GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-07-31 01:47:50, GGRNA.v2 : RefSeq release 206 (May, 2021)

LOCUS       NM_001385460            3699 bp    mRNA    linear   PRI 16-MAY-2021
DEFINITION  Homo sapiens inositol polyphosphate-4-phosphatase type II B
            (INPP4B), transcript variant 42, mRNA.
ACCESSION   NM_001385460 XM_005263323
VERSION     NM_001385460.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3699)
  AUTHORS   Wu Y, Meng D, Xu X, Bao J, You Y, Sun Y, Li Y and Sun D.
  TITLE     Expression and functional characterization of INPP4B in gallbladder
            cancer patients and gallbladder cancer cells
  JOURNAL   BMC Cancer 21 (1), 433 (2021)
   PUBMED   33879096
  REMARK    GeneRIF: Expression and functional characterization of INPP4B in
            gallbladder cancer patients and gallbladder cancer cells.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 3699)
  AUTHORS   Chaurasiya S, Wu W, Strom AM, Warner M and Gustafsson JA.
  TITLE     Estrogen receptor beta regulates AKT activity through up-regulation
            of INPP4B and inhibits migration of prostate cancer cell line PC-3
  JOURNAL   Proc Natl Acad Sci U S A 117 (42), 26347-26355 (2020)
   PUBMED   33020300
  REMARK    GeneRIF: Estrogen receptor beta regulates AKT activity through
            up-regulation of INPP4B and inhibits migration of prostate cancer
            cell line PC-3.
REFERENCE   3  (bases 1 to 3699)
  AUTHORS   Yang L, Ding C, Tang W, Yang T, Liu M, Wu H, Wen K, Yao X, Feng J
            and Luo J.
  TITLE     INPP4B exerts a dual function in the stemness of colorectal cancer
            stem-like cells through regulating Sox2 and Nanog expression
  JOURNAL   Carcinogenesis 41 (1), 78-90 (2020)
   PUBMED   31179504
  REMARK    GeneRIF: INPP4B exerts a dual function in the stemness of
            colorectal cancer stem-like cells through regulating Sox2 and Nanog
            expression.
REFERENCE   4  (bases 1 to 3699)
  AUTHORS   Aki S, Yoshioka K, Takuwa N and Takuwa Y.
  TITLE     TGFbeta receptor endocytosis and Smad signaling require
            synaptojanin1, PI3K-C2alpha-, and INPP4B-mediated phosphoinositide
            conversions
  JOURNAL   Mol Biol Cell 31 (5), 360-372 (2020)
   PUBMED   31913757
  REMARK    GeneRIF: TGFbeta receptor endocytosis and Smad signaling require
            synaptojanin1, PI3K-C2alpha-, and INPP4B-mediated phosphoinositide
            conversions.
REFERENCE   5  (bases 1 to 3699)
  AUTHORS   Chen X, Theobard R, Zhang J and Dai X.
  TITLE     Genetic interactions between INPP4B and RAD50 is prognostic of
            breast cancer survival
  JOURNAL   Biosci Rep 40 (1) (2020)
   PUBMED   31872854
  REMARK    GeneRIF: Genetic interactions between INPP4B and RAD50 is
            prognostic of breast cancer survival.
REFERENCE   6  (bases 1 to 3699)
  AUTHORS   Rampersaud E, Damcott CM, Fu M, Shen H, McArdle P, Shi X, Shelton
            J, Yin J, Chang YP, Ott SH, Zhang L, Zhao Y, Mitchell BD, O'Connell
            J and Shuldiner AR.
  TITLE     Identification of novel candidate genes for type 2 diabetes from a
            genome-wide association scan in the Old Order Amish: evidence for
            replication from diabetes-related quantitative traits and from
            independent populations
  JOURNAL   Diabetes 56 (12), 3053-3062 (2007)
   PUBMED   17846126
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   7  (bases 1 to 3699)
  AUTHORS   Munday AD, Norris FA, Caldwell KK, Brown S, Majerus PW and Mitchell
            CA.
  TITLE     The inositol polyphosphate 4-phosphatase forms a complex with
            phosphatidylinositol 3-kinase in human platelet cytosol
  JOURNAL   Proc Natl Acad Sci U S A 96 (7), 3640-3645 (1999)
   PUBMED   10097090
REFERENCE   8  (bases 1 to 3699)
  AUTHORS   Zhang X and Majerus PW.
  TITLE     Phosphatidylinositol signalling reactions
  JOURNAL   Semin Cell Dev Biol 9 (2), 153-160 (1998)
   PUBMED   9599410
  REMARK    Review article
REFERENCE   9  (bases 1 to 3699)
  AUTHORS   Norris FA, Atkins RC and Majerus PW.
  TITLE     The cDNA cloning and characterization of inositol polyphosphate
            4-phosphatase type II. Evidence for conserved alternative splicing
            in the 4-phosphatase family
  JOURNAL   J Biol Chem 272 (38), 23859-23864 (1997)
   PUBMED   9295334
REFERENCE   10 (bases 1 to 3699)
  AUTHORS   Norris FA, Auethavekiat V and Majerus PW.
  TITLE     The isolation and characterization of cDNA encoding human and rat
            brain inositol polyphosphate 4-phosphatase
  JOURNAL   J Biol Chem 270 (27), 16128-16133 (1995)
   PUBMED   7608176
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AC093860.3 and AC108077.3.
            On Jul 17, 2020 this sequence version replaced XM_005263323.3.
            
            Summary: INPP4B encodes the inositol polyphosphate 4-phosphatase
            type II, one of the enzymes involved in phosphatidylinositol
            signaling pathways. This enzyme removes the phosphate group at
            position 4 of the inositol ring from inositol 3,4-bisphosphate.
            There is limited data to suggest that the human type II enzyme is
            subject to alternative splicing, as has been established for the
            type I enzyme. [provided by RefSeq, Jul 2008].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR1660809.196490.1 [ECO:0000332]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-133               AC093860.3         178658-178790       c
            134-213             AC093860.3         178416-178495       c
            214-325             AC093860.3         143621-143732       c
            326-398             AC093860.3         133450-133522       c
            399-546             AC093860.3         110822-110969       c
            547-677             AC093860.3         81854-81984         c
            678-782             AC093860.3         81383-81487         c
            783-891             AC093860.3         66045-66153         c
            892-1069            AC093860.3         46590-46767         c
            1070-1273           AC093860.3         33316-33519         c
            1274-1430           AC093860.3         18798-18954         c
            1431-1603           AC108077.3         102529-102701       c
            1604-1727           AC108077.3         101233-101356       c
            1728-1845           AC108077.3         100069-100186       c
            1846-1986           AC108077.3         90483-90623         c
            1987-2084           AC108077.3         86034-86131         c
            2085-2197           AC108077.3         64085-64197         c
            2198-2352           AC108077.3         59972-60126         c
            2353-3699           AC108077.3         6897-8243           c
FEATURES             Location/Qualifiers
     source          1..3699
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="4"
                     /map="4q31.21"
     gene            1..3699
                     /gene="INPP4B"
                     /note="inositol polyphosphate-4-phosphatase type II B"
                     /db_xref="GeneID:8821"
                     /db_xref="HGNC:HGNC:6075"
                     /db_xref="MIM:607494"
     exon            1..133
                     /gene="INPP4B"
                     /inference="alignment:Splign:2.1.0"
     CDS             98..2527
                     /gene="INPP4B"
                     /EC_number="3.1.3.66"
                     /note="isoform 5 is encoded by transcript variant 42;
                     inositol polyphosphate 4-phosphatase II; 4-phosphatase II;
                     type II inositol 3,4-bisphosphate 4-phosphatase; inositol
                     polyphosphate-4-phosphatase, type II, 105kDa"
                     /codon_start=1
                     /product="inositol polyphosphate 4-phosphatase type II
                     isoform 5"
                     /protein_id="NP_001372389.1"
                     /db_xref="GeneID:8821"
                     /db_xref="HGNC:HGNC:6075"
                     /db_xref="MIM:607494"
                     /translation="
MIHFHPLILPHERSFLGYASFKVGELLKSKEQLLVLSLRTSDGGKVVGTIEVSVVKMGEIEDGEADHITTDVQGQKCALVCECTAPESVSGKDNLPFLNSVLKNPVCKLYRFPTSDNKWMRIREQMSESILSFHIPKELISLHIKEDLCRNQEIKELGELSPHWDNLRKNVLTHCDQMVNMYQDILTELSKETGSSFKSSSSKGEKTLEFVPINLHLQRMQVHSPHLKDALYDVITVGAPAAHFQGFKNGGLRKLLHRFETERRNTGYQFIYYSPENTAKAKEVLSNINQLQPLIATHADLLLNSASQHSPDSLKNSLKMLSEKTELFVHAFKDQLVRSALLALYTARPGGILKKPPSPKSSTEESSPQDQPPVMRGQDSIPHHSDYDEEEWDRVWANVGKSLNCIIAMVDKLIERDGGSEGSGGNNDGEKEPSLTDAIPSHPREDWYEQLYPLILTLKDCMGEVVNRAKQSLTFVLLQELAYSLPQCLMLTLRRDIVFSQALAGLVCGFIIKLQTSLYDPGFLQQLHTVGLIVQYEGLLSTYSDEIGMLEDMAVGISDLKKVAFKIIEAKSNDVLPVITGRREHYVVEVKLPARMFESLPLQIKEGQLLHVYPVLFNVGINEQQTLAERFGDVSLQESINQENFELLQEYYKIFMEKMPPDYISHFQEQNDLKALLENLLQNIQSKKRKNVEIMWLAATICRKLNGIRFTCCKSAKDRTSMSVTLEQCSILRDEHQLHKDFFIRALDCMRSRQTQGALNESDDPETGCLTDNKPTSRHFYPVALLLVSSHLLVVWLILSLALLLAKYQ"
     exon            134..213
                     /gene="INPP4B"
                     /inference="alignment:Splign:2.1.0"
     exon            214..325
                     /gene="INPP4B"
                     /inference="alignment:Splign:2.1.0"
     exon            326..398
                     /gene="INPP4B"
                     /inference="alignment:Splign:2.1.0"
     exon            399..546
                     /gene="INPP4B"
                     /inference="alignment:Splign:2.1.0"
     exon            547..677
                     /gene="INPP4B"
                     /inference="alignment:Splign:2.1.0"
     exon            678..782
                     /gene="INPP4B"
                     /inference="alignment:Splign:2.1.0"
     exon            783..891
                     /gene="INPP4B"
                     /inference="alignment:Splign:2.1.0"
     exon            892..1069
                     /gene="INPP4B"
                     /inference="alignment:Splign:2.1.0"
     exon            1070..1273
                     /gene="INPP4B"
                     /inference="alignment:Splign:2.1.0"
     exon            1274..1430
                     /gene="INPP4B"
                     /inference="alignment:Splign:2.1.0"
     exon            1431..1603
                     /gene="INPP4B"
                     /inference="alignment:Splign:2.1.0"
     exon            1604..1727
                     /gene="INPP4B"
                     /inference="alignment:Splign:2.1.0"
     exon            1728..1845
                     /gene="INPP4B"
                     /inference="alignment:Splign:2.1.0"
     exon            1846..1986
                     /gene="INPP4B"
                     /inference="alignment:Splign:2.1.0"
     exon            1987..2084
                     /gene="INPP4B"
                     /inference="alignment:Splign:2.1.0"
     exon            2085..2197
                     /gene="INPP4B"
                     /inference="alignment:Splign:2.1.0"
     exon            2198..2352
                     /gene="INPP4B"
                     /inference="alignment:Splign:2.1.0"
     exon            2353..3699
                     /gene="INPP4B"
                     /inference="alignment:Splign:2.1.0"
     regulatory      3681..3686
                     /regulatory_class="polyA_signal_sequence"
                     /gene="INPP4B"
                     /note="hexamer: AATAAA"
     polyA_site      3699
                     /gene="INPP4B"
                     /note="major polyA site"
ORIGIN      
atatgcagagaaaattatagttagtgaaacaactctgggtgctgtattttacctcttgttattttctagcctgttggtctcttttcttttagggaaaatgatacattttcaccctttaatcctaccccatgagcgaagtttcttgggctatgccagttttaaagtgggagagctgctgaagtcaaaggagcaattgctggtcctgagcctgagaacttcagatggtggcaaagtggttggcaccatagaagtcagtgtcgtgaagatgggggagattgaggatggggaagccgaccacatcaccacagatgtacagggacaaaagtgtgccctggtatgtgaatgtacagccccggaaagtgtgagcggaaaagataacttaccttttttgaattcagtgttaaagaacccagtatgtaaattatatagatttcccacatctgacaataagtggatgcgaattcgagagcagatgtcagagagcattctttcctttcatattcctaaggaattgatttcccttcacattaaagaagatttgtgcagaaaccaggagataaaagaacttggtgagctttctccacattgggacaatctgcgaaaaaatgtccttactcactgtgatcaaatggtgaatatgtaccaagacattctgacagaacttagcaaggaaacagggtcctctttcaaatcaagcagcagcaaaggagagaaaacattagaatttgttccaataaatctacatctgcaaagaatgcaggtacacagccctcacttgaaagatgctctctacgatgtcatcactgtgggagccccagctgcccattttcagggatttaagaatggtggtcttcggaagctactccatagatttgaaacagaaagaagaaataccggataccagtttatttactattcacctgaaaacacagccaaagcaaaggaagttctcagcaacatcaatcaactacaacctcttatagcaacccatgcagacctactgcttaattctgcaagccagcattctccagacagcttgaagaattctttaaagatgctttcagaaaaaacagagctttttgtacatgccttcaaggatcaacttgtcaggagtgctcttttagcactctacactgcaaggccaggaggcattcttaagaagccaccctctcctaagagcagcacagaggagagcagtccccaagaccaacccccagtgatgagagggcaggactccataccacatcattcagactatgatgaggaagagtgggacagggtgtgggccaatgtggggaagagcctgaactgcattattgctatggtggacaaactgattgaaagagatggtggcagtgaaggcagtggcggcaacaatgatggagaaaaggaaccttcattaacagatgccattccctctcacccaagagaggactggtatgaacagttgtatcccctcatccttaccctgaaggactgcatgggagaagtggtgaaccgagccaagcagtccctgacatttgtgctccttcaggaacttgcgtacagcttgccccagtgtctgatgctgacgctaagaagagacatcgtcttcagccaagcacttgctggattggtttgtggttttatcatcaaattacagacaagtctgtatgacccaggcttcctacagcagcttcacacagtggggttgatagtacaatatgaaggactgctaagtacatacagcgatgaaattggaatgctagaggacatggccgttggcatttccgatttaaagaaagttgcatttaaaataattgaagccaaatccaatgatgtgttgccagttataacaggaagacgagaacattacgtggtagaggtcaagcttccagccagaatgtttgagtcactacctctacagattaaagaaggacagttgcttcatgtgtatccagtactttttaatgttggaatcaatgaacagcaaactctggctgaaaggtttggagatgtctctttgcaagaaagtattaatcaggaaaacttcgaacttctacaagaatattacaagatatttatggaaaagatgcctcctgattatatttcacattttcaggaacaaaatgatttaaaagcattgctagaaaatctccttcaaaatatccaatccaaaaaaagaaagaatgtagaaattatgtggctggctgcaacgatttgccgcaaactgaatggtattcgtttcacctgttgtaaaagtgccaaagacaggacatcgatgtcagtgacacttgaacaatgctcaatcttgagagatgagcaccagttacacaaggacttctttatccgagcgctggattgcatgagaagcagacaaacccagggagcactgaatgaatccgatgatcctgaaacaggctgtctaactgataacaagccaacttctcgacacttctatcctgtcgccttgctgcttgtcagctcacacctgctagttgtgtggcttattttaagtctggcgttactcttagccaaataccaataagttttatgttgtattcctttttcttttctacaaatgacaatgaactttaaattatggggacaatgctgtaatatttttacattttcaaattcacagaatttaaaaaatgttaaattgtgtttagtttgtttttcctaaaatctaaaaaacaaaaagtactatgcattaggtggattattttgctcttttgttcatggaaaggtgtttcccactgttaactagctcaagaagaatttttaaattactgtctttggaataagacaaagaacagaatcctgaaagcttgaagttctgaacctcctgtcctcatcccactaaatttattaaagaaattaagactgaaatttgcacaaacactgaaaccctgagacaagttctagagatgtgggaggttgcagactttatttccactgtgctaatatcatagatgccatctgctgatagaaattttttttaacctgttttacttctttgctgcaattaactcttttctgtcaagtaactttatggagagaatggctatttatgttttgtaattaaattacctgtttgtatctcttgtttgggttgatttggctttcagaggacttttctattctttttaacaaggtcttgtttgtgtcttgatgtaccattcccagcacttgtgacttttgtactgtccgtggacaagcactcttcctttataaagctgagacttggcccaggctgttcagaaagccattttctctcttccttgcacagctaaaataataaaatagagatgaaatttttctttaaaaatctatagggccagacttaataaattaaatgccttatttctagaacctgcatccttagggctacatatagattttaatgtgttttaaagagactgagaaattaatttgtggaaatgttataaaaaggcagatatatttatgaaactaaagtggagctgtattgtggagcaaattatatttaaagagtttattaaattttaaatgttaagagtaaagagacttaagtcatctctttcagagggcaataatggtattgggcctggcctaggatttaattttgtaagatgtatcatcacttgtggaaaaaaaaaatgtagagttgaatctttgttatttttacttggatggttgctgcaactctgcattaaacaaataaagcatatttattta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]