GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-10-17 14:35:05, GGRNA.v2 : RefSeq release 207 (Jul, 2021)

LOCUS       NM_001388512            2107 bp    mRNA    linear   ROD 31-MAY-2021
DEFINITION  Rattus norvegicus hypoxia inducible factor 3 subunit alpha (Hif3a),
            transcript variant 2, mRNA.
ACCESSION   NM_001388512
VERSION     NM_001388512.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 2107)
  AUTHORS   Yang M, Yan X, Yuan FZ, Ye J, Du MZ, Mao ZM, Xu BB, Chen YR, Song
            YF, Fan BS and Yu JK.
  TITLE     MicroRNA-210-3p Promotes Chondrogenic Differentiation and Inhibits
            Adipogenic Differentiation Correlated with HIF-3alpha Signalling in
            Bone Marrow Mesenchymal Stem Cells
  JOURNAL   Biomed Res Int 2021, 6699910 (2021)
   PUBMED   33937412
  REMARK    GeneRIF: MicroRNA-210-3p Promotes Chondrogenic Differentiation and
            Inhibits Adipogenic Differentiation Correlated with HIF-3alpha
            Signalling in Bone Marrow Mesenchymal Stem Cells.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 2107)
  AUTHORS   Drevytska T, Gonchar E, Okhai I, Lynnyk O, Mankovska I, Klionsky D
            and Dosenko V.
  TITLE     The protective effect of Hif3a RNA interference and HIF-prolyl
            hydroxylase inhibition on cardiomyocytes under anoxia-reoxygenation
  JOURNAL   Life Sci 202, 131-139 (2018)
   PUBMED   29660430
  REMARK    GeneRIF: Hif3a RNA interference and HIF-prolyl hydroxylase
            inhibition protect cardiomyocytes against anoxia-reoxygenation
            injury via the HIF signaling pathway
REFERENCE   3  (bases 1 to 2107)
  AUTHORS   Cuomo F, Coppola A, Botti C, Maione C, Forte A, Scisciola L,
            Liguori G, Caiafa I, Ursini MV, Galderisi U, Cipollaro M, Altucci L
            and Cobellis G.
  TITLE     Pro-inflammatory cytokines activate hypoxia-inducible factor 3alpha
            via epigenetic changes in mesenchymal stromal/stem cells
  JOURNAL   Sci Rep 8 (1), 5842 (2018)
   PUBMED   29643458
  REMARK    GeneRIF: Study in human mesenchymal stromal/stem cells revealed
            robust hypermethylation of histone H3 across HIF3A locus driven by
            pro-inflammatory cytokines. Experiments in a murine model of
            arteriotomy highlighted the activation of Hif3alpha expression in
            infiltrated inflammatory cells, suggesting a new role for Hif3alpha
            in inflammation in vivo.
            Erratum:[Sci Rep. 2020 Apr 17;10(1):6776. PMID: 32303693]
            Publication Status: Online-Only
REFERENCE   4  (bases 1 to 2107)
  AUTHORS   Rao K, Sethi K, Ischia J, Gibson L, Galea L, Xiao L, Yim M, Chang
            M, Papa N, Bolton D, Shulkes A, Baldwin GS and Patel O.
  TITLE     Protective effect of zinc preconditioning against renal ischemia
            reperfusion injury is dose dependent
  JOURNAL   PLoS One 12 (7), e0180028 (2017)
   PUBMED   28686686
  REMARK    GeneRIF: ZnCl2 (10 mg/kg) significantly lowered the creatinine and
            urea concentrations compared to saline-treated control rats
            following a clinically relevant 60 minutes of ischemia. Zn2+
            induced expression of HIF1a and HIF2a but not HIF3a.ZnCl2
            preconditioning protects against renal Ischemia-reperfusion injury
            in a dose-dependent manner
            Publication Status: Online-Only
REFERENCE   5  (bases 1 to 2107)
  AUTHORS   Keith B, Johnson RS and Simon MC.
  TITLE     HIF1alpha and HIF2alpha: sibling rivalry in hypoxic tumour growth
            and progression
  JOURNAL   Nat Rev Cancer 12 (1), 9-22 (2011)
   PUBMED   22169972
  REMARK    Review article
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 2107)
  AUTHORS   Li QF and Dai AG.
  TITLE     Differential expression of three hypoxia-inducible factor-alpha
            subunits in pulmonary arteries of rat with hypoxia-induced
            hypertension
  JOURNAL   Acta Biochim Biophys Sin (Shanghai) 37 (10), 665-672 (2005)
   PUBMED   16215633
  REMARK    GeneRIF: HIF-1alpha, HIF-2alpha and HIF-3alpha may not only confer
            different target genes, but also play key pathogenetic roles in
            hypoxic-induced pulmonary hypertension.
REFERENCE   7  (bases 1 to 2107)
  AUTHORS   Heidbreder M, Frohlich F, Johren O, Dendorfer A, Qadri F and
            Dominiak P.
  TITLE     Hypoxia rapidly activates HIF-3alpha mRNA expression
  JOURNAL   FASEB J 17 (11), 1541-1543 (2003)
   PUBMED   12824304
  REMARK    GeneRIF: Hypoxia rapidly activates HIF-3alpha mRNA expression
REFERENCE   8  (bases 1 to 2107)
  AUTHORS   Hara S, Hamada J, Kobayashi C, Kondo Y and Imura N.
  TITLE     Expression and characterization of hypoxia-inducible factor
            (HIF)-3alpha in human kidney: suppression of HIF-mediated gene
            expression by HIF-3alpha
  JOURNAL   Biochem Biophys Res Commun 287 (4), 808-813 (2001)
   PUBMED   11573933
REFERENCE   9  (bases 1 to 2107)
  AUTHORS   Kietzmann T, Cornesse Y, Brechtel K, Modaressi S and Jungermann K.
  TITLE     Perivenous expression of the mRNA of the three hypoxia-inducible
            factor alpha-subunits, HIF1alpha, HIF2alpha and HIF3alpha, in rat
            liver
  JOURNAL   Biochem J 354 (Pt 3), 531-537 (2001)
   PUBMED   11237857
REFERENCE   10 (bases 1 to 2107)
  AUTHORS   Gu YZ, Moran SM, Hogenesch JB, Wartman L and Bradfield CA.
  TITLE     Molecular characterization and chromosomal localization of a third
            alpha-class hypoxia inducible factor subunit, HIF3alpha
  JOURNAL   Gene Expr 7 (3), 205-213 (1998)
   PUBMED   9840812
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JACYVU010000033.1.
            
            Summary: binds HIF-responsive elements and activates transcription
            in vitro [RGD, Feb 2006].
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            RNAseq introns :: single sample supports all introns SAMN16676789
                              [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            inferred exon combination :: based on alignments, homology
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-65                JACYVU010000033.1  1626648-1626712     c
            66-256              JACYVU010000033.1  1620642-1620832     c
            257-402             JACYVU010000033.1  1619128-1619273     c
            403-487             JACYVU010000033.1  1616751-1616835     c
            488-600             JACYVU010000033.1  1615871-1615983     c
            601-809             JACYVU010000033.1  1615303-1615511     c
            810-916             JACYVU010000033.1  1613116-1613222     c
            917-1064            JACYVU010000033.1  1612714-1612861     c
            1065-1177           JACYVU010000033.1  1609228-1609340     c
            1178-1368           JACYVU010000033.1  1608245-1608435     c
            1369-1470           JACYVU010000033.1  1606035-1606136     c
            1471-1742           JACYVU010000033.1  1604036-1604307     c
            1743-1854           JACYVU010000033.1  1602553-1602664     c
            1855-1936           JACYVU010000033.1  1600954-1601035     c
            1937-2107           JACYVU010000033.1  1599425-1599595     c
FEATURES             Location/Qualifiers
     source          1..2107
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="1"
                     /map="1q21"
     gene            1..2107
                     /gene="Hif3a"
                     /gene_synonym="Ipas; Mop7"
                     /note="hypoxia inducible factor 3 subunit alpha"
                     /db_xref="GeneID:64345"
                     /db_xref="RGD:70332"
     exon            1..65
                     /gene="Hif3a"
                     /gene_synonym="Ipas; Mop7"
                     /inference="alignment:Splign:2.1.0"
     CDS             40..2034
                     /gene="Hif3a"
                     /gene_synonym="Ipas; Mop7"
                     /note="isoform 2 is encoded by transcript variant 2;
                     HIF3-alpha; HIF-3-alpha; HIF3-alpha-1; hypoxia inducible
                     factor 3, alpha subunit; hypoxia inducible factor 3a;
                     Inhibitory PAS (Per/Arnt/Sim) domain protein;
                     hypoxia-inducible factor 3-alpha"
                     /codon_start=1
                     /product="hypoxia-inducible factor 3-alpha isoform 2"
                     /protein_id="NP_001375441.1"
                     /db_xref="GeneID:64345"
                     /db_xref="RGD:70332"
                     /translation="
MALGLQRVRSSTELRKEKSRDAARSRRSQETEVLYQLAHTLPFARGVSAHLDKASIMRLTISYLRMHRLCAAGEWNQVGKEGEPLDACYLKALEGFVMVLTAEGDMAYLSENVSKHLGLSQLELIGHSIFDFIHPCDQEELQDALTPRPSLSKKKSEAATGRHFSLRMKSTLTSRGRTLNLKAATWKVLHCSGHMRAYKPPAQTSPAGSPRSEPPLQCLVLICEAIPHPASLEPPLGRGAFLSRHSLDMKFTYCDERIAEVAGYSPDDLIGCSAYEYIHALDSDAVSRSIHTLLSKGQAVTGQYRFLARTGGYLWTQTQATVVSGGRGPQSESIICVHFLISRVEENGVVLSLEQTEQHTRRPPQLGTSSKKGIPGNSLDPPAPRILAFLHPPALSEASLAADPRRFCSPDLRRLMAPILDGPPTAATPSTPQAARRPQSPLPADLPDQLAVGLENAHRLSTARKNKTMETDLDIAQDPDTLDLEMLAPYISMDDDFQLNSSEQLPKVHRRPPRTARRPRARSFHGLSPPIPEATLLPRWGSDPRLNCSSSSKGDPPTAPLTPRTRKRALAQSSEDKGLELLETKPPKRSPRLEPGSVLLPPLSLSFLLQGRQLPGNQPDPRAPLVDSHEPLGLAPSLLSLYQHEETIQPRNHFLPAAGLAQTH"
     misc_feature    73..261
                     /gene="Hif3a"
                     /gene_synonym="Ipas; Mop7"
                     /note="basic helix-loop-helix-Per-ARNT-Sim (bHLH-PAS)
                     domain found in hypoxia-inducible factor 3-alpha (HIF3a)
                     and similar proteins; Region: bHLH-PAS_HIF3a_PASD7;
                     cd19729"
                     /db_xref="CDD:381572"
     misc_feature    order(106..111,115..117,130..132,193..198)
                     /gene="Hif3a"
                     /gene_synonym="Ipas; Mop7"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:381572"
     misc_feature    order(124..129,136..141,145..150,160..162,196..201,
                     208..213,220..222,226..231,238..243)
                     /gene="Hif3a"
                     /gene_synonym="Ipas; Mop7"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:381572"
     misc_feature    307..474
                     /gene="Hif3a"
                     /gene_synonym="Ipas; Mop7"
                     /note="PAS domain; Region: PAS; smart00091"
                     /db_xref="CDD:214512"
     misc_feature    790..1053
                     /gene="Hif3a"
                     /gene_synonym="Ipas; Mop7"
                     /note="PAS fold; Region: PAS_3; pfam08447"
                     /db_xref="CDD:369881"
     misc_feature    order(799..801,811..813,829..831,868..879,955..957,
                     970..972)
                     /gene="Hif3a"
                     /gene_synonym="Ipas; Mop7"
                     /note="putative active site [active]"
                     /db_xref="CDD:238075"
     misc_feature    order(859..861,871..873,895..897,904..909,991..993,
                     997..999)
                     /gene="Hif3a"
                     /gene_synonym="Ipas; Mop7"
                     /note="heme pocket [chemical binding]; other site"
                     /db_xref="CDD:238075"
     misc_feature    <1117..1938
                     /gene="Hif3a"
                     /gene_synonym="Ipas; Mop7"
                     /note="large tegument protein UL36; Provisional; Region:
                     PHA03247"
                     /db_xref="CDD:223021"
     misc_feature    1468..1557
                     /gene="Hif3a"
                     /gene_synonym="Ipas; Mop7"
                     /note="Hypoxia-inducible factor-1; Region: HIF-1;
                     pfam11413"
                     /db_xref="CDD:402842"
     exon            66..256
                     /gene="Hif3a"
                     /gene_synonym="Ipas; Mop7"
                     /inference="alignment:Splign:2.1.0"
     exon            257..402
                     /gene="Hif3a"
                     /gene_synonym="Ipas; Mop7"
                     /inference="alignment:Splign:2.1.0"
     exon            403..487
                     /gene="Hif3a"
                     /gene_synonym="Ipas; Mop7"
                     /inference="alignment:Splign:2.1.0"
     exon            488..600
                     /gene="Hif3a"
                     /gene_synonym="Ipas; Mop7"
                     /inference="alignment:Splign:2.1.0"
     exon            601..809
                     /gene="Hif3a"
                     /gene_synonym="Ipas; Mop7"
                     /inference="alignment:Splign:2.1.0"
     exon            810..916
                     /gene="Hif3a"
                     /gene_synonym="Ipas; Mop7"
                     /inference="alignment:Splign:2.1.0"
     exon            917..1064
                     /gene="Hif3a"
                     /gene_synonym="Ipas; Mop7"
                     /inference="alignment:Splign:2.1.0"
     exon            1065..1177
                     /gene="Hif3a"
                     /gene_synonym="Ipas; Mop7"
                     /inference="alignment:Splign:2.1.0"
     exon            1178..1368
                     /gene="Hif3a"
                     /gene_synonym="Ipas; Mop7"
                     /inference="alignment:Splign:2.1.0"
     exon            1369..1470
                     /gene="Hif3a"
                     /gene_synonym="Ipas; Mop7"
                     /inference="alignment:Splign:2.1.0"
     exon            1471..1742
                     /gene="Hif3a"
                     /gene_synonym="Ipas; Mop7"
                     /inference="alignment:Splign:2.1.0"
     exon            1743..1854
                     /gene="Hif3a"
                     /gene_synonym="Ipas; Mop7"
                     /inference="alignment:Splign:2.1.0"
     exon            1855..1936
                     /gene="Hif3a"
                     /gene_synonym="Ipas; Mop7"
                     /inference="alignment:Splign:2.1.0"
     exon            1937..2107
                     /gene="Hif3a"
                     /gene_synonym="Ipas; Mop7"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
gctgggcatcgagggctctggaaccgcgaagggcgagccatggcgttggggctgcagcgcgtgaggtcgagcaccgagctgcggaaggagaagtcgcgggatgcggcccgcagcaggcgcagccaggagacggaggtgctgtaccaactggcgcacaccctgccctttgcgcgcggcgtcagcgcgcacctggacaaggcctccatcatgcgcctcacaatcagctacttgcgcatgcaccgcctctgcgctgcaggggagtggaaccaggtgggaaaagagggagaaccactggacgcctgctacctgaaggccctggagggtttcgtcatggtgctcaccgctgagggagacatggcttacctgtcggaaaatgtcagcaagcacctgggcctcagtcagctggagctcattggacacagtatctttgattttatccatccctgtgaccaagaggaactccaggatgccctgaccccgagaccaagcctgtcaaagaagaagtcagaagcagcaacaggacgccacttttccctgcgaatgaagagcacactcaccagcagggggcgcacgctgaacctcaaagcggccacctggaaggtgctgcactgctcaggacatatgagggcctacaagccccctgcacagacttcccccgccgggagccctcgctccgagcctcccctgcaatgcctggtgcttatctgtgaagccatcccccacccagccagtctggagcccccactgggccgaggggcctttctcagtcgccacagcctggacatgaagttcacatactgcgacgagaggattgcagaagttgctggctacagccccgatgacctgattggctgttctgcctatgaatacatccacgctttggactctgatgcagtcagcaggagcatccacactttgctgagcaagggccaggcagtaacagggcagtatcgcttcctggcccggactggaggctatctgtggactcagactcaggctacagtggtgtcaggggggcggggcccccagtcggaaagtatcatctgcgtccacttcctgatcagccgtgtagaagagaacggagtggtgctgtccctggaacaaacggagcaacatactcgcagaccccctcagctgggtacctcctcgaagaagggtatcccaggcaacagtctagaccctcccgctccacggatcctggccttcctgcaccctccagccctgagtgaggcctccctggctgctgaccctcgccgtttttgtagcccagacctgcgccgcctcatggcacccatcctggatggacctcccacagccgctacccccagcaccccgcaagctgcacggagaccccaaagtcctcttccggctgatctcccagatcagttggctgtgggcttggagaatgcacacagactctccactgcccggaaaaacaagaccatggagacagatctagatatagctcaggaccctgacactctggacttggagatgttggctccgtacatctccatggatgatgacttccagctcaactccagcgagcaattgcccaaagtccaccgcagacctcccaggacggcccgcaggcctcgtgctcggagcttccatggcctgtcgcctcccatccctgaggccaccctgctgccccgctgggggagtgatccacgactgaactgttccagctcctccaagggggatccccccacagcccccctgacgcctagaactcggaagagggccttggcccagagctcagaggacaaagggttggagctgctggaaacgaagccccccaagcggtccccaagactagaacctggaagtgtcctgctgcctccgctcagcctgagtttccttctgcaaggtcgacaacttccagggaaccagccggatcccagagccccactcgtggattcgcatgagcccttgggcctagctccctcgctgctctctctctaccagcatgaggaaactatccagcccaggaaccacttcctcccagcagcaggcttggcccagacacactgagtcagccttcctctcagccctcttcttctaccccagaaaggactcagccgcactccacaccagcagcctacac
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]