GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-10-29 02:37:56, GGRNA.v2 : RefSeq release 207 (Jul, 2021)

LOCUS       NM_001394957            1659 bp    mRNA    linear   ROD 12-MAY-2021
DEFINITION  Rattus norvegicus one cut homeobox 3 (Onecut3), mRNA.
ACCESSION   NM_001394957
VERSION     NM_001394957.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1659)
  AUTHORS   Vanhorenbeeck V, Jacquemin P, Lemaigre FP and Rousseau GG.
  TITLE     OC-3, a novel mammalian member of the ONECUT class of transcription
            factors
  JOURNAL   Biochem Biophys Res Commun 292 (4), 848-854 (2002)
   PUBMED   11944891
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JACYVU010000177.1.
            
            ##Evidence-Data-START##
            RNAseq introns :: single sample supports all introns SAMEA5756307,
                              SAMN06680421 [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            inferred exon combination :: based on alignments, homology
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1331              JACYVU010000177.1  4376921-4378251     c
            1332-1659           JACYVU010000177.1  4358945-4359272     c
FEATURES             Location/Qualifiers
     source          1..1659
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="7"
                     /map="7"
     gene            1..1659
                     /gene="Onecut3"
                     /note="one cut homeobox 3"
                     /db_xref="GeneID:120093758"
                     /db_xref="RGD:1591005"
     exon            1..1331
                     /gene="Onecut3"
                     /inference="alignment:Splign:2.1.0"
     CDS             146..1621
                     /gene="Onecut3"
                     /note="one cut domain, family member 3"
                     /codon_start=1
                     /product="one cut homeobox 3"
                     /protein_id="NP_001381886.1"
                     /db_xref="GeneID:120093758"
                     /db_xref="RGD:1591005"
                     /translation="
MELSLESLGGLHGVTHAQAGELLSPGHARSAAAQHRSLVASGRPGLVAGMASLLDGGGAGGGGAGGAGAAGAAGGGPDFRGELAGPLHPAMGMACEAPGLGGTYTTLTPLQHLPPLAAVADKFHQHAVAGAHGGHPHAHPHPATAPPPPPPQRLAASVSGSFTLMRDERAALASVGHLYGPYGKELPTMGSPLSPLPSALPPALHSAPQPPPPPPPLAAYGAPGHLAGDKLLPPAAFEPHAALLGRAEDALARGLPGGGGGAGGGGAAGGAAAGLLAPLGGLATAGAHGPHSGGGGPGGGGGAGGGSGGPGAGAAAEEINTKEVAQRITAELKRYSIPQAIFAQRILCRSQGTLSDLLRNPKPWSKLKSGRETFRRMWKWLQEPEFQRMSALRLAACKRKEQDQQKERALQPKKQRLVFTDLQRRTLIAIFKENKRPSKEMQATISQQLGLELNTVSNFFMNARRRCMNRWAEEPGATPGTATATATFSKA"
     exon            1332..1659
                     /gene="Onecut3"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
acatcctggtggccgctgctcgcagcagccgaagccgggcgagagcactgaacgagcgggacagcagccgccgccacggagagcgccggccagtgcgtggggaccatgctgcggccttgagcacacacggagggggtcgcccaggatggagttgagcttggagagcctcggggggctgcacggggtgacacacgcgcaagccggcgagctgctgagcccgggccacgcgcgctccgccgcggcccaacaccgaagcctagtggcatcggggcgtccgggcctggtggcgggcatggctagcctgctggacggtggtggcgccggaggcgggggggccgggggcgcgggagctgcaggggccgcgggtggtggccctgacttccgtggggagctggctggccccctgcacccggccatgggtatggcgtgcgaggccccaggtttgggtggcacctacaccacgctcacgcccttgcagcacctgccgccgctggccgcggtggccgacaagttccaccagcacgcggtggccggggcgcacggaggccatccgcacgcgcaccctcacccggccaccgcgccgccaccgccccctccgcagcgcctggcggccagcgtgagcggcagcttcaccctcatgcgcgacgagcgggcggcgctggcctcggtgggccacctctacgggccctatggcaaggagctgcccaccatggggtcgccactgtcgccgctgcccagcgcgctgcccccggctctgcacagcgccccgcagccgccgccgccgccgccgccgctcgccgcttacggggctccgggccacctggccggggacaaactactgccacctgccgctttcgagccacacgccgcgctgcttgggcgcgcggaggacgcgctggcccgagggctgcctggaggcggcggcggcgcgggaggtggcggggcggccggcggggcggccgcgggtttgctggctccgctgggcgggctggctacggccggggcgcacgggcctcactcaggcggcggtggccccggagggggcgggggcgccggcggcggcagcggcggtccgggagcaggcgccgcagccgaagaaatcaacaccaaagaggtggcccagcgcatcaccgccgagctgaagcgctacagcatccctcaggccatcttcgcgcagcgtatcctgtgccgctcgcagggcacgctctcggacctgctgcgcaacccgaagccctggagcaagctcaaatccggccgcgagaccttccgcaggatgtggaagtggctgcaggagcccgagttccagcgcatgtcggcgctgcgcctggcagcctgcaagcgtaaggagcaggatcagcagaaagagagggctctgcaaccgaagaagcaacgcctcgtgttcacagacctgcagcgccgcacgctgatcgccatcttcaaggagaacaagcggccctccaaggagatgcaagccaccatctcgcagcagctgggcctggagctcaacacggtcagcaacttcttcatgaacgcccgtcgccgctgcatgaaccgctgggctgaggagccgggtgccacccctggcaccgcaacagccacagccaccttctccaaggcctgagccttctgcccgacacttaccccagcccccggggaccg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]