LOCUS       NM_001393886            1796 bp    mRNA    linear   ROD 19-MAR-2021
DEFINITION  Rattus norvegicus sequestosome 1 (Sqstm1), transcript variant 5,
            mRNA.
ACCESSION   NM_001393886 XM_006246215
VERSION     NM_001393886.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1796)
  AUTHORS   Feng X, Chen L, Guo W, Zhang Y, Lai X, Shao L and Li Y.
  TITLE     Graphene oxide induces p62/SQSTM-dependent apoptosis through the
            impairment of autophagic flux and lysosomal dysfunction in PC12
            cells
  JOURNAL   Acta Biomater 81, 278-292 (2018)
   PUBMED   30273743
  REMARK    GeneRIF: Graphene oxide induces p62/SQSTM-dependent apoptosis
            through the impairment of autophagic flux and lysosomal dysfunction
            in PC12 cells.
REFERENCE   2  (bases 1 to 1796)
  AUTHORS   Bresciani A, Spiezia MC, Boggio R, Cariulo C, Nordheim A, Altobelli
            R, Kuhlbrodt K, Dominguez C, Munoz-Sanjuan I, Wityak J, Fodale V,
            Marchionini DM and Weiss A.
  TITLE     Quantifying autophagy using novel LC3B and p62 TR-FRET assays
  JOURNAL   PLoS One 13 (3), e0194423 (2018)
   PUBMED   29554128
  REMARK    GeneRIF: Quantifying autophagy using novel LC3B and p62 TR-FRET
            assays.
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1796)
  AUTHORS   Chung H, Choi J and Park S.
  TITLE     Ghrelin protects adult rat hippocampal neural stem cells from
            excessive autophagy during oxygen-glucose deprivation
  JOURNAL   Endocr J 65 (1), 63-73 (2018)
   PUBMED   29057768
  REMARK    GeneRIF: Data suggest that neuroprotection via ghrelin involves
            up-regulation of Bcl-2 (B cell lymphoma 2 associated oncogene) and
            p-62/Sqstm1 (ubiquitin-binding protein p62) plus down-regulation of
            LC3-II (microtubule-associated protein 1 light chain 3) and
            Beclin-1. Studies were conducted in adult hippocampal neural stem
            cells in primary culture.
REFERENCE   4  (bases 1 to 1796)
  AUTHORS   Ha S, Jeong SH, Yi K, Chung KM, Hong CJ, Kim SW, Kim EK and Yu SW.
  TITLE     Phosphorylation of p62 by AMP-activated protein kinase mediates
            autophagic cell death in adult hippocampal neural stem cells
  JOURNAL   J Biol Chem 292 (33), 13795-13808 (2017)
   PUBMED   28655770
  REMARK    GeneRIF: Data suggest that phosphorylation of Sqstm1 by
            AMP-activated protein kinase (AMPK) and translocation of Sqstm1 to
            mitochondria drives autophagic cell death in adult hippocampal
            neural stem cells; activation of AMPK promotes autophagic cell
            death; inhibition of AMPK (by enzyme inhibitor or RNA interference)
            suppresses autophagic cell death. (Sqstm1 = sequestosome 1)
REFERENCE   5  (bases 1 to 1796)
  AUTHORS   Liu X, Li Y, Wang X, Xing R, Liu K, Gan Q, Tang C, Gao Z, Jian Y,
            Luo S, Guo W and Yang C.
  TITLE     The BEACH-containing protein WDR81 coordinates p62 and LC3C to
            promote aggrephagy
  JOURNAL   J Cell Biol 216 (5), 1301-1320 (2017)
   PUBMED   28404643
REFERENCE   6  (bases 1 to 1796)
  AUTHORS   Wooten MW, Seibenhener ML, Mamidipudi V, Diaz-Meco MT, Barker PA
            and Moscat J.
  TITLE     The atypical protein kinase C-interacting protein p62 is a scaffold
            for NF-kappaB activation by nerve growth factor
  JOURNAL   J Biol Chem 276 (11), 7709-7712 (2001)
   PUBMED   11244088
REFERENCE   7  (bases 1 to 1796)
  AUTHORS   Kuusisto E, Suuronen T and Salminen A.
  TITLE     Ubiquitin-binding protein p62 expression is induced during
            apoptosis and proteasomal inhibition in neuronal cells
  JOURNAL   Biochem Biophys Res Commun 280 (1), 223-228 (2001)
   PUBMED   11162503
REFERENCE   8  (bases 1 to 1796)
  AUTHORS   Gong J, Xu J, Bezanilla M, van Huizen R, Derin R and Li M.
  TITLE     Differential stimulation of PKC phosphorylation of potassium
            channels by ZIP1 and ZIP2
  JOURNAL   Science 285 (5433), 1565-1569 (1999)
   PUBMED   10477520
REFERENCE   9  (bases 1 to 1796)
  AUTHORS   Nakaso K, Kitayama M, Ishii T, Bannai S, Yanagawa T, Kimura K,
            Nakashima K, Ohama E and Yamada K.
  TITLE     Effects of kainate-mediated excitotoxicity on the expression of rat
            counterparts of A170 and MSP23 stress proteins in the brain
  JOURNAL   Brain Res Mol Brain Res 69 (2), 155-163 (1999)
   PUBMED   10366737
REFERENCE   10 (bases 1 to 1796)
  AUTHORS   Joung I, Strominger JL and Shin J.
  TITLE     Molecular cloning of a phosphotyrosine-independent ligand of the
            p56lck SH2 domain
  JOURNAL   Proc Natl Acad Sci U S A 93 (12), 5991-5995 (1996)
   PUBMED   8650207
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JACYVU010000219.1.
            On Mar 19, 2021 this sequence version replaced XM_006246215.3.
            
            Summary: interacts with PKC-zeta and GABA(C) receptors to form
            ternary postsynaptic complex in the retina [RGD, Feb 2006].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR8487231.146512.1 [ECO:0000332]
            ##Evidence-Data-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-233               JACYVU010000219.1  22569752-22569984   c
            234-329             JACYVU010000219.1  22567698-22567793   c
            330-556             JACYVU010000219.1  22567230-22567456   c
            557-698             JACYVU010000219.1  22566986-22567127   c
            699-919             JACYVU010000219.1  22561454-22561674   c
            920-1001            JACYVU010000219.1  22561170-22561251   c
            1002-1796           JACYVU010000219.1  22558831-22559625   c
FEATURES             Location/Qualifiers
     source          1..1796
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="10"
                     /map="10q22"
     gene            1..1796
                     /gene="Sqstm1"
                     /gene_synonym="Osi; ZIP; ZIP3"
                     /note="sequestosome 1"
                     /db_xref="GeneID:113894"
                     /db_xref="RGD:69287"
     exon            1..233
                     /gene="Sqstm1"
                     /gene_synonym="Osi; ZIP; ZIP3"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    23..25
                     /gene="Sqstm1"
                     /gene_synonym="Osi; ZIP; ZIP3"
                     /note="upstream in-frame stop codon"
     CDS             35..1159
                     /gene="Sqstm1"
                     /gene_synonym="Osi; ZIP; ZIP3"
                     /note="isoform 5 is encoded by transcript variant 5;
                     oxidative stress induced; protein kinase
                     C-zeta-interacting protein; ubiquitin-binding protein p62;
                     PKC-zeta-interacting protein"
                     /codon_start=1
                     /product="sequestosome-1 isoform 5"
                     /protein_id="NP_001380815.1"
                     /db_xref="GeneID:113894"
                     /db_xref="RGD:69287"
                     /translation="

MASLTVKAYLLGKEEAAREIRRFSFCFSPEPEAEAAAGPGPCERLLSRVAVLFPALRPGGFQAHYRDEDGDLVAFSSDEELTMAMSYVKDDIFRIYIKEKKECRREHRPPCAQEARSMVHPNVICDGCNGPVVGTRYKCSVCPDYDLCSVCEGKGLHREHSKLIFPNPFGHLSDSFSHSRWLRKLKHGHFGWPGWEMGPPGNWSPRPPRAGDGRPCPTAESGIEVDIDVEHGGKRSRLTPTSAESSSTGTEDKSGTQPSSCSSEVSKPDGAGEGPAQSLTEQMKKIALESVGQPEELMESDNCSGGDDDWTHLSSKEVDPSTEADPRLIESLSQMLSMGFSDEGGWLTRLLQTKNYDIGAALDTIQYSKHPPPL"

     exon            234..329
                     /gene="Sqstm1"
                     /gene_synonym="Osi; ZIP; ZIP3"
                     /inference="alignment:Splign:2.1.0"
     exon            330..556
                     /gene="Sqstm1"
                     /gene_synonym="Osi; ZIP; ZIP3"
                     /inference="alignment:Splign:2.1.0"
     exon            557..698
                     /gene="Sqstm1"
                     /gene_synonym="Osi; ZIP; ZIP3"
                     /inference="alignment:Splign:2.1.0"
     exon            699..919
                     /gene="Sqstm1"
                     /gene_synonym="Osi; ZIP; ZIP3"
                     /inference="alignment:Splign:2.1.0"
     exon            920..1001
                     /gene="Sqstm1"
                     /gene_synonym="Osi; ZIP; ZIP3"
                     /inference="alignment:Splign:2.1.0"
     exon            1002..1796
                     /gene="Sqstm1"
                     /gene_synonym="Osi; ZIP; ZIP3"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

gcccagctgtttcctccgtacctagtctgcggttatggcttcgctcacggtgaaggcctatctactgggcaaggaggaggcggcccgcgagatccgccgcttcagcttctgcttcagcccggagccggaggcggaagccgcggctggcccggggccctgcgagaggctgctgagccgggtggctgtgctgttccccgcgctgcggcctggaggctttcaggcgcactaccgcgatgaggatggggacttggtcgccttctccagtgatgaggaactgacaatggccatgtcctatgtgaaagatgacatcttccgcatctacattaaagagaagaaggagtgccggcgggaacatcgccccccatgtgctcaggaggcacgaagcatggtgcaccccaacgtgatttgtgatggttgcaatgggcctgtggtgggaactcgctataagtgcagtgtgtgccccgactacgacctgtgcagcgtctgcgaggggaagggcctgcacagggagcacagcaagctcatctttcccaacccctttggccacctctctgatagcttctctcatagccgctggcttcggaagctgaaacatgggcactttggctggcctggctgggagatgggcccaccagggaactggagcccacgtcctcctcgcgcaggggatggtcgcccttgccccacagctgagtcgggcatcgaggttgacattgatgtggaacatggagggaagagaagccgcctgacacccacctctgcagaaagttccagcacaggcacagaagataagagtggtactcagccaagcagctgctcttcggaagtcagcaaacctgacggggccggggagggccctgctcagtctctgacagagcagatgaagaagatagccttggagtcggtgggacagccagaggaactgatggagtcggataactgctcaggaggggatgacgactggacgcatttgtcttctaaagaagtggacccatccacagaggctgatccccggctgattgagtcactctctcagatgctgtccatgggtttctcggatgaaggcggctggctcaccaggctcctacagaccaagaattatgacatcggggctgctctggacacgatccagtattcaaagcaccctccaccattgtgacagtgctgtggccaagtcccacaacccacctcccttgtcttctagttgcatcatgtagagtagcagggcttctaaggcccagtgtcttggcattcttctagaaccttcaggtgggactgtgaggccttcttaggcagtaggaaagtgcatgagaagagagtctgagtgtgcacatgctgacccctgagcacagatccaagcagctgtggctgggcttccgctgctttccctcggcctggcctttgccagggagctgtggagtcatgctgcactccacttgctcttgccgccagcattgcacctgcagtccatcatccctgcctgataaccttctgtgttttctttattaaaagggattagtacaactgatagttattttcaacaaataaagccattatgtttagagggggactgtcctcagtgagtgaaaggtggcaggctaccggggcctacggctcctgggtgatggagaacttaggtgaagccaactgaaagatcttatcattcactgtgcccccttttaatggccagtttagtttttgtgtctaatgttaatgcttaaagtacaaaccccctatgtagcttcctctgacttgatttttaagtaacctgtaataaagtggcatatgcactttaa

//