ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2025-07-10 16:30:01, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NM_001401062 2498 bp mRNA linear ROD 31-MAR-2024
DEFINITION Rattus norvegicus janus kinase and microtubule interacting protein
1 (Jakmip1), transcript variant 5, mRNA.
ACCESSION NM_001401062
VERSION NM_001401062.1
KEYWORDS RefSeq.
SOURCE Rattus norvegicus (Norway rat)
ORGANISM Rattus norvegicus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Rattus.
REFERENCE 1 (bases 1 to 2498)
AUTHORS Berg,J.M., Lee,C., Chen,L., Galvan,L., Cepeda,C., Chen,J.Y.,
Penagarikano,O., Stein,J.L., Li,A., Oguro-Ando,A., Miller,J.A.,
Vashisht,A.A., Starks,M.E., Kite,E.P., Tam,E., Gdalyahu,A.,
Al-Sharif,N.B., Burkett,Z.D., White,S.A., Fears,S.C., Levine,M.S.,
Wohlschlegel,J.A. and Geschwind,D.H.
TITLE JAKMIP1, a Novel Regulator of Neuronal Translation, Modulates
Synaptic Function and Autistic-like Behaviors in Mouse
JOURNAL Neuron 88 (6), 1173-1191 (2015)
PUBMED 26627310
REFERENCE 2 (bases 1 to 2498)
AUTHORS Vidal,R.L., Fuentes,P., Valenzuela,J.I., Alvarado-Diaz,C.P.,
Ramirez,O.A., Kukuljan,M. and Couve,A.
TITLE RNA interference of Marlin-1/Jakmip1 results in abnormal
morphogenesis and migration of cortical pyramidal neurons
JOURNAL Mol Cell Neurosci 51 (1-2), 1-11 (2012)
PUBMED 22828129
REMARK GeneRIF: RNA interference of Marlin-1 in vivo results in abnormal
migration and abnormal morphology of newborn pyramidal neurons
during the formation of the cortex.
REFERENCE 3 (bases 1 to 2498)
AUTHORS Vidal,R.L., Valenzuela,J.I., Lujan,R. and Couve,A.
TITLE Cellular and subcellular localization of Marlin-1 in the brain
JOURNAL BMC Neurosci 10, 37 (2009)
PUBMED 19386132
REMARK GeneRIF: Marlin-1 is enriched in restricted areas of the brain
including olfactory bulb, cerebral cortex, hippocampus and
cerebellum; it is abundant in dendrites and axons of hippocampal
neurons, associated with microtubules at the ultrastructural level.
Publication Status: Online-Only
REFERENCE 4 (bases 1 to 2498)
AUTHORS Vidal,R.L., Ramirez,A., Castro,M., Concha,I.I. and Couve,A.
TITLE Marlin-1 is expressed in testis and associates to the cytoskeleton
and GABAB receptors
JOURNAL J Cell Biochem 103 (3), 886-895 (2008)
PUBMED 17668444
REMARK GeneRIF: Our findings demonstrate that Marlin-1 associates with a
microtubule fraction and with GABA(B) receptors in testis
suggesting that the set of protein interactions of Marlin-1 are
conserved in different tissues.
REFERENCE 5 (bases 1 to 2498)
AUTHORS Nishimura,Y., Martin,C.L., Vazquez-Lopez,A., Spence,S.J.,
Alvarez-Retuerto,A.I., Sigman,M., Steindler,C., Pellegrini,S.,
Schanen,N.C., Warren,S.T. and Geschwind,D.H.
TITLE Genome-wide expression profiling of lymphoblastoid cell lines
distinguishes different forms of autism and reveals shared pathways
JOURNAL Hum Mol Genet 16 (14), 1682-1698 (2007)
PUBMED 17519220
REFERENCE 6 (bases 1 to 2498)
AUTHORS Vidal,R.L., Ramirez,O.A., Sandoval,L., Koenig-Robert,R., Hartel,S.
and Couve,A.
TITLE Marlin-1 and conventional kinesin link GABAB receptors to the
cytoskeleton and regulate receptor transport
JOURNAL Mol Cell Neurosci 35 (3), 501-512 (2007)
PUBMED 17532644
REFERENCE 7 (bases 1 to 2498)
AUTHORS Couve,A., Restituito,S., Brandon,J.M., Charles,K.J., Bawagan,H.,
Freeman,K.B., Pangalos,M.N., Calver,A.R. and Moss,S.J.
TITLE Marlin-1, a novel RNA-binding protein associates with GABA
receptors
JOURNAL J Biol Chem 279 (14), 13934-13943 (2004)
PUBMED 14718537
REMARK GeneRIF: Marlin-1 functions to regulate the cellular levels of
GABA(B) R2 subunits, which may have significant effects on the
production of functional GABA(B) receptor heterodimers.
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
JAXUCZ010000014.1.
Sequence Note: The RefSeq transcript and protein were derived from
genomic sequence to make the sequence consistent with the reference
genome assembly. The genomic coordinates used for the transcript
record were based on alignments.
##Evidence-Data-START##
Transcript exon combination :: SRR26360176.2456791.1,
SRR26360172.1974318.1 [ECO:0000332]
RNAseq introns :: mixed sample support SAMEA5760383,
SAMEA5760389 [ECO:0006172]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-248 JAXUCZ010000014.1 77991278-77991525 c
249-511 JAXUCZ010000014.1 77931831-77932093 c
512-1006 JAXUCZ010000014.1 77925770-77926264 c
1007-1216 JAXUCZ010000014.1 77916154-77916363 c
1217-1336 JAXUCZ010000014.1 77915107-77915226 c
1337-1483 JAXUCZ010000014.1 77912567-77912713 c
1484-1624 JAXUCZ010000014.1 77911748-77911888 c
1625-1684 JAXUCZ010000014.1 77910278-77910337 c
1685-1813 JAXUCZ010000014.1 77900084-77900212 c
1814-1942 JAXUCZ010000014.1 77898614-77898742 c
1943-2026 JAXUCZ010000014.1 77896569-77896652 c
2027-2089 JAXUCZ010000014.1 77895378-77895440 c
2090-2498 JAXUCZ010000014.1 77893492-77893900 c
FEATURES Location/Qualifiers
source 1..2498
/organism="Rattus norvegicus"
/mol_type="mRNA"
/strain="BN"
/db_xref="taxon:10116"
/chromosome="14"
/map="14q21"
gene 1..2498
/gene="Jakmip1"
/gene_synonym="Marlin-1; Marlin1"
/note="janus kinase and microtubule interacting protein 1"
/db_xref="GeneID:305434"
/db_xref="RGD:1562401"
exon 1..248
/gene="Jakmip1"
/gene_synonym="Marlin-1; Marlin1"
/inference="alignment:Splign:2.1.0"
exon 249..511
/gene="Jakmip1"
/gene_synonym="Marlin-1; Marlin1"
/inference="alignment:Splign:2.1.0"
misc_feature 344..346
/gene="Jakmip1"
/gene_synonym="Marlin-1; Marlin1"
/note="upstream in-frame stop codon"
CDS 383..2263
/gene="Jakmip1"
/gene_synonym="Marlin-1; Marlin1"
/note="isoform 5 is encoded by transcript variant 5;
multiple alpha helices and RNA-linker protein 1; multiple
coiled-coil GABABR1-binding protein"
/codon_start=1
/product="janus kinase and microtubule-interacting protein
1 isoform 5"
/protein_id="NP_001387991.1"
/db_xref="GeneID:305434"
/db_xref="RGD:1562401"
/translation="
MSKKGRSKGEKPETETDSVQMANEELRAKLTNIQIEFQQEKSKVGKLRERLQEAKLEREQEQRRHTAYISELKAKLHEEKTKELQALREALIRQHEQEAARTAKIKEGELQRLQATLNVLRDGAADKVKTALLADAREEARRTFDGERQRLQQEILELKAARKQAEEALSNCMQADKAKAADLRAAYQAHQDEVHRIKRECERDIRRLMDEIKGKERVILALEKELGVQAGQTQRLLLQKEALDEQLVQVKEAERHHSSPKRELPPGIGDMAELMGGQDQHMDERDVRRFQLKIAELNSVIRKLEDRNTLLADERNELLKRSRETEVQLKPLVEKNKRMNKKNEDLLHSIQRMEEKLKSLTRENVEMKEKLSAQASLKRHTSLNDLSLTRDEQEIEFLRLQVLEQQHVIDDLSLERERLLRSKRHRGKSLKPPKKHVVETFFGFDEESVDSETLSETSYNTDRTDRTPATPEEDLDETTTREEADLRFCQLTREYQALQRAYALLQEQVGGTLDAEREARTREQLQADLLRCQAKIEDLEKLLVEKGQDAAWVEEKQVLMRTNQDLLEKIYRLEMEENQLKSEMQDAKDQNELLEFRVLELEVRDSICCKLSNGADILFEPKLKFV"
misc_feature 383..1477
/gene="Jakmip1"
/gene_synonym="Marlin-1; Marlin1"
/note="propagated from UniProtKB/Swiss-Prot (Q3SWS9.1);
Region: Mediates association with microtubules.
/evidence=ECO:0000250"
misc_feature 383..457
/gene="Jakmip1"
/gene_synonym="Marlin-1; Marlin1"
/note="propagated from UniProtKB/Swiss-Prot (Q3SWS9.1);
Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
misc_feature <452..>2203
/gene="Jakmip1"
/gene_synonym="Marlin-1; Marlin1"
/note="Chromosome segregation ATPase Smc [Cell cycle
control, cell division, chromosome partitioning]; Region:
Smc; COG1196"
/db_xref="CDD:440809"
misc_feature 1475..2260
/gene="Jakmip1"
/gene_synonym="Marlin-1; Marlin1"
/note="propagated from UniProtKB/Swiss-Prot (Q3SWS9.1);
Region: Mediates interaction with TYK2 and GABBR1.
/evidence=ECO:0000250"
misc_feature 1526..1528
/gene="Jakmip1"
/gene_synonym="Marlin-1; Marlin1"
/note="Phosphoserine.
/evidence=ECO:0000250|UniProtKB:Q96N16; propagated from
UniProtKB/Swiss-Prot (Q3SWS9.1); phosphorylation site"
misc_feature 1625..2197
/gene="Jakmip1"
/gene_synonym="Marlin-1; Marlin1"
/note="JAKMIP CC3 domain; Region: JAKMIP_CC3; pfam16034"
/db_xref="CDD:464986"
misc_feature 1736..1825
/gene="Jakmip1"
/gene_synonym="Marlin-1; Marlin1"
/note="propagated from UniProtKB/Swiss-Prot (Q3SWS9.1);
Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
misc_feature 1790..1792
/gene="Jakmip1"
/gene_synonym="Marlin-1; Marlin1"
/note="Phosphothreonine.
/evidence=ECO:0000250|UniProtKB:Q96N16; propagated from
UniProtKB/Swiss-Prot (Q3SWS9.1); phosphorylation site"
exon 512..1006
/gene="Jakmip1"
/gene_synonym="Marlin-1; Marlin1"
/inference="alignment:Splign:2.1.0"
exon 1007..1216
/gene="Jakmip1"
/gene_synonym="Marlin-1; Marlin1"
/inference="alignment:Splign:2.1.0"
exon 1217..1336
/gene="Jakmip1"
/gene_synonym="Marlin-1; Marlin1"
/inference="alignment:Splign:2.1.0"
exon 1337..1483
/gene="Jakmip1"
/gene_synonym="Marlin-1; Marlin1"
/inference="alignment:Splign:2.1.0"
exon 1484..1624
/gene="Jakmip1"
/gene_synonym="Marlin-1; Marlin1"
/inference="alignment:Splign:2.1.0"
exon 1625..1684
/gene="Jakmip1"
/gene_synonym="Marlin-1; Marlin1"
/inference="alignment:Splign:2.1.0"
exon 1685..1813
/gene="Jakmip1"
/gene_synonym="Marlin-1; Marlin1"
/inference="alignment:Splign:2.1.0"
exon 1814..1942
/gene="Jakmip1"
/gene_synonym="Marlin-1; Marlin1"
/inference="alignment:Splign:2.1.0"
exon 1943..2026
/gene="Jakmip1"
/gene_synonym="Marlin-1; Marlin1"
/inference="alignment:Splign:2.1.0"
exon 2027..2089
/gene="Jakmip1"
/gene_synonym="Marlin-1; Marlin1"
/inference="alignment:Splign:2.1.0"
exon 2090..2498
/gene="Jakmip1"
/gene_synonym="Marlin-1; Marlin1"
/inference="alignment:Splign:2.1.0"
ORIGIN
agccgctagcgtgcggcgcctgtccccgccgttcccgcatcgtgcacgggttctccgcgggccgagcctcctcggctacggtccaggttttctttattttcattttttgcatgcattcattttctgttctatcttgtcccttttaaggcagcggtgactgggacagcagcgtaggcgcgcgcggggaggaggcggctggagaatgcggctcccggctgctgcccggtttgggtcggagcgtcaagcagactctccagtgatggtgtgcacagaggacgagcggaggcctgcacgactgcttagcacagctgagctggtagctgtgcttgccggtgggcaggcgtgaacctcaggacctcagcgtctcactccaagaggaaacatgtctaaaaagggccgcagcaagggtgagaagcccgagacagagacagactctgtacagatggccaatgaagagctacgggccaagctgacgaacatccagatcgagttccagcaggagaagagcaaggtggggaagctgcgggagcgtctgcaggaggccaagctggaacgggagcaggagcagcgtcgccacacggcctacatctcagaactcaaggccaagctgcacgaagagaagacgaaggaactgcaggcgctgcgcgaggcgctcatccggcagcacgagcaggaggcagcgcggaccgccaagatcaaggaaggcgagctgcagcgactgcaggccacgctgaatgtgctgcgcgatggcgccgcggacaaagtcaagactgcattgctggccgacgcgcgcgaggaggcgcgcaggacctttgatggcgagcgccagaggctgcagcaggagattctggaactgaaggctgcgcgcaaacaggcagaagaggcactcagcaactgcatgcaggcagacaaggccaaagccgcggacctgcgcgctgcgtaccaggcgcaccaggatgaggtgcaccgcatcaagcgggagtgtgaacgtgacatccgcagactgatggacgagatcaaaggaaaggaacgcgtgatcctggccctggagaaggagcttggtgtgcaggccgggcagacccagcggctgctattacagaaggaggctctggatgagcagctggtccaggtcaaggaggccgaacgccaccacagcagcccaaagagggagcttcctccaggcattggtgacatggctgagcttatgggtggccaggatcagcatatggacgagcgagatgtgaggcgatttcagctgaagattgccgaactgaattcagtgattcggaagctggaggacaggaacaccctgctggctgatgagaggaacgaactgctgaagcgctctcgggagacggaggtgcagctgaagccgctggtggagaagaacaaacgcatgaataaaaagaacgaggatctgctgcacagcatccaaaggatggaggagaaactcaagagcctcacgagggaaaacgtggagatgaaagaaaagctgtctgcccaggcctcactaaagcgacacacatccctgaatgacctcagtctgaccagggacgagcaggagatagagttcctgaggctgcaggtgctggaacagcagcatgtcattgatgacctctctctggaaagagaacgcctgctgcgctccaagaggcatcgagggaagagcctgaaaccccccaagaagcatgttgtggagacattttttggatttgatgaggagtctgtggactctgaaacattgtcagagacgtcctacaacacagacaggacagaccggaccccagccacgcctgaagaggacttagatgagaccacaaccagagaagaggctgacctgaggttctgccagctgaccagggagtaccaggctctgcagagggcttatgccctgcttcaggagcaggttggggggacgctggatgctgagagggaggctcggactcgggagcaacttcaggctgacctgctgagatgccaggccaaaattgaggacttagagaagctgctggttgagaagggacaggatgctgcgtgggtagaggagaagcaggtactcatgaggacaaaccaggacctgctggagaagatttacaggctggagatggaggagaaccagctaaagagtgaaatgcaagacgccaaggaccagaacgagctgttagaattcagagtgctagaactcgaagtaagagactctatctgttgtaagctctcaaatggagcagacattctctttgagcccaaactgaaattcgtgtaaagctctctgctatttccaagcatgcgtgaagggacgcgcgttaccgtttctctccttccttcctccgttcttttcctcttcgtctttttaaaaagatctgtatgttcggggtaacttcactgccttaacatgtcctggggaggatgctcgcgacgcctgtggacctgtaccagagcaatcgacttattgcctaccgcttgttttgcacttaataaaataagttgtttttgcaata
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]