GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-10-29 02:25:30, GGRNA.v2 : RefSeq release 207 (Jul, 2021)

LOCUS       NM_001393802            2802 bp    mRNA    linear   ROD 12-MAR-2021
DEFINITION  Rattus norvegicus Rhox homeobox family member 7 (Rhox7), mRNA.
ACCESSION   NM_001393802 XM_039099574
VERSION     NM_001393802.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JACYVU010000455.1.
            On Mar 12, 2021 this sequence version replaced XM_039099574.1.
            
            ##Evidence-Data-START##
            RNAseq introns :: mixed/partial sample support SAMEA5760383,
                              SAMEA5760389 [ECO:0000350]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-70                JACYVU010000455.1  1592626-1592695     c
            71-2501             JACYVU010000455.1  1587642-1590072     c
            2502-2547           JACYVU010000455.1  1585846-1585891     c
            2548-2802           JACYVU010000455.1  1584619-1584873     c
FEATURES             Location/Qualifiers
     source          1..2802
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="X"
                     /map="X"
     gene            1..2802
                     /gene="Rhox7"
                     /note="Rhox homeobox family member 7"
                     /db_xref="GeneID:298353"
                     /db_xref="RGD:1563189"
     CDS             1..2670
                     /gene="Rhox7"
                     /note="reproductive homeobox on X chromosome 7;
                     reproductive homeobox 7"
                     /codon_start=1
                     /product="Rhox homeobox family member 7"
                     /protein_id="NP_001380731.1"
                     /db_xref="GeneID:298353"
                     /db_xref="RGD:1563189"
                     /translation="
MWFSNRRAKERACEKKAMPRSIPGAKAQMILPAGEGRNGEESERSSPGQEASATKWGEVEELGERDRTGSDGENLSAVGTSGIRNDWDKEGASSSRQKNESRPQKPVPECRWGMEDVQPVPVLIPRVQRIQLVQSRVQSVPLKVPVVRPVPIPALSVQPIPISVPKVQPMPITVPQVQAIPPAVPPAQPVPTTVSQDPTGPIPEPHVQPVPVTAPPPQPVPLTTPPPQPVPVTAPPPQGMSIRVPHVQPVPVTAPPSQAMPIRVPHVQPVPVTTPPSQAMPIRVPHVQPVPVSAPPSQAMPIRVPQVQPVSVTAPLSQGMSIRVPHVQPVPVTAPLSQGMPVRVPHVQPVPVSAPLSQAMPIRVPHVQPVPVTALPPQPVPLTAPTPWAVPTRLPHAQPVPVTPAPPQTMPVRVPHVQPLPRTAPLSQAIPIRVPHVQPVPVTTPPSQTMALTAPRSQAMPITVPHVQPVPISLPHVRPMPIPWHYVQPMPDSVPHVQPMALTVPHARHMPVPVPHVHPMPVTVPHVQPMPFPVPQALSMPFPVPQALSMPFPVPQALSMPFPVHQALSMPVPVPVPQVQPVPVTVPHTQRIRGPVPRVQTLPPSVTQSESIPVTVSSIQPKPTTVPRAHRICVPHVQILPPPVTQSESMADTVSPLQPMPVTVPHAQRIRGPVPCVQTLPNSVPQSESMAVTVPTAQTMPPTVPHKERMPGPGPHVQSLLPPVPHEHPMPFTVHQAQPMPVSVSNAQHIPAKESSTPHVPVPREQTSPVGMNCVRPIPNAAPRIRPVAVSATTVQPEPVLVPRRHLHDRFTDPELQELERVFQRNHYLSAEERKELARVMGVSEAKVQRWFKKRREHFRREQSQSGGAPPGNTPPLSEDGAGALVYHP"
     misc_feature    <745..1935
                     /gene="Rhox7"
                     /note="large tegument protein UL36; Provisional; Region:
                     PHA03247"
                     /db_xref="CDD:223021"
     misc_feature    <1924..>2424
                     /gene="Rhox7"
                     /note="antigen I/II family LPXTG-anchored adhesin; Region:
                     Streccoc_I_II; NF033804"
                     /db_xref="CDD:411384"
     misc_feature    2428..2589
                     /gene="Rhox7"
                     /note="Homeodomain; DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:238039"
     misc_feature    order(2428..2430,2548..2550,2557..2562,2569..2571)
                     /gene="Rhox7"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     exon            1..70
                     /gene="Rhox7"
                     /inference="alignment:Splign:2.1.0"
     exon            71..2501
                     /gene="Rhox7"
                     /inference="alignment:Splign:2.1.0"
     exon            2502..2547
                     /gene="Rhox7"
                     /inference="alignment:Splign:2.1.0"
     exon            2548..2802
                     /gene="Rhox7"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
atgtggtttagcaataggagagccaaagagagggcctgtgagaagaaagcaatgcccaggagcataccaggtgcgaaagcacagatgatcttgcccgctggagagggaagaaatggggaagagagtgaacggtcgtcccctgggcaggaggcttcagcaacaaaatggggagaagtagaagaactgggagaaagggacagaacggggagtgatggagaaaatctttctgctgtaggaacttcaggcatcaggaatgactgggacaaagagggtgccagcagcagtaggcagaagaatgagagtcggcctcagaagccagtccctgagtgtaggtggggcatggaggatgtacagccagtgccagtactgattccccgtgtacaacggatacaacttgtgcaatcccgggtacagtcggtgcccctaaaggtacctgttgtacggcctgtgcccattcctgcgctcagtgtacagcctataccaatcagtgtgcccaaggtccagcctatgcccattactgtgccccaagtacaggctataccacctgctgtgcccccagcacagcctgtgccaaccactgtgtcccaggaccccactgggcccattcctgagccccatgtacaacctgtgccagttactgctcccccaccacagcctgtgccacttactactcccccaccacagcctgtgccagttactgctcccccaccacagggtatgtcaatcagagtgccccatgtacagcctgtgccagttactgctcccccatcacaggctatgccaatcagagtgccccatgtacagcctgtgccagttactactcccccatcacaggctatgcctatccgagtgccccatgtacagcctgtgccagtttctgctcccccatcacaggctatgccaattagagtgccccaggtacagcctgtgtcagttactgctcctctatcacagggtatgtcaatcagagtaccccatgtacagcctgtgccagttactgctcctctatcacagggtatgccagtcagagtgccccatgtacagcctgtgccagtttctgctcctctatcacaggctatgcctatccgagtgccccatgtacagcctgtgccagttactgctctcccaccacagcctgtgccacttactgctcccacaccatgggctgtgcctaccagactgccccatgcacagcctgtgccagttactcctgccccgccacagactatgccagtcagagtgccccatgtacagcctttgccacgtactgctcctctatcacaggctataccaattagagtgccccatgtacagcctgtgccagttactactcccccatcacagactatggcacttactgctccgagatcacaggctatgccaatcacagtgccccatgtacagcctgtgcccatttctctgcctcatgtacggcccatgcccattccttggcattatgtacagcctatgccagattctgtgccccatgtacagcctatggcactcactgtgcctcatgcacgtcatatgcctgtgcctgtgccccatgtacaccccatgcctgttacagtgccccatgtacagcctatgccttttcctgtgccccaggcactgtctatgccttttcctgtgccccaggcactgtctatgccttttcctgtgccccaggcactgtctatgccttttcctgtgcaccaggcactgtctatgcctgttcctgtgcctgtgccccaggtacagcctgtgccagtcactgtgcctcacacacagcgtatacgtgggcctgtgccccgtgtacagacattgcctccttctgtgacacagtcagagtctatacctgttactgtgtcctccatacagcctaagccaaccactgtgcctcgcgcacaccgtatatgtgtgccccacgtacagatattgcctcctcctgtgacacagtcagagtctatggctgatactgtgtcccccctacagcctatgccagtcactgtgcctcatgcacagcgtatacgtgggcctgtgccctgtgtacagacattgcctaattctgtgccacagtcagagtctatggctgttactgtgcccactgcacagactatgccacccactgtgcctcacaaagagcgtatgcctgggccagggccccatgtacagtcgttgcttcctcctgtgccccacgaacatcctatgccattcactgtgcaccaagcacagcctatgccagtatctgtgtccaatgcacagcatataccagctaaggagtctagcacaccacatgtgccagtgccccgtgaacagacttcaccagtcgggatgaactgtgtacggcccataccaaatgcagcacctcgcataaggccggtggcagtttcggcgaccactgtacagcctgagccagtgctggtgcctcgccgccatctccatgacagatttacagacccagagctgcaggagctggaacgcgttttccagaggaatcactatctcagtgctgaagaaagaaaagagctggcaagggtgatgggcgtgagtgaggccaaagtgcagagatggtttaagaagaggagagaacacttcaggagagaacaaagtcagtcaggtggtgctcctcctgggaatactccacctctctctgaagatggcgcaggagccctagtgtaccacccttgacctagagccactggcagacgcctgctttcttccaccaacatgttattgcctctttatcccctaagcacttgtatttgaaataaatagattctctgtttatttgcttcctgtgtcttctggattagtacggca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]