GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:12:19, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NM_001387               5045 bp    mRNA    linear   PRI 19-NOV-2019
DEFINITION  Homo sapiens dihydropyrimidinase like 3 (DPYSL3), transcript
            variant 2, mRNA.
ACCESSION   NM_001387
VERSION     NM_001387.3
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 5045)
  AUTHORS   Matsunuma R, Chan DW, Kim BJ, Singh P, Han A, Saltzman AB, Cheng C,
            Lei JT, Wang J, Roberto da Silva L, Sahin E, Leng M, Fan C, Perou
            CM, Malovannaya A and Ellis MJ.
  TITLE     DPYSL3 modulates mitosis, migration, and epithelial-to-mesenchymal
            transition in claudin-low breast cancer
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 115 (51), E11978-E11987 (2018)
   PUBMED   30498031
  REMARK    GeneRIF: DPYSL3 expression identifies claudin-low (CLOW) tumors
            that will be sensitive to approaches that promote vimentin
            phosphorylation during mitosis and inhibitors of PAK signaling
            during migration and EMT.
REFERENCE   2  (bases 1 to 5045)
  AUTHORS   Huang QX, Xiao CT, Chen Z, Lu MH, Pang J, Di JM, Luo ZH and Gao X.
  TITLE     Combined analysis of CRMP4 methylation levels and CAPRA-S score
            predicts metastasis and outcomes in prostate cancer patients
  JOURNAL   Asian J. Androl. 20 (1), 56-61 (2018)
   PUBMED   28382925
  REMARK    GeneRIF: CRMP4 methylation levels >/=15% were significantly
            associated with a poor prognosis and their combination with CAPRA-S
            score accurately predicted tumor progression and metastasis
REFERENCE   3  (bases 1 to 5045)
  AUTHORS   Tsutiya A, Nakano Y, Hansen-Kiss E, Kelly B, Nishihara M, Goshima
            Y, Corsmeier D, White P, Herman GE and Ohtani-Kaneko R.
  TITLE     Human CRMP4 mutation and disrupted Crmp4 expression in mice are
            associated with ASD characteristics and sexual dimorphism
  JOURNAL   Sci Rep 7 (1), 16812 (2017)
   PUBMED   29196732
  REMARK    GeneRIF: Data found a damaging de novo missense CRMP4 mutation in a
            male autism spectrum disorders (ASD). Accumulating evidence
            suggests that a disturbance in the regulatory function of CRMP4 in
            forming neuronal networks is an important aspect underlying some
            characteristics of ASD, including sexual differences. These
            findings provide CRMP4 as a novel candidate gene contributing to
            ASD.
            Publication Status: Online-Only
REFERENCE   4  (bases 1 to 5045)
  AUTHORS   Guo H and Xia B.
  TITLE     Collapsin response mediator protein 4 isoforms (CRMP4a and CRMP4b)
            have opposite effects on cell proliferation, migration, and
            invasion in gastric cancer
  JOURNAL   BMC Cancer 16, 565 (2016)
   PUBMED   27475326
  REMARK    GeneRIF: Data indicate that CRMP4a and CRMP4b isoforms have
            opposite effects on cell proliferation, migration, and invasion in
            gastric cancer. CRMP4a expression was reduced in gastric carcinoma
            tissues and cell lines and seems to act as a tumor suppressor in
            gastric carcinoma. CRMP4b expression was higher in tumor tissue and
            cell lines.
            Publication Status: Online-Only
REFERENCE   5  (bases 1 to 5045)
  AUTHORS   Nakamura F, Kumeta K, Hida T, Isono T, Nakayama Y,
            Kuramata-Matsuoka E, Yamashita N, Uchida Y, Ogura K, Gengyo-Ando K,
            Mitani S, Ogino T and Goshima Y.
  TITLE     Amino- and carboxyl-terminal domains of Filamin-A interact with
            CRMP1 to mediate Sema3A signalling
  JOURNAL   Nat Commun 5, 5325 (2014)
   PUBMED   25358863
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 5045)
  AUTHORS   Matsuo T, Stauffer JK, Walker RL, Meltzer P and Thiele CJ.
  TITLE     Structure and promoter analysis of the human unc-33-like
            phosphoprotein gene. E-box required for maximal expression in
            neuroblastoma and myoblasts
  JOURNAL   J. Biol. Chem. 275 (22), 16560-16568 (2000)
   PUBMED   10748015
  REMARK    Erratum:[J Biol Chem 2000 Aug 11;275(32):25052-3]
REFERENCE   7  (bases 1 to 5045)
  AUTHORS   Inagaki H, Kato Y, Hamajima N, Nonaka M, Sasaki M and Eimoto T.
  TITLE     Differential expression of dihydropyrimidinase-related protein
            genes in developing and adult enteric nervous system
  JOURNAL   Histochem. Cell Biol. 113 (1), 37-41 (2000)
   PUBMED   10664068
REFERENCE   8  (bases 1 to 5045)
  AUTHORS   Gaetano C, Matsuo T and Thiele CJ.
  TITLE     Identification and characterization of a retinoic acid-regulated
            human homologue of the unc-33-like phosphoprotein gene (hUlip) from
            neuroblastoma cells
  JOURNAL   J. Biol. Chem. 272 (18), 12195-12201 (1997)
   PUBMED   9115293
REFERENCE   9  (bases 1 to 5045)
  AUTHORS   Hamajima N, Matsuda K, Sakata S, Tamaki N, Sasaki M and Nonaka M.
  TITLE     A novel gene family defined by human dihydropyrimidinase and three
            related proteins with differential tissue distribution
  JOURNAL   Gene 180 (1-2), 157-163 (1996)
   PUBMED   8973361
REFERENCE   10 (bases 1 to 5045)
  AUTHORS   Dawson SJ and White LA.
  TITLE     Treatment of Haemophilus aphrophilus endocarditis with
            ciprofloxacin
  JOURNAL   J. Infect. 24 (3), 317-320 (1992)
   PUBMED   1602151
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AI570709.1, D78014.1, BC039006.1 and CA424493.1.
            On May 31, 2019 this sequence version replaced NM_001387.2.
            
            Transcript Variant: This variant (2) differs in the 5' UTR and
            coding sequence compared to variant 1. The resulting isoform (2)
            has a shorter and distinct N-terminus compared to isoform (1).
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR1803617.128517.1,
                                           SRR1803614.253045.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMEA1965299, SAMEA1966682
                                           [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-233               AI570709.1         158-390
            234-1778            D78014.1           239-1783
            1779-2379           BC039006.1         1750-2350
            2380-5042           D78014.1           2385-5047
            5043-5045           CA424493.1         17-19               c
FEATURES             Location/Qualifiers
     source          1..5045
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="5"
                     /map="5q32"
     gene            1..5045
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /note="dihydropyrimidinase like 3"
                     /db_xref="GeneID:1809"
                     /db_xref="HGNC:HGNC:3015"
                     /db_xref="MIM:601168"
     exon            1..144
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /inference="alignment:Splign:2.1.0"
     variation       2
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1283583356"
     variation       5
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1356466160"
     variation       6
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1205951329"
     variation       7
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1311235049"
     variation       9
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1319206226"
     variation       15
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1239861821"
     variation       17
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1285322231"
     variation       19
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1353052184"
     variation       20..23
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1258026616"
     variation       20
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1016144859"
     variation       23
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1243547123"
     variation       27
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1482820353"
     variation       28..29
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1381758097"
     variation       30
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1252584200"
     variation       31
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1419543164"
     variation       32
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:568282671"
     misc_feature    34..36
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /note="upstream in-frame stop codon"
     variation       41
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:923117377"
     variation       45
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:950574003"
     variation       46
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1561794300"
     variation       47
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:975913037"
     variation       49
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:961798743"
     variation       50
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:907612116"
     variation       53
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192761790"
     variation       54
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780069433"
     variation       55
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371812308"
     variation       57..61
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="agcag"
                     /replace="agcagcag"
                     /db_xref="dbSNP:745353597"
     variation       58
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758969737"
     variation       59
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367940618"
     variation       60..67
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="agaag"
                     /replace="agaagaag"
                     /replace="agaagaagaag"
                     /db_xref="dbSNP:778474557"
     variation       60
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:895103442"
     variation       62
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1281352268"
     variation       65
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779343461"
     variation       66
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:757632182"
     variation       70
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1460363087"
     variation       71
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1265148361"
     variation       72
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374875662"
     variation       74
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1480958651"
     variation       75
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:528736381"
     variation       76
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1042566506"
     variation       78
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:910767025"
     variation       79
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1002870679"
     variation       83
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763875948"
     variation       84
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370710925"
     variation       85
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1216136869"
     variation       86
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1424034362"
     variation       89
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1365706576"
     variation       95
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1412339624"
     variation       98
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:974865439"
     variation       99
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:943063693"
     variation       100
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1554115339"
     variation       102
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1335810378"
     variation       103
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:758927120"
     variation       105
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766876733"
     CDS             106..1818
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /note="isoform 2 is encoded by transcript variant 2;
                     dihydropyrimidinase-related protein 3; collapsin response
                     mediator protein 4 long; unc-33-like phosphoprotein 1;
                     testicular secretory protein Li 7"
                     /codon_start=1
                     /product="dihydropyrimidinase-related protein 3 isoform 2"
                     /protein_id="NP_001378.1"
                     /db_xref="CCDS:CCDS43381.1"
                     /db_xref="GeneID:1809"
                     /db_xref="HGNC:HGNC:3015"
                     /db_xref="MIM:601168"
                     /translation="
MSYQGKKNIPRITSDRLLIKGGRIVNDDQSFYADIYMEDGLIKQIGDNLIVPGGVKTIEANGKMVIPGGIDVHTHFQMPYKGMTTVDDFFQGTKAALAGGTTMIIDHVVPEPESSLTEAYEKWREWADGKSCCDYALHVDITHWNDSVKQEVQNLIKDKGVNSFMVYMAYKDLYQVSNTELYEIFTCLGELGAIAQVHAENGDIIAQEQTRMLEMGITGPEGHVLSRPEELEAEAVFRAITIASQTNCPLYVTKVMSKSAADLISQARKKGNVVFGEPITASLGIDGTHYWSKNWAKAAAFVTSPPLSPDPTTPDYINSLLASGDLQLSGSAHCTFSTAQKAIGKDNFTAIPEGTNGVEERMSVIWDKAVATGKMDENQFVAVTSTNAAKIFNLYPRKGRISVGSDSDLVIWDPDAVKIVSAKNHQSAAEYNIFEGMELRGAPLVVICQGKIMLEDGNLHVTQGAGRFIPCSPFSDYVYKRIKARRKMADLHAVPRGMYDGPVFDLTTTPKGGTPAGSARGSPTRPNPPVRNLHQSGFSLSGTQVDEGVRSASKRIVAPPGGRSNITSLS"
     misc_feature    154..1518
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /note="D-hydantoinase; Region: D-hydantoinase; TIGR02033"
                     /db_xref="CDD:273937"
     misc_feature    order(187..192,196..198,235..240,643..645,706..708,
                     715..717,724..726,793..795,805..807,817..819,826..828,
                     907..912,916..921,1273..1275,1288..1290,1303..1305)
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /note="tetramer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238639"
     misc_feature    order(322..324,328..330,598..600,697..699,865..867,
                     1099..1101)
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /note="active site"
                     /db_xref="CDD:238639"
     misc_feature    880..882
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine. {ECO:0000244|PubMed:21406692};
                     propagated from UniProtKB/Swiss-Prot (Q14195.1);
                     phosphorylation site"
     misc_feature    1396..1398
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphotyrosine. {ECO:0000250|UniProtKB:Q62188};
                     propagated from UniProtKB/Swiss-Prot (Q14195.1);
                     phosphorylation site"
     misc_feature    1483..1800
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /note="vicinal oxygen chelate (VOC) family; Region: VOC;
                     cl14632"
                     /db_xref="CDD:326334"
     misc_feature    1600..1602
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphotyrosine. {ECO:0000250|UniProtKB:Q62188};
                     propagated from UniProtKB/Swiss-Prot (Q14195.1);
                     phosphorylation site"
     misc_feature    1630..1632
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine, by GSK3.
                     {ECO:0000244|PubMed:21406692, ECO:0000244|PubMed:24275569,
                     ECO:0000269|PubMed:16611631}; propagated from
                     UniProtKB/Swiss-Prot (Q14195.1); phosphorylation site"
     misc_feature    1645..1647
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine, by GSK3.
                     {ECO:0000244|PubMed:21406692,
                     ECO:0000269|PubMed:16611631}; propagated from
                     UniProtKB/Swiss-Prot (Q14195.1); phosphorylation site"
     misc_feature    1657..1659
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine, by GSK3.
                     {ECO:0000269|PubMed:16611631}; propagated from
                     UniProtKB/Swiss-Prot (Q14195.1); phosphorylation site"
     misc_feature    1669..1671
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine, by DYRK2.
                     {ECO:0000244|PubMed:21406692, ECO:0000244|PubMed:24275569,
                     ECO:0000269|PubMed:16611631}; propagated from
                     UniProtKB/Swiss-Prot (Q14195.1); phosphorylation site"
     misc_feature    1711..1713
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine. {ECO:0000250|UniProtKB:Q62188};
                     propagated from UniProtKB/Swiss-Prot (Q14195.1);
                     phosphorylation site"
     misc_feature    1720..1722
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine. {ECO:0000250|UniProtKB:Q62188};
                     propagated from UniProtKB/Swiss-Prot (Q14195.1);
                     phosphorylation site"
     misc_feature    1726..1728
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine. {ECO:0000250|UniProtKB:Q62188};
                     propagated from UniProtKB/Swiss-Prot (Q14195.1);
                     phosphorylation site"
     misc_feature    1732..1734
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine. {ECO:0000250|UniProtKB:Q62188};
                     propagated from UniProtKB/Swiss-Prot (Q14195.1);
                     phosphorylation site"
     variation       107
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1302935274"
     variation       111
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:759520414"
     variation       113
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1291205451"
     variation       114
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1013738830"
     variation       123
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201601413"
     variation       132
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:137909376"
     variation       135
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1391232897"
     variation       138
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1443209367"
     variation       143
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:984697504"
     variation       144
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1379773556"
     exon            145..233
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /inference="alignment:Splign:2.1.0"
     variation       151
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771972753"
     variation       152
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374440794"
     variation       160
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1265792687"
     variation       162
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:933190174"
     variation       165
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778230955"
     variation       167
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1333906044"
     variation       171
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371030253"
     variation       172
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1409839247"
     variation       177
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752329261"
     variation       178
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376535312"
     variation       182
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426127055"
     variation       185
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1393394009"
     variation       191
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1164185028"
     variation       193
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:754503646"
     variation       198
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1031236169"
     variation       203
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751057179"
     variation       205
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1184469866"
     variation       206
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1000205679"
     variation       214
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:954682768"
     variation       216
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423928952"
     exon            234..418
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /inference="alignment:Splign:2.1.0"
     variation       237
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748508790"
     variation       239
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1260778682"
     variation       246
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1251779877"
     variation       265
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1177783408"
     variation       266
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1429252383"
     variation       270
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1467727635"
     variation       271
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1271087572"
     variation       275
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376419607"
     variation       276
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1345295881"
     variation       277
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754627549"
     variation       278
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:958023861"
     variation       279
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1032260219"
     variation       282
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1173022930"
     variation       283
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751063562"
     variation       286
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1322955406"
     variation       287
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1007434012"
     variation       294
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1405913183"
     variation       301
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779569209"
     variation       304
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758346627"
     variation       308
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750296589"
     variation       310
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373398234"
     variation       315
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761657413"
     variation       316
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369477048"
     variation       320
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1051623683"
     variation       323
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767677729"
     variation       327
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1241130589"
     variation       331
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759750712"
     variation       332
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:17853869"
     variation       333
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1321385615"
     variation       338
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1216057747"
     variation       341
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774304174"
     variation       342
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758536186"
     variation       344
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763117789"
     variation       349
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773912873"
     variation       356
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1300277747"
     variation       367
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770401823"
     variation       373
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766199489"
     variation       385
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781579811"
     variation       387
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1450773209"
     variation       388
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198126870"
     variation       389
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768216009"
     variation       390
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201521252"
     variation       391
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778829032"
     variation       393
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17106709"
     variation       399
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1169000689"
     variation       401
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1409813415"
     variation       408
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377294346"
     variation       414
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1383120272"
     variation       417
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754994345"
     variation       418
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1183579974"
     exon            419..583
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /inference="alignment:Splign:2.1.0"
     variation       426
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374737256"
     variation       430
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139341814"
     variation       433
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775183154"
     variation       441
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771694171"
     variation       447
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745426369"
     variation       449
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1251865507"
     variation       451
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778358403"
     variation       453
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:918367287"
     variation       456
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371548122"
     variation       459
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489710048"
     variation       461
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757195721"
     variation       464
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:572434542"
     variation       466
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367769724"
     variation       471
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1284121634"
     variation       478
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777564671"
     variation       486
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331375127"
     variation       492
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:558974365"
     variation       496
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755992859"
     variation       498
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1404638487"
     variation       502
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1036917761"
     variation       507
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1458574312"
     variation       510
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752411530"
     variation       513
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295087682"
     variation       517
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766746019"
     variation       518
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1344571206"
     variation       519
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:940886605"
     variation       522
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201787615"
     variation       523
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:973954644"
     variation       524
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750552836"
     variation       525
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765351592"
     variation       526
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147541241"
     variation       530
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1193306229"
     variation       531
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777263653"
     variation       535
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1399366118"
     variation       540
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1241871008"
     variation       541
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764498265"
     variation       546
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761152983"
     variation       547
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116679689"
     variation       557
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1289392855"
     variation       559
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771747440"
     variation       560
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745478173"
     variation       562
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442821716"
     variation       564
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1303628898"
     variation       567
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220006391"
     variation       568
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773851486"
     variation       576
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1295108492"
     variation       583
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770538365"
     exon            584..645
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /inference="alignment:Splign:2.1.0"
     variation       584
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1204309430"
     variation       585
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774059481"
     variation       586
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770462148"
     variation       588
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1302915459"
     variation       591
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1461179400"
     variation       599
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1368258730"
     variation       605
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1561778293"
     variation       606
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:544817415"
     variation       608
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1561778288"
     variation       616
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772550085"
     variation       617
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1391142497"
     variation       625
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1214623338"
     variation       626
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:575844670"
     variation       628
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1422565988"
     variation       629
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1056679957"
     variation       632
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748032395"
     variation       633
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:556065111"
     variation       638
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1561778266"
     variation       639
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768629396"
     exon            646..726
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /inference="alignment:Splign:2.1.0"
     variation       650
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1326526812"
     variation       655
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772784218"
     variation       657
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1378259870"
     variation       662
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1228696631"
     variation       663
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769127728"
     variation       664
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1323324495"
     variation       665
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377270433"
     variation       667
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1379907448"
     variation       668
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1433481612"
     variation       673
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:931715826"
     variation       674
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:921701958"
     variation       677
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1392889178"
     variation       681
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776774448"
     variation       683
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768682357"
     variation       685
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213722276"
     variation       687
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746847113"
     variation       688
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775095992"
     variation       689
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1473049327"
     variation       692
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1561777845"
     variation       698
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1177868696"
     variation       702
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1377236546"
     variation       707
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771212935"
     variation       708
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749400341"
     variation       710
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370048196"
     variation       715
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1208097914"
     variation       718
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1463489765"
     variation       724
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:756257899"
     exon            727..795
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /inference="alignment:Splign:2.1.0"
     variation       735
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:35891125"
     variation       736
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368879178"
     variation       737
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755481306"
     variation       738
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1057084923"
     variation       739
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:747416841"
     variation       741
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1456642358"
     variation       742
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:937429406"
     variation       751
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1363687315"
     variation       753
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34332356"
     variation       758
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201487610"
     variation       759
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750768155"
     variation       762
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765028918"
     variation       774
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201569659"
     variation       775
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367968514"
     variation       782
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763626428"
     variation       790
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:913119486"
     variation       794
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1290851841"
     exon            796..916
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /inference="alignment:Splign:2.1.0"
     variation       801
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1410556390"
     variation       802
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1391849743"
     variation       808
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1179645447"
     variation       817
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1474166214"
     variation       818
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751363047"
     variation       819
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370308670"
     variation       824
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762723911"
     variation       827
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1346618241"
     variation       829
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1231659274"
     variation       836
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276087650"
     variation       837
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1480659678"
     variation       840
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1451554601"
     variation       841
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1288298071"
     variation       842
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1009286976"
     variation       849
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1335600922"
     variation       850
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1194770990"
     variation       857
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747180872"
     variation       858
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768834528"
     variation       859
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377142026"
     variation       862
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1298556773"
     variation       870
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1435445209"
     variation       872
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1347872582"
     variation       874
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775590493"
     variation       881
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1031989147"
     variation       889
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772484841"
     variation       890
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1262311328"
     variation       891
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138020761"
     variation       892
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1156238918"
     variation       894
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1473378891"
     variation       900
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1172031703"
     exon            917..1073
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /inference="alignment:Splign:2.1.0"
     variation       922
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1561773057"
     variation       923
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767573218"
     variation       942
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1455095183"
     variation       944
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759671041"
     variation       948
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1314280262"
     variation       954
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374362949"
     variation       955
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749696414"
     variation       962
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1261375806"
     variation       975
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773674068"
     variation       980
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310597531"
     variation       984
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1280493973"
     variation       991
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1234695140"
     variation       992
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769338348"
     variation       993
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747779189"
     variation       998
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1437159047"
     variation       999
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200777055"
     variation       1000
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754584484"
     variation       1004
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1269891882"
     variation       1005
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1337525087"
     variation       1009
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1464233292"
     variation       1011
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372399159"
     variation       1017
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183360676"
     variation       1021
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1035665716"
     variation       1023
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750247835"
     variation       1026
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1389920699"
     variation       1030
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765013840"
     variation       1031
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1219921836"
     variation       1033
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1451877544"
     variation       1039
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756302276"
     variation       1041
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753017382"
     variation       1042
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1482414232"
     variation       1044
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1428949601"
     variation       1046
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767626566"
     variation       1047
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746870672"
     variation       1055
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1370991512"
     variation       1058
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539740774"
     variation       1060
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:941054021"
     variation       1064
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1370077188"
     variation       1071
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767026872"
     exon            1074..1215
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /inference="alignment:Splign:2.1.0"
     variation       1074
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751007269"
     variation       1075
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765632189"
     variation       1078
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1397615121"
     variation       1089
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:762286701"
     variation       1090
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456832027"
     variation       1091
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1455505351"
     variation       1100
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776812299"
     variation       1107
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201019011"
     variation       1115
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1406378805"
     variation       1116
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760252867"
     variation       1118
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468789441"
     variation       1120
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1409969847"
     variation       1122
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774990938"
     variation       1132
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368254542"
     variation       1133
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771625097"
     variation       1146
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1208060302"
     variation       1148
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76516681"
     variation       1150
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200957398"
     variation       1152
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745361456"
     variation       1153
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1273280445"
     variation       1158
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444962248"
     variation       1164
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778946047"
     variation       1167
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770728163"
     variation       1169
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749143796"
     variation       1172
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777366989"
     variation       1173
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1336787531"
     variation       1179
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755267708"
     variation       1180
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1301015383"
     variation       1187
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1385600033"
     variation       1197
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:10515587"
     variation       1198
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370311772"
     variation       1199
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:924697047"
     variation       1200
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200870327"
     variation       1204
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1324562094"
     variation       1209
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1386504346"
     variation       1210
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1046190056"
     variation       1215
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1200136595"
     exon            1216..1386
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /inference="alignment:Splign:2.1.0"
     variation       1216
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745990406"
     variation       1220
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778792059"
     variation       1221
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253597404"
     variation       1222
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1212539373"
     variation       1232
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1350565597"
     variation       1233
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757796024"
     variation       1234
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754356799"
     variation       1235
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:764576617"
     variation       1240
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:556229292"
     variation       1241
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1160512073"
     variation       1242
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1272022180"
     variation       1243
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:878891490"
     variation       1245
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1228190683"
     variation       1248
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1440577827"
     variation       1250
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1339911001"
     variation       1253
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:756509306"
     variation       1262
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1252571387"
     variation       1263
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:753034401"
     variation       1264
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1245713924"
     variation       1266
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767191885"
     variation       1267
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759046215"
     variation       1276
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773930325"
     variation       1284
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201914504"
     variation       1286
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1421514555"
     variation       1287
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762521696"
     variation       1293
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1190292517"
     variation       1295
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1369407412"
     variation       1296
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1561771381"
     variation       1299..1301
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1561771372"
     variation       1299
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1472202284"
     variation       1302
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773322580"
     variation       1310
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1189699404"
     variation       1311
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1485755880"
     variation       1312
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1391143057"
     variation       1313
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1561771346"
     variation       1314
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:35381274"
     variation       1317
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747981160"
     variation       1319
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:776525457"
     variation       1320
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1275767374"
     variation       1324
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772341292"
     variation       1326
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375162549"
     variation       1327
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1291512141"
     variation       1332
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779181977"
     variation       1333
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757343684"
     variation       1334
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1287517973"
     variation       1335
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749330607"
     variation       1336
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1356032463"
     variation       1343
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1329516939"
     variation       1349
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1404684930"
     variation       1351
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:994683071"
     variation       1354
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778298980"
     variation       1362
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756560734"
     variation       1363
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372122886"
     variation       1364
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1207769671"
     variation       1368
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1410715797"
     variation       1369
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1265683666"
     variation       1374
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767815118"
     variation       1376
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:755401521"
     variation       1385
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755360448"
     exon            1387..1566
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /inference="alignment:Splign:2.1.0"
     variation       1388
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758085369"
     variation       1389
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749955993"
     variation       1391
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764781361"
     variation       1392
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761393367"
     variation       1395
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363908220"
     variation       1413
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753892360"
     variation       1415
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1432479692"
     variation       1417
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1345370738"
     variation       1422
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1160331180"
     variation       1423
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1434534045"
     variation       1424
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188735247"
     variation       1425
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760432417"
     variation       1428
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1296097083"
     variation       1429
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2304044"
     variation       1432
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771087651"
     variation       1436
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1445805600"
     variation       1437
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1028326734"
     variation       1439
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202141552"
     variation       1441
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1486990010"
     variation       1443
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769931944"
     variation       1444
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377603066"
     variation       1449
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1561770582"
     variation       1464
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748199099"
     variation       1467
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1300256324"
     variation       1472
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781599179"
     variation       1479
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769157829"
     variation       1480
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:747367486"
     variation       1482
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780400795"
     variation       1485
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370095443"
     variation       1486
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147214429"
     variation       1497
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370899306"
     variation       1498
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1004810629"
     variation       1499
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1489478190"
     variation       1504
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:753362629"
     variation       1505
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377459296"
     variation       1513
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252503783"
     variation       1514
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:532476363"
     variation       1519
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752450859"
     variation       1523
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373475070"
     variation       1524
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767405700"
     variation       1530
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:117731508"
     variation       1531
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200874080"
     variation       1534
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776734034"
     variation       1535
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1369865347"
     variation       1539
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1178557899"
     variation       1540
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1461681252"
     variation       1541
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1324612396"
     variation       1542
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1391725848"
     variation       1546
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769049808"
     variation       1547
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1474309300"
     variation       1549
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:965952237"
     variation       1558
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747491194"
     variation       1559
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775844954"
     variation       1562
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1293651290"
     variation       1565
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1561770459"
     exon            1567..1729
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /inference="alignment:Splign:2.1.0"
     variation       1571
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1374998534"
     variation       1572
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:962598779"
     variation       1573
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393657269"
     variation       1574
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381394072"
     variation       1575
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200587767"
     variation       1577
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1296604219"
     variation       1578
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367672335"
     variation       1583
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866804037"
     variation       1584
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1448805202"
     variation       1585
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776105614"
     variation       1592
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1376867895"
     variation       1597
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1166003966"
     variation       1598
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1448991070"
     variation       1599
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1453318131"
     variation       1602
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1361855113"
     variation       1603
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772681423"
     variation       1605
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746254120"
     variation       1618
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774814276"
     variation       1621
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200381159"
     variation       1622
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749030462"
     variation       1623
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1237447464"
     variation       1631
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:990783323"
     variation       1632
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777289428"
     variation       1633
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755693993"
     variation       1635
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1348023166"
     variation       1639
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1561769309"
     variation       1644
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1035469319"
     variation       1646
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1259355479"
     variation       1647
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1241576766"
     variation       1650
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:540998273"
     variation       1651
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781130845"
     variation       1654
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235306105"
     variation       1655
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1803521"
     variation       1663
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751361322"
     variation       1664
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766107448"
     variation       1667
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754155618"
     variation       1669
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1181060345"
     variation       1670
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1426207967"
     variation       1678
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:902623921"
     variation       1679
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1383006271"
     variation       1682
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372328515"
     variation       1683
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760857578"
     variation       1685
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1394235672"
     variation       1691
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1415314922"
     variation       1695
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200227942"
     variation       1700
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367549900"
     variation       1707
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768165929"
     variation       1710
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:983506607"
     variation       1712
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752895926"
     variation       1713
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199502989"
     variation       1715
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1035491375"
     variation       1717
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1207358713"
     exon            1730..5045
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /inference="alignment:Splign:2.1.0"
     variation       1732
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542333524"
     variation       1733
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1025206541"
     variation       1734
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3792837"
     variation       1735
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17853868"
     variation       1742
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:768220433"
     variation       1746..1750
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:1238404625"
     variation       1746
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374056960"
     variation       1749
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780014551"
     variation       1750
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771854528"
     variation       1753
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998856637"
     variation       1754
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773944258"
     variation       1763
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778502005"
     variation       1766
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1334226797"
     variation       1767
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:936628864"
     variation       1769
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756369537"
     variation       1773
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200584034"
     variation       1774
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755161394"
     variation       1776
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751645128"
     variation       1778
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766945584"
     variation       1779
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763302616"
     variation       1782
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:933380784"
     variation       1785
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1259727592"
     variation       1788
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376767463"
     variation       1789
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375392700"
     variation       1793
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762162860"
     variation       1794
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577467748"
     variation       1796
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1358675564"
     variation       1804
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763713401"
     variation       1805
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760199898"
     variation       1806
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774822283"
     variation       1817..1824
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="aagc"
                     /replace="aagcaagc"
                     /db_xref="dbSNP:762706222"
     variation       1819
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1051649933"
     variation       1821
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1414994738"
     variation       1824
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1158299773"
     variation       1832..1834
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="aaa"
                     /db_xref="dbSNP:775308643"
     variation       1835
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1480386473"
     variation       1838
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:764830950"
     variation       1838
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772047096"
     variation       1839
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1174962601"
     variation       1840
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1561768358"
     variation       1842
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:940846847"
     variation       1844
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1462775350"
     variation       1854..1858
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="aga"
                     /replace="agaga"
                     /db_xref="dbSNP:759160130"
     variation       1864
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1167714467"
     variation       1867
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:745731115"
     variation       1869
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1407066533"
     variation       1883
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:921121964"
     variation       1884
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:909423927"
     variation       1885
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1039611279"
     variation       1899
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308025835"
     variation       1900
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1443645348"
     variation       1902
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1256464246"
     variation       1903
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:985034235"
     variation       1904
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:959015596"
     variation       1914
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1033746347"
     variation       1916
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1487522078"
     variation       1919
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:980482519"
     variation       1923
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:970856736"
     variation       1924
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1024736425"
     variation       1934
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489617765"
     variation       1935
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1218035380"
     variation       1939
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1429637609"
     variation       1948
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1192917160"
     variation       1951
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1356435240"
     variation       1956
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1009318325"
     variation       1961
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1164494774"
     variation       1967
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:929679125"
     variation       1971
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1282887304"
     variation       1987
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:892299541"
     variation       1988
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:927729121"
     variation       1996
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1342090245"
     variation       2017
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1032167298"
     variation       2025
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:982290584"
     variation       2027
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1000722123"
     variation       2030
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:190962577"
     variation       2032
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1218085013"
     variation       2037
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1023565823"
     variation       2038
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1486472720"
     variation       2041..2046
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="ccccc"
                     /replace="cccccc"
                     /db_xref="dbSNP:1398368710"
     variation       2044
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:991675818"
     variation       2046
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1446782358"
     variation       2059
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767038754"
     variation       2062
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:957620062"
     variation       2065
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384781144"
     variation       2071
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:889061181"
     variation       2075
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1297323909"
     variation       2075
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140806749"
     variation       2079
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:575533132"
     variation       2080
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:555761451"
     variation       2082
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768344292"
     variation       2083
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1408242708"
     variation       2090
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1029728896"
     variation       2099
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:901890279"
     variation       2100
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1472183520"
     variation       2108
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1380122409"
     variation       2113
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:535952012"
     variation       2114
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:940789539"
     variation       2116
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1561768121"
     variation       2117
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1315853932"
     variation       2120
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:998707089"
     variation       2124
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1213074099"
     variation       2128
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:899635801"
     variation       2134
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1463060122"
     variation       2136
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1189263714"
     variation       2140
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746269998"
     variation       2144
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1460137713"
     variation       2150
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1262977998"
     variation       2152
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:909368057"
     variation       2157
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1418534197"
     variation       2159
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186317891"
     variation       2160
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:180940372"
     variation       2163
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1403700684"
     variation       2170
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:937567201"
     variation       2178
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1298355371"
     variation       2179
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:927583338"
     variation       2183
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:547175352"
     variation       2184
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:980813562"
     variation       2188
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1224721850"
     variation       2191
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:970424807"
     variation       2198
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:917624968"
     variation       2202
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1441083568"
     variation       2204
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1207099240"
     variation       2205
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1233612742"
     variation       2206
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:927647842"
     variation       2209
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1175554664"
     variation       2215
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146411440"
     variation       2219
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1357210930"
     variation       2235
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:947812458"
     variation       2236
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175669601"
     variation       2242
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1561768035"
     variation       2244
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1427153696"
     variation       2245
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1411401340"
     variation       2246
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1170894655"
     variation       2248
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761275309"
     variation       2254
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:956481807"
     variation       2255
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1439656054"
     variation       2258
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1217081129"
     variation       2271
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1345646513"
     variation       2277
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1340099091"
     variation       2278
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1032115891"
     variation       2280
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1000671622"
     variation       2285
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1406053373"
     variation       2287
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283156185"
     variation       2295
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753211757"
     variation       2298
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1274234073"
     variation       2304
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1561767997"
     variation       2305
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1400421688"
     variation       2317
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1203346237"
     variation       2318
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:991625142"
     variation       2319
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143982609"
     variation       2322
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198821247"
     variation       2323
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:953387351"
     variation       2325
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1028917588"
     variation       2326
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1186881502"
     variation       2332
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1321524682"
     variation       2334
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1404686292"
     variation       2335
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:997886096"
     variation       2339
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1165123514"
     variation       2345
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:901840873"
     variation       2347
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1036392715"
     variation       2348
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:551008324"
     variation       2351
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1300755414"
     variation       2353
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:531272775"
     variation       2375
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1433577841"
     variation       2380
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3749721"
     variation       2387
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139117381"
     variation       2388
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226689706"
     variation       2390..2391
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:35067518"
     variation       2390
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:899920672"
     variation       2391
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1221756308"
     variation       2393
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:927499608"
     variation       2395
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1448648298"
     variation       2396
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1423994828"
     variation       2399
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1018088966"
     variation       2406
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1241270186"
     variation       2411
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:528911748"
     variation       2414
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1185219181"
     variation       2418
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1385405645"
     variation       2421
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:950386150"
     variation       2424
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1161121462"
     variation       2425
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1049161"
     variation       2426
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:987788526"
     variation       2431
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1345141129"
     variation       2432
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:956431723"
     variation       2434
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771376088"
     variation       2442
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777051046"
     variation       2445
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:929890120"
     variation       2446
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:925046201"
     variation       2447..2449
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1383790999"
     variation       2448
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1803520"
     variation       2449
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373357109"
     variation       2457
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:953240184"
     variation       2458
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78922742"
     variation       2460
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:577431475"
     variation       2467..2471
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace=""
                     /replace="aatgc"
                     /db_xref="dbSNP:1283409307"
     variation       2469
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1409981009"
     variation       2471
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:188091020"
     variation       2479
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:916309156"
     variation       2482
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184807613"
     variation       2483
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151163132"
     variation       2484
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:936153475"
     variation       2488
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1243592297"
     variation       2489
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1272857374"
     variation       2501
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1435729731"
     variation       2503
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:926152928"
     variation       2508
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1014910747"
     variation       2512
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1470155242"
     variation       2513
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376062947"
     variation       2517
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1004901172"
     variation       2526..2533
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="tctt"
                     /replace="tctttctt"
                     /db_xref="dbSNP:1411787698"
     variation       2527
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1157498846"
     variation       2535
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1456177251"
     variation       2537
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772280263"
     variation       2559
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1339089024"
     variation       2569
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:575046837"
     variation       2585
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1407360316"
     variation       2595
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1027745037"
     variation       2599
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:968052518"
     variation       2600
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1337772775"
     variation       2604
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1239782859"
     variation       2609
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747457889"
     variation       2611
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:906026210"
     variation       2614
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1171018713"
     variation       2617
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:977168145"
     variation       2630
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142183802"
     variation       2632
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:555468068"
     variation       2634
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1411293422"
     variation       2635
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1263498134"
     variation       2646
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:10065495"
     variation       2651
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:950309942"
     variation       2653
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198539988"
     variation       2660
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1252156152"
     variation       2666
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1018370712"
     variation       2667
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:892064091"
     variation       2670
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1005666546"
     variation       2672
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:573330599"
     variation       2674
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1052020459"
     variation       2675
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:935005426"
     variation       2676
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1430651447"
     variation       2678
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:553528497"
     variation       2680
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171196818"
     variation       2687
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:576930831"
     variation       2696
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:994058434"
     variation       2703
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1392245953"
     variation       2718
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:906450637"
     variation       2719
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1177247033"
     variation       2721
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:924993885"
     variation       2722
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111296628"
     variation       2727
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:540005947"
     variation       2728
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1230707485"
     variation       2729
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:979201396"
     variation       2730
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:758616098"
     variation       2732
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1440883320"
     variation       2736
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:931757769"
     variation       2741
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:921769363"
     variation       2750
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1339640667"
     variation       2755
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1194921427"
     variation       2756
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1271820982"
     variation       2764
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:976339248"
     variation       2768
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:965923954"
     variation       2771
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1012322404"
     variation       2773
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1433116265"
     variation       2780
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:181267279"
     variation       2788
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1375194510"
     variation       2790
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1345369401"
     variation       2799
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1305550629"
     variation       2805
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1462662726"
     variation       2811
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168157945"
     variation       2813
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1368976287"
     variation       2815
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748222574"
     variation       2819
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1181832633"
     variation       2821
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:190171030"
     variation       2826
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1385068527"
     variation       2831
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1561767735"
     variation       2831
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1297425513"
     variation       2833
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:983413500"
     variation       2840
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:952024911"
     variation       2841
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:537333317"
     variation       2848
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1443988781"
     variation       2853
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1222493263"
     variation       2855
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1290482364"
     variation       2863
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1001611256"
     variation       2866
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357093385"
     variation       2868
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:75613839"
     variation       2869
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:977071957"
     variation       2871
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1415409924"
     variation       2879
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1024455168"
     variation       2893
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1188343580"
     variation       2911
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1561767671"
     variation       2913
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1014851467"
     variation       2926
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:964374469"
     variation       2927
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:548651514"
     variation       2936
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1053303249"
     variation       2939
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1456300007"
     variation       2941
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:936296920"
     variation       2950
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:879111154"
     variation       2957
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1381046852"
     variation       2959
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:952773040"
     variation       2961
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:903521310"
     variation       2962
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1043811953"
     variation       2963..2966
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace=""
                     /replace="ggga"
                     /db_xref="dbSNP:1246331238"
     variation       2965
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384534006"
     variation       2968
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76958182"
     variation       2972
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:921689407"
     variation       2977..2978
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1262958546"
     variation       2977
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1240593626"
     variation       2982
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1486482310"
     variation       2983
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:560071783"
     variation       2989..2990
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:1442845895"
     variation       2998
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1246637746"
     variation       3006
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1462808671"
     variation       3010
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1184481287"
     variation       3019
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1025292597"
     variation       3022
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1282190886"
     variation       3025
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1012194075"
     variation       3029
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1561767611"
     variation       3030
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1364239605"
     variation       3031
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:75139854"
     variation       3041
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779874606"
     variation       3044
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1561767595"
     variation       3051
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1408086658"
     variation       3063
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1352867213"
     variation       3067..3069
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:560014863"
     variation       3070
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755819037"
     variation       3075
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1392559250"
     variation       3076
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1309827674"
     variation       3080
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907747359"
     variation       3081
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:546271916"
     variation       3083
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:946207165"
     variation       3089
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1266589167"
     variation       3092
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1326045942"
     variation       3101
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1204734556"
     variation       3108
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1237062141"
     variation       3110
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115762779"
     variation       3116
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1179017648"
     variation       3120
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1041683258"
     variation       3121
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1472209822"
     variation       3124
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1156812272"
     variation       3131
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:920590818"
     variation       3136
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:942981928"
     variation       3142
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1175103467"
     variation       3145
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1357068209"
     variation       3149
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1463255188"
     variation       3154
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1298230173"
     variation       3157
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1561767530"
     variation       3171
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:980530559"
     variation       3175
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1349382823"
     variation       3177
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1407488619"
     variation       3180
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1286946375"
     variation       3181
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:970140405"
     variation       3185
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1347951872"
     variation       3186
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1419425816"
     variation       3191
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278436274"
     variation       3195
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1310648930"
     variation       3212
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1206946276"
     variation       3214
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1275404076"
     variation       3218
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1361765044"
     variation       3220
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1161826323"
     variation       3221
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1270880963"
     variation       3231
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403686322"
     variation       3232
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1413147527"
     variation       3234
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1182727292"
     variation       3239
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1476291900"
     variation       3241
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:911184698"
     variation       3242
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1191265869"
     variation       3245
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:564124459"
     variation       3248
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:984127456"
     variation       3249
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1261247115"
     variation       3252
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1217788162"
     variation       3263..3271
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="aaga"
                     /replace="aagataaga"
                     /db_xref="dbSNP:1427196387"
     variation       3267
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:931334957"
     variation       3268..3272
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="aa"
                     /replace="aagaa"
                     /db_xref="dbSNP:753606011"
     variation       3272
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1304433605"
     variation       3274
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756774466"
     variation       3281
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1024819888"
     variation       3296
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369757405"
     variation       3300
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1274605664"
     variation       3303
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1014338047"
     variation       3309
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:867237370"
     variation       3316
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577580337"
     variation       3317
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:544437600"
     variation       3332
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:530676830"
     variation       3333
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1000391210"
     variation       3336
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1275864822"
     variation       3338
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:959286857"
     variation       3339
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1452090392"
     variation       3345
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:562019808"
     variation       3353
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244945315"
     variation       3354
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1043369498"
     variation       3357
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542218190"
     variation       3364
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1389094862"
     variation       3369
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1409676694"
     variation       3375
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1291201879"
     variation       3382
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1164920348"
     variation       3387
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1385370335"
     variation       3391
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:902228015"
     variation       3400
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1323428141"
     variation       3403
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1348662553"
     variation       3409
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1433247812"
     variation       3411
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765804403"
     variation       3413..3416
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1021107170"
     variation       3426
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:573291818"
     variation       3430
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:944471309"
     variation       3432
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226535469"
     variation       3434
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:866405044"
     variation       3435
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147224404"
     variation       3438
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1170157768"
     variation       3438
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1049171"
     variation       3440
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143682341"
     variation       3449
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1287569424"
     variation       3450
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1448662612"
     variation       3451
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1209113175"
     variation       3452
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1247248386"
     variation       3456
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047617031"
     variation       3457
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:557229342"
     variation       3468
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188281200"
     variation       3472
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237724967"
     variation       3481
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1041217453"
     variation       3483
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1160956493"
     variation       3486
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537653143"
     variation       3487
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1403011920"
     variation       3491
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:920522605"
     variation       3500
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:980094080"
     variation       3506..3526
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="gga"
                     /replace="ggagatagccaaggaacagga"
                     /db_xref="dbSNP:1341309617"
     variation       3508
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1388423116"
     variation       3517
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1433393907"
     variation       3525
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754207295"
     variation       3527
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1447296810"
     variation       3530
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:890032573"
     variation       3533
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1048715299"
     variation       3534
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:970468110"
     variation       3536
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1228982307"
     variation       3540
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:568629561"
     variation       3541
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:554858336"
     variation       3543
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:59026412"
     variation       3545
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1326765463"
     variation       3551
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1205355088"
     variation       3559
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1256343902"
     variation       3564
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:535017942"
     variation       3566
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:918619694"
     variation       3567
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1234165694"
     variation       3570
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:566108899"
     variation       3572
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:973198525"
     variation       3573..3575
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:775342340"
     variation       3574
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:949514923"
     variation       3576..3579
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:917703300"
     variation       3577
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:917297411"
     variation       3579
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1179032800"
     variation       3582
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1414173131"
     variation       3589
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:990678010"
     variation       3591
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:959233139"
     variation       3598
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:992865958"
     variation       3600
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1287592411"
     variation       3606
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1348564304"
     variation       3609
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1225113125"
     variation       3610
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1032219554"
     variation       3617
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198417758"
     variation       3618
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1274720451"
     variation       3624
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:956153718"
     variation       3627
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1203832703"
     variation       3628
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1251641244"
     variation       3635
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:546235095"
     variation       3639
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1031781681"
     variation       3649
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1471933416"
     variation       3651
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201440584"
     variation       3662
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1378620974"
     variation       3664
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1000332437"
     variation       3666
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3805533"
     variation       3667
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1170996543"
     variation       3670
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1372665307"
     variation       3678
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1028995254"
     variation       3682
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1307572658"
     variation       3686
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:997145717"
     variation       3689
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1443203023"
     variation       3701
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760878995"
     variation       3703
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1398132935"
     variation       3711..3713
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="aca"
                     /db_xref="dbSNP:1331002055"
     variation       3718
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301684331"
     variation       3726
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1223842185"
     variation       3728
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1020633140"
     variation       3732
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:997634129"
     variation       3739
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:901598981"
     variation       3740
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1017804581"
     variation       3748
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1203802960"
     variation       3749..3760
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="cat"
                     /replace="catatacctcat"
                     /db_xref="dbSNP:889980542"
     variation       3754
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:900158149"
     variation       3761
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1212193206"
     variation       3768
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866975550"
     variation       3769
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:868323800"
     variation       3776
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773577949"
     variation       3784
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1172248251"
     variation       3790
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:570537803"
     variation       3794
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:970654566"
     variation       3802
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1431187403"
     variation       3804
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1040089209"
     variation       3813
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1347138915"
     variation       3820
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1008630789"
     variation       3824
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:550457244"
     variation       3832
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1037038250"
     variation       3837
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1235821795"
     variation       3845
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1459541817"
     variation       3847
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3805532"
     variation       3848
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:115528173"
     variation       3849
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252651369"
     variation       3857
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1231569208"
     variation       3859
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1227271639"
     variation       3860
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1311909053"
     variation       3861..3866
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="ctct"
                     /replace="ctctct"
                     /db_xref="dbSNP:1294725218"
     variation       3861
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1304829365"
     variation       3871
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1360925605"
     variation       3877
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1237126666"
     variation       3878..3882
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="actca"
                     /db_xref="dbSNP:1266487264"
     variation       3879
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1244910517"
     variation       3883
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1055178017"
     variation       3887..3888
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace=""
                     /replace="ct"
                     /db_xref="dbSNP:1374853837"
     variation       3888
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1208418330"
     variation       3891
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543950398"
     variation       3894
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1188122850"
     variation       3899
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:920486015"
     variation       3902
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1044703803"
     variation       3911
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:925149454"
     variation       3915
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:948698980"
     variation       3916..3920
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="t"
                     /replace="tctgt"
                     /db_xref="dbSNP:1165582229"
     variation       3925
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1367811557"
     variation       3927
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1456379770"
     variation       3940
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:542132317"
     variation       3943
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:528426118"
     variation       3951
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1281879132"
     variation       3952
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:917226516"
     variation       3959
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:992812075"
     variation       3960
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:966598861"
     variation       3962
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:140722862"
     variation       3979
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:924706115"
     variation       3980
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:546225404"
     variation       3996
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358344124"
     variation       3999
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1270611156"
     variation       4011
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:966140200"
     variation       4015
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1174254956"
     variation       4017
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185191627"
     variation       4024
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577220223"
     variation       4033
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1182504798"
     variation       4047
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1007343752"
     variation       4052
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1028523440"
     variation       4060
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:976054961"
     variation       4063
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184201118"
     variation       4064
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:965679948"
     variation       4067
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1419110244"
     variation       4078
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:563824992"
     variation       4082
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1008583464"
     variation       4086..4093
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="tctt"
                     /replace="tctttctt"
                     /db_xref="dbSNP:1198315750"
     variation       4100
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:543618143"
     variation       4103
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1281492645"
     variation       4106
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1362646640"
     variation       4110
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1026073267"
     variation       4113
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1213695036"
     variation       4114
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1376295363"
     variation       4120
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756059804"
     variation       4129
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1290696658"
     variation       4134
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:995720042"
     variation       4140
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:898987350"
     variation       4153
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1305382947"
     variation       4171
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314139464"
     variation       4185
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1044267004"
     variation       4186
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775253342"
     variation       4196
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310915998"
     variation       4199
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:895755637"
     variation       4200
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:191949529"
     variation       4208
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769636269"
     variation       4229
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1313236898"
     variation       4238
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1179724507"
     variation       4245
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554770643"
     variation       4248
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1427057222"
     variation       4251
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1436300201"
     variation       4252..4253
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1174859186"
     variation       4252
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:934664132"
     variation       4259
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1157905250"
     variation       4261
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1453871698"
     variation       4262
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1308183974"
     variation       4262
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:924653339"
     variation       4265
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978806136"
     variation       4275
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1409798266"
     variation       4283
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:947521699"
     variation       4285
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:925095615"
     variation       4293
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1315341647"
     variation       4295
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:534982300"
     variation       4298
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1422850425"
     variation       4299
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:575087390"
     variation       4303
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:913815487"
     variation       4305
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:965987934"
     variation       4306
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1248407556"
     variation       4307
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1019888078"
     variation       4310..4315
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace=""
                     /replace="tatctg"
                     /db_xref="dbSNP:1389051087"
     variation       4311
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:987097041"
     variation       4312
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11950394"
     variation       4319
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:552511473"
     variation       4325
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:539422518"
     variation       4327
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1352134970"
     variation       4341
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1437547778"
     variation       4342
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:985853382"
     variation       4345
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:951778955"
     variation       4347
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1353013153"
     variation       4350
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1027121998"
     variation       4354
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:187846605"
     variation       4355..4360
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="ccccc"
                     /replace="cccccc"
                     /db_xref="dbSNP:1159566212"
     variation       4355
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1347123186"
     variation       4356
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:6897295"
     variation       4358
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1015830757"
     variation       4360
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1431895213"
     variation       4361
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1561766820"
     variation       4362
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115557293"
     variation       4363
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1416394671"
     variation       4365
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:896459370"
     variation       4367
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:184531246"
     variation       4371
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:548454587"
     variation       4373
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002208602"
     variation       4380
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1382708083"
     variation       4383
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:528351919"
     variation       4386
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1386554303"
     variation       4388
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1056974505"
     variation       4396
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:559686409"
     variation       4398
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1447066682"
     variation       4401
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:934611980"
     variation       4404
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1416581931"
     variation       4414
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1024965541"
     variation       4418
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:903177817"
     variation       4428
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1160930114"
     variation       4432
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1406518361"
     variation       4433
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1043085343"
     variation       4436..4442
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="tct"
                     /replace="tctctct"
                     /db_xref="dbSNP:1043828405"
     variation       4440
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:903936805"
     variation       4442
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1364739828"
     variation       4446
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1428721417"
     variation       4447
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764343201"
     variation       4451
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:945210089"
     variation       4452
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1166571666"
     variation       4455
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1271225636"
     variation       4457
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:59587692"
     variation       4464
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1477077656"
     variation       4474
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1330883781"
     variation       4477
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1209133782"
     variation       4487
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1267022416"
     variation       4500
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147258016"
     variation       4502
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237598097"
     variation       4504
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:921369528"
     variation       4507
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371276937"
     variation       4508
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:563565974"
     variation       4522
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:910179418"
     variation       4535
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:944192267"
     variation       4538
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:543875240"
     variation       4564..4567
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1399230834"
     variation       4572
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:574882197"
     variation       4581
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1359768806"
     variation       4587
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1447417436"
     variation       4597
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:554721306"
     variation       4604
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149557051"
     variation       4605
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:983026175"
     variation       4608
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1228774476"
     variation       4609
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:972248367"
     variation       4613
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:961556275"
     variation       4616
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1201863201"
     variation       4617
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1016191695"
     variation       4635
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541235882"
     variation       4636
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1441278284"
     variation       4642
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:951639425"
     variation       4650
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:918909282"
     variation       4652
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:961253815"
     variation       4659
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1183326660"
     variation       4660
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363631200"
     variation       4671
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:13002"
     variation       4674
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:973110916"
     variation       4679
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:963430840"
     variation       4684
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1315907639"
     variation       4689
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1561766625"
     variation       4690
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1426148564"
     variation       4698
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1413909732"
     variation       4701
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1033924849"
     variation       4710
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1022715522"
     variation       4718
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1269348588"
     variation       4719
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1410407872"
     variation       4720
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1307145239"
     variation       4725
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1013119905"
     variation       4727
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1333718260"
     variation       4730
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1228131454"
     variation       4731
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1002154938"
     variation       4740
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1343939673"
     variation       4750
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1231427970"
     variation       4764..4777
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="tc"
                     /replace="tcccagatacactc"
                     /db_xref="dbSNP:1206450245"
     variation       4765
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1276220174"
     variation       4775
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:903885818"
     variation       4779
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:959856111"
     variation       4787
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1022322565"
     variation       4789
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:13495"
     variation       4803
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:116934475"
     variation       4805
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1436371314"
     variation       4816
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1378416821"
     variation       4817
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1035514193"
     variation       4828
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1561766565"
     variation       4831
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:998709311"
     variation       4833
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171819264"
     variation       4843
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1392146959"
     variation       4859..4867
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="tgg"
                     /replace="tgggtatgg"
                     /db_xref="dbSNP:1430519786"
     variation       4862
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:903124057"
     variation       4868
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1167197729"
     variation       4875
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1394256221"
     variation       4878
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:892275251"
     variation       4883
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1324034186"
     variation       4892
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1330129512"
     variation       4899
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750294618"
     variation       4904
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1438315270"
     variation       4918
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75982120"
     variation       4919
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746565930"
     variation       4928
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777245857"
     variation       4929
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1039789056"
     variation       4933
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1049378"
     variation       4942
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:944605950"
     variation       4943
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191318509"
     variation       4947
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1211988230"
     variation       4954..4958
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="tgt"
                     /replace="tgtgt"
                     /db_xref="dbSNP:1468179092"
     variation       4954
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757799876"
     variation       4976
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1050373921"
     variation       4981
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1419309538"
     variation       4981
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:930278103"
     variation       4988
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1192651668"
     variation       4996
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1168874936"
     variation       4997
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:920288580"
     variation       5009
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047286521"
     variation       5014
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1393410623"
     variation       5017
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:908673517"
     variation       5021
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198706018"
     variation       5030
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:113986956"
     variation       5032
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1365475650"
     variation       5033
                     /gene="DPYSL3"
                     /gene_synonym="CRMP-4; CRMP4; DRP-3; DRP3; LCRMP; ULIP;
                     ULIP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1469010117"
ORIGIN      
attcactccacctgatctcggggcgctgtgcgctgaggaaggcgcgggcgagccggagcagaagaaggagggagggagccagccgctgcagccaccaccgccaccatgtcctaccaaggcaagaagaacatcccgcggatcacgagtgaccgtctccttatcaagggaggcagaatcgtcaatgatgatcagtccttttatgctgatatttacatggaagatggcttaataaaacaaattggagacaatctgattgttcctggaggagtgaagaccattgaagccaatgggaagatggtgatccctggaggcatcgatgtccatactcacttccagatgccatataagggaatgaccacagtagatgacttcttccaagggacaaaggcggccttagcaggtggcaccaccatgatcattgaccatgtggtgcctgagcctgagtccagcctgactgaggcctatgagaaatggagagagtgggctgatgggaagagttgctgtgactatgccctgcatgtggacatcacccactggaatgacagcgtcaagcaggaagtgcagaacctcatcaaggacaaaggggttaactccttcatggtttatatggcttataaggatttgtatcaagtatctaacacagagctctatgagatcttcacctgcctgggagagctgggggccattgctcaagttcatgctgagaatggggatatcattgcccaggagcaaacccgcatgttggaaatggggataactggcccagaaggccatgtactgagcaggccagaagagctggaagctgaggctgtgttccgtgccatcaccattgccagccaaaccaattgccctctctacgtcacaaaggtcatgagcaagagtgcagctgacctcatctcacaagccaggaaaaaaggaaatgtagtctttggtgagcccatcactgccagcctcggcatagatggaacccattattggagcaagaactgggccaaggcggctgcatttgtgacatccccacccctgagccctgacccaactactccggactacatcaactccttgctggccagcggggatctgcagctatctgggagtgcccactgcaccttcagcactgcccagaaagcaattgggaaggacaacttcacagccattcctgagggcaccaatggtgtggaggagcggatgtctgtcatctgggacaaggctgtggccacagggaaaatggacgaaaaccagttcgtggctgtgacaagcacaaacgctgccaagatcttcaacctgtatccccgcaagggaagaatatctgtgggttctgacagcgacctcgtcatctgggatccagatgctgtgaagatcgtctctgccaagaaccaccagtctgcggcagagtacaacatctttgaagggatggagctgcgcggggctcctctggttgtcatctgccagggcaagatcatgctggaagatggcaacctgcacgtgacccagggggctggccgcttcataccctgcagcccgttctccgactatgtctacaagcgcattaaagcacggaggaagatggcagacctgcatgccgtcccaaggggcatgtacgatgggcctgtgtttgacctgaccaccacccccaaaggtggcacccccgcaggctctgctcggggctctcctactcggccgaacccacctgtgaggaatcttcatcagtcgggatttagcctgtcaggcacccaagtggatgagggggttcgctcagccagcaagcgcatcgtggcgcccccaggcggccgttctaatatcacatctctgagttaagcaagccttcctcaaagagaggggcagaagcaagaagagattgttttgaagccaaaatggtacaccgatatttaagaaggaaagcgaatccaaacggttgtgatctaaagaatcaataagcctcaagccttatgtttctccaatgttacgctcgcttgcctagctttacgaatattgctttgttttctgtttatgcatagccttgatttgtttgactcccctccccccatttacatgcatgcaatcagacaggccactaaggtaaaagagtctgctctatcatagtgttgagagcgtgtgtagtgctgcatcttatgacaaggggacagacaagctgggacgtcagggaaatgaacaaaagggacgcaggttatttggggtgagtgggtggtgggagcctggagcaaggtggagggtgcagaggggctggggtagggcatgtaggagggaggtgggtgggtcaggtgagtggaaggggtgttgtatattgtgttgatgacgtacgttatttccatggaagatagccgctgtggcagctgtcacatcaccacagctccctagggtctgccgagaaggcaggcagtctttgggttctgttctttgtcacgtcccctacaagtaaattttgtttctttgaacgtttattaaaatgccaagacccaaccatttcttccacctgcttgattgtgccagtgtttgctcaggcctctttcttagtgttgctttcaaatccttctctttcctgggttgggaaggccaggcagggacagagcaaatgacacttctcttcctcttgccctccctgcctctttggtgctcttaaaagccagcagctgagaacatagcacaggcccacgtggtgagggcacccacagcttaaagacgcttccttctaaacacggcgaggtcacctctcactcttctgtctttgcaaaccgagaagagtggcatgcttctggcatcccaagtcaggattttagctcagatgaggcagaatgaagggcctctcttacaggcagtttgtgtttgattctctcgatcctggcacatccatgataaataggagtttttgaaagttggttttattaggtgttccctaatttttaccgtaataggtcatctcagcttatatgaaagtcaagtggggaactgggaaagccaaagtcagtcttgagcagagggagcacattttgtggacctggttccacctttccattccaaaccacctgtttccccttccattagcagaaactctgggggaactttgtgtctcagtcctagaatctccccaagtgagtggaagtgacatgatgcagtcttcctcatggggcacctgaaagaaattagtgtgggtgcttcgatctaccttgtctgtcagagttgaatatctctttccctatcatgctgcttctgaaaattcagttttggagcaagtcctgtgagcaagataagaatctatagaaccaagatgctcattttcagaagaaatatgttcaacctgggatcagacttccatgctctggggaatccaagtggtagcacctgtaaccctgtgtactaagtgctttgaagagaagagcaggcctcagacaccttttaattgcttaggagaaaccattgtctctgactgcaggtttgaataagttgaagaccagagaaaagtacacactgggctacaaaggaatttggagatagccaaggaacaggatttcccctagcaagctaccttctgttcaaatcatgaaaaaagactatttccccttagaatagggaagcttgctattttaaagctcttgtagtgcttttcttttaagggagatgtagtaaaagggaaaatgtagctcttagtttacacttcaaagatgtgggggtctttcagagaactaagaataacagttttatgtgcagagagagtttgccagatctgaagcatatacctcattgactaggctgttactttgggataggttgcagtaccagccacagccagcagatagaggaaaagacacacataaactcgcttctgagcgtccacttctgcactctctgctctgctgttactcagcccctgagtctgactcatctctgcacaacctctctgtgccatgaagataagtcttccatggccaaatcggtcatccgcactgcccttgggacttccgaagtgaaccattccaccagaacctttgattctgcacaagatttccttgctctgggaacaacccccaaatgcccttgggaggaacaacatgagctcaggaagcctctctttcttcacttaccattactaactctccaagcatagaaatccctgggaattgcgagaataactcccactattttaaaatttatattcagatttgtttcgtttcataagacacatcaaacaggcctatacaaaaggtttaggaaaagaaaacaatggtgagtcccggccctcttcgaattcactggcacctcatgcaagtgtaggaaggcacgctggatcgtctatctgattccaaagctgtcctttgccatctcatcccttggcctgccccccaaccctgaggatgcccctgccatccccccaacctcctcatattgcctctgaacccagatggcaatccatcccggttctctctgagggccacgggcttgggtagtggaaagggtgtttgggaaattgttaaatcagttacccgtagtagagctatttcttgtacttctaagttttctagaagtggaaggattgtagtcatcctgaaaatgggtttacttcaaaatccctcagccttgttcttcacgactgtctatactgagagtgtcatgtttccacaaagggctgacacctgagcctggattttcactcatccctgagaagccctttccagtagggtgggcaattcccaacttccttgccacaagcttcccaggctttctcccctggaaaactccagcttgagtcccagatacactcatgggctgccctgggcagccagcattcattgtaagttccctctttgaaaactggtgtgtgggtgttcagttctgtgtctggtgggtatggacagacagtaatctcctgtgatctgtgctagctgtgaggcagctctggaacgtgaagagctgtttggtttgaaccgtgaacaaaactgtgttttgagtttagctgacattaaagaaaaaagttcatcacgtgactgttaatgtaaacctggttattaaaataactatgaaattaccaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]