GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:10:45, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NM_001364781            2069 bp    mRNA    linear   PRI 07-JUL-2018
DEFINITION  Homo sapiens bridging integrator 2 (BIN2), transcript variant 7,
            mRNA.
ACCESSION   NM_001364781
VERSION     NM_001364781.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2069)
  AUTHORS   Sanchez-Barrena MJ, Vallis Y, Clatworthy MR, Doherty GJ, Veprintsev
            DB, Evans PR and McMahon HT.
  TITLE     Bin2 is a membrane sculpting N-BAR protein that influences
            leucocyte podosomes, motility and phagocytosis
  JOURNAL   PLoS ONE 7 (12), e52401 (2012)
   PUBMED   23285027
  REMARK    GeneRIF: Bin2 is a membrane-sculpting protein that influences
            podosome formation, motility and phagocytosis in leucocytes.
            Erratum:[PLoS One. 2013;8(8).
            doi:10.1371/annotation/3bdc487b-5e25-4cd7-a354-b2952eec943d]
REFERENCE   2  (bases 1 to 2069)
  AUTHORS   Walter S, Atzmon G, Demerath EW, Garcia ME, Kaplan RC, Kumari M,
            Lunetta KL, Milaneschi Y, Tanaka T, Tranah GJ, Volker U, Yu L,
            Arnold A, Benjamin EJ, Biffar R, Buchman AS, Boerwinkle E, Couper
            D, De Jager PL, Evans DA, Harris TB, Hoffmann W, Hofman A, Karasik
            D, Kiel DP, Kocher T, Kuningas M, Launer LJ, Lohman KK, Lutsey PL,
            Mackenbach J, Marciante K, Psaty BM, Reiman EM, Rotter JI, Seshadri
            S, Shardell MD, Smith AV, van Duijn C, Walston J, Zillikens MC,
            Bandinelli S, Baumeister SE, Bennett DA, Ferrucci L, Gudnason V,
            Kivimaki M, Liu Y, Murabito JM, Newman AB, Tiemeier H and
            Franceschini N.
  TITLE     A genome-wide association study of aging
  JOURNAL   Neurobiol. Aging 32 (11), 2109 (2011)
   PUBMED   21782286
REFERENCE   3  (bases 1 to 2069)
  AUTHORS   Scherer SE, Muzny DM, Buhay CJ, Chen R, Cree A, Ding Y, Dugan-Rocha
            S, Gill R, Gunaratne P, Harris RA, Hawes AC, Hernandez J, Hodgson
            AV, Hume J, Jackson A, Khan ZM, Kovar-Smith C, Lewis LR, Lozado RJ,
            Metzker ML, Milosavljevic A, Miner GR, Montgomery KT, Morgan MB,
            Nazareth LV, Scott G, Sodergren E, Song XZ, Steffen D, Lovering RC,
            Wheeler DA, Worley KC, Yuan Y, Zhang Z, Adams CQ, Ansari-Lari MA,
            Ayele M, Brown MJ, Chen G, Chen Z, Clerc-Blankenburg KP, Davis C,
            Delgado O, Dinh HH, Draper H, Gonzalez-Garay ML, Havlak P, Jackson
            LR, Jacob LS, Kelly SH, Li L, Li Z, Liu J, Liu W, Lu J, Maheshwari
            M, Nguyen BV, Okwuonu GO, Pasternak S, Perez LM, Plopper FJ,
            Santibanez J, Shen H, Tabor PE, Verduzco D, Waldron L, Wang Q,
            Williams GA, Zhang J, Zhou J, Allen CC, Amin AG, Anyalebechi V,
            Bailey M, Barbaria JA, Bimage KE, Bryant NP, Burch PE, Burkett CE,
            Burrell KL, Calderon E, Cardenas V, Carter K, Casias K, Cavazos I,
            Cavazos SR, Ceasar H, Chacko J, Chan SN, Chavez D, Christopoulos C,
            Chu J, Cockrell R, Cox CD, Dang M, Dathorne SR, David R, Davis CM,
            Davy-Carroll L, Deshazo DR, Donlin JE, D'Souza L, Eaves KA, Egan A,
            Emery-Cohen AJ, Escotto M, Flagg N, Forbes LD, Gabisi AM, Garza M,
            Hamilton C, Henderson N, Hernandez O, Hines S, Hogues ME, Huang M,
            Idlebird DG, Johnson R, Jolivet A, Jones S, Kagan R, King LM, Leal
            B, Lebow H, Lee S, LeVan JM, Lewis LC, London P, Lorensuhewa LM,
            Loulseged H, Lovett DA, Lucier A, Lucier RL, Ma J, Madu RC, Mapua
            P, Martindale AD, Martinez E, Massey E, Mawhiney S, Meador MG,
            Mendez S, Mercado C, Mercado IC, Merritt CE, Miner ZL, Minja E,
            Mitchell T, Mohabbat F, Mohabbat K, Montgomery B, Moore N, Morris
            S, Munidasa M, Ngo RN, Nguyen NB, Nickerson E, Nwaokelemeh OO,
            Nwokenkwo S, Obregon M, Oguh M, Oragunye N, Oviedo RJ, Parish BJ,
            Parker DN, Parrish J, Parks KL, Paul HA, Payton BA, Perez A, Perrin
            W, Pickens A, Primus EL, Pu LL, Puazo M, Quiles MM, Quiroz JB,
            Rabata D, Reeves K, Ruiz SJ, Shao H, Sisson I, Sonaike T, Sorelle
            RP, Sutton AE, Svatek AF, Svetz LA, Tamerisa KS, Taylor TR, Teague
            B, Thomas N, Thorn RD, Trejos ZY, Trevino BK, Ukegbu ON, Urban JB,
            Vasquez LI, Vera VA, Villasana DM, Wang L, Ward-Moore S, Warren JT,
            Wei X, White F, Williamson AL, Wleczyk R, Wooden HS, Wooden SH, Yen
            J, Yoon L, Yoon V, Zorrilla SE, Nelson D, Kucherlapati R, Weinstock
            G and Gibbs RA.
  CONSRTM   Baylor College of Medicine Human Genome Sequencing Center Sequence
            Production Team
  TITLE     The finished DNA sequence of human chromosome 12
  JOURNAL   Nature 440 (7082), 346-351 (2006)
   PUBMED   16541075
REFERENCE   4  (bases 1 to 2069)
  AUTHORS   Ge K and Prendergast GC.
  TITLE     Bin2, a functionally nonredundant member of the BAR adaptor gene
            family
  JOURNAL   Genomics 67 (2), 210-220 (2000)
   PUBMED   10903846
  REMARK    GeneRIF: Bin2 is a BAR domain adapter protein structurally related
            but functionally distinct from family members Bin1 and amphiphysin.
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC046135.15.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR1803617.40784.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMEA1965299, SAMEA1966682
                                           [ECO:0000350]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-153               AC046135.15        80072-80224         c
            154-234             AC046135.15        69873-69953         c
            235-289             AC046135.15        59137-59191         c
            290-384             AC046135.15        58736-58830         c
            385-480             AC046135.15        58070-58165         c
            481-588             AC046135.15        55657-55764         c
            589-674             AC046135.15        55253-55338         c
            675-1425            AC046135.15        47641-48391         c
            1426-1506           AC046135.15        44158-44238         c
            1507-1578           AC046135.15        40766-40837         c
            1579-2069           AC046135.15        37088-37578         c
FEATURES             Location/Qualifiers
     source          1..2069
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="12"
                     /map="12q13.13"
     gene            1..2069
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /note="bridging integrator 2"
                     /db_xref="GeneID:51411"
                     /db_xref="HGNC:HGNC:1053"
                     /db_xref="MIM:605936"
     exon            1..153
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /inference="alignment:Splign:2.1.0"
     variation       9
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1404977264"
     variation       11
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1328927751"
     variation       11
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1304614361"
     variation       12
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1271208459"
     variation       17
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1226905723"
     variation       22
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1209832469"
     variation       23
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:767228569"
     variation       26
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360301315"
     variation       28
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1418375239"
     variation       32
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201377937"
     variation       36
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751935830"
     variation       37
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:962490527"
     variation       38
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774786312"
     variation       44
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:555513164"
     variation       45
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775900063"
     variation       46
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1164870359"
     variation       48
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757935160"
     variation       49
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1404441233"
     variation       51
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759592373"
     variation       53
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776846147"
     variation       54
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771279097"
     variation       55
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1212962648"
     variation       59
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:745872885"
     variation       60
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1297522783"
     variation       63
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298500934"
     variation       65
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:535835356"
     variation       69
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1212312552"
     variation       71..76
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="g"
                     /replace="ggatgg"
                     /db_xref="dbSNP:1565695828"
     variation       71
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774307681"
     variation       72
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768291835"
     CDS             73..1608
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /note="isoform 7 is encoded by transcript variant 7;
                     breast cancer associated protein BRAP1; breast
                     cancer-associated protein 1"
                     /codon_start=1
                     /product="bridging integrator 2 isoform 7"
                     /protein_id="NP_001351710.1"
                     /db_xref="GeneID:51411"
                     /db_xref="HGNC:HGNC:1053"
                     /db_xref="MIM:605936"
                     /translation="
MAEGKAGGAAGLFAKQVQKKFSRAQEKVLQKLGKAVETKDERFEQSASNFYQQQAEGHKLYKDLKNFLSAVKVMHESSKRVSETLQEIYSSEWDGHEELKAIVWNNDLLWEDYEEKLADQAVRTMEIYVAQFSEIKERIAKRGRKLVDYDSARHHLEAVQNAKKKDEAKTAKAEEEFNKAQTVFEDLNQELLEELPILYNSSRRSLVISPPVRTATVSSPLTSPTSPSTLSLKSESESVSATEDLAPDAAQGEDNSEIKELLEEEEIEKEGSEASSSEEDEPLPACNGPAQAQPSPTTERAKSQEEVLPSSTTPSPGGALSPSGQPSSSATEVVLRTRTASEGSEQPKKRASIQRTSAPPSRPPPPRATASPRPSSGNIPSSPTASGGGSPTSPRASLGTGTASPRTSLEVSPNPEPPEKPVRTPEAKENENIHNQNPEELCTSPTLMTSQVASEPGEAKKMEDKEKDNKLISANSSEGQDQLQVSMVPENNNLTAPEPQEEVSTSENPQL"
     misc_feature    160..675
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /note="The Bin/Amphiphysin/Rvs (BAR) domain, a
                     dimerization module that binds membranes and detects
                     membrane curvature; Region: BAR; cl12013"
                     /db_xref="CDD:325158"
     misc_feature    649..>1359
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /note="Herpesvirus ICP4-like protein C-terminal region;
                     Region: Herpes_ICP4_C; cl28033"
                     /db_xref="CDD:332854"
     variation       76
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1248791086"
     variation       77
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1565695821"
     variation       81
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749090623"
     variation       82
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779915952"
     variation       87
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756078092"
     variation       88
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1326599760"
     variation       89
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745377859"
     variation       95
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780623962"
     variation       96
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1162419242"
     variation       97
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756925855"
     variation       99
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751175113"
     variation       103
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184050111"
     variation       108
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1466111654"
     variation       111
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:935960459"
     variation       112
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777374690"
     variation       113
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758737740"
     variation       116
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376204352"
     variation       117
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1484189585"
     variation       118
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1275567065"
     variation       120
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371486750"
     variation       121
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1247356518"
     variation       123
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765730538"
     variation       125..132
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="agaag"
                     /replace="agaagaag"
                     /db_xref="dbSNP:774777732"
     variation       125
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1314772643"
     variation       131
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1228885615"
     variation       137
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760020602"
     variation       138
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374696948"
     variation       139
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1370820906"
     variation       142
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766513059"
     variation       143
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1422230637"
     variation       144
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761006815"
     variation       146..150
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="ag"
                     /replace="aggag"
                     /db_xref="dbSNP:1175893181"
     variation       146
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1164861056"
     variation       147
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424960673"
     variation       150
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773620778"
     exon            154..234
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /inference="alignment:Splign:2.1.0"
     variation       165
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367795211"
     variation       166
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762041854"
     variation       169
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1051647162"
     variation       170
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1313633782"
     variation       180
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1185842896"
     variation       184
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1483752927"
     variation       186
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143305160"
     variation       189
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1221838034"
     variation       190
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1376616352"
     variation       197
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:539014719"
     variation       201
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200144030"
     variation       202
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1017332664"
     variation       204
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776601257"
     variation       207
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1007234519"
     variation       209
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770841763"
     variation       210
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746586606"
     variation       211
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:892811401"
     variation       212
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1373616594"
     variation       215
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:7312857"
     variation       217
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:771635732"
     variation       218
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:747783381"
     variation       219
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1176986357"
     variation       222
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:989926935"
     variation       224
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779172778"
     variation       225
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201072153"
     variation       231
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1190582770"
     exon            235..289
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /inference="alignment:Splign:2.1.0"
     variation       237
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756714621"
     variation       239
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:956534423"
     variation       245
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1342771672"
     variation       255
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313949194"
     variation       257
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1216726298"
     variation       258
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781521252"
     variation       264
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757407557"
     variation       268
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1444743464"
     variation       270
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751579536"
     variation       271
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1430504528"
     variation       274
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34119627"
     variation       276
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1365104593"
     variation       279
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764364274"
     variation       281
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147235873"
     variation       282
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1368951923"
     variation       285
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201895934"
     variation       289
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1161982744"
     exon            290..384
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /inference="alignment:Splign:2.1.0"
     variation       292
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:564147412"
     variation       294
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1199706594"
     variation       296
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368812192"
     variation       297
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1379408859"
     variation       298
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1468274446"
     variation       314
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752872701"
     variation       325
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779073492"
     variation       341
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1204995475"
     variation       344
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144102822"
     variation       345
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750169427"
     variation       346
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:555115486"
     variation       347
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299610017"
     variation       354
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7975715"
     variation       355
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1273261212"
     variation       356
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751140007"
     variation       358
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331694675"
     variation       359
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1317710617"
     variation       362
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1221141071"
     variation       369
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763661077"
     variation       374
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762521366"
     variation       376
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199694240"
     variation       378
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1469053591"
     variation       379
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769557937"
     variation       380
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760014450"
     exon            385..480
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /inference="alignment:Splign:2.1.0"
     variation       385
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146410757"
     variation       386
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1007916122"
     variation       388
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764945899"
     variation       389
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759052022"
     variation       390
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1344322448"
     variation       391
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777075653"
     variation       402
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1202385654"
     variation       411
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:79231837"
     variation       412
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542179917"
     variation       414
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1387398340"
     variation       417
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773753332"
     variation       421
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138549357"
     variation       429
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1200952780"
     variation       430
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748291125"
     variation       432
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1305727259"
     variation       433
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1431120612"
     variation       436
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565680777"
     variation       443
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:983431162"
     variation       445
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143984628"
     variation       456
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1162372249"
     variation       457
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768947422"
     variation       460
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:546375480"
     variation       463
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780296457"
     variation       464
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1473306528"
     variation       477
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200637291"
     variation       478
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1030585767"
     exon            481..588
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /inference="alignment:Splign:2.1.0"
     variation       485
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774523510"
     variation       487
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768661735"
     variation       494
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749365314"
     variation       495
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1190720080"
     variation       496
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374011518"
     variation       497
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770052008"
     variation       498
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746806256"
     variation       499
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777651541"
     variation       500
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758431238"
     variation       502
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:969445320"
     variation       503
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1329459156"
     variation       509
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748057174"
     variation       510
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78442656"
     variation       511
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:576769629"
     variation       522
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1293588349"
     variation       523
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:761737319"
     variation       526
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774401820"
     variation       529
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753374931"
     variation       530
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139065319"
     variation       537
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1459121448"
     variation       550
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:577030938"
     variation       553
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1412983865"
     variation       556..580
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="gccaagaagaaagatgaggccaaga"
                     /replace="gccaagaagaaagatgaggccaagaagaaagatgaggccaaga"
                     /db_xref="dbSNP:766068626"
     variation       557
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:192943143"
     variation       560
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175559937"
     variation       564
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150740618"
     variation       567
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201767225"
     variation       569
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767830479"
     variation       571
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762135863"
     variation       573
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1246064780"
     variation       585
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764653272"
     exon            589..674
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /inference="alignment:Splign:2.1.0"
     variation       590
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374148495"
     variation       592
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771264691"
     variation       593
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1157988719"
     variation       595
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1294070066"
     variation       600
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1026318403"
     variation       606
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:994468460"
     variation       616
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868484597"
     variation       617
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761578835"
     variation       618
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1047248142"
     variation       619
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:898735266"
     variation       624
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200686598"
     variation       626
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774127762"
     variation       637
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768489810"
     variation       638
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1437987026"
     variation       640
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142121602"
     variation       642
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779936952"
     variation       645
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1430372293"
     variation       658
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769343422"
     variation       664
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200936405"
     variation       669
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751886413"
     variation       670
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1425268528"
     variation       673
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1347721718"
     exon            675..1425
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /inference="alignment:Splign:2.1.0"
     variation       677
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:575023408"
     variation       682
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774206846"
     variation       683
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1167510580"
     variation       684
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147192751"
     variation       687
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1411444457"
     variation       688
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1180141659"
     variation       696
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481618781"
     variation       697
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1195355631"
     variation       700..704
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="cccc"
                     /replace="ccccc"
                     /replace="cccccc"
                     /db_xref="dbSNP:1220834082"
     variation       700
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1291691495"
     variation       701
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1244501309"
     variation       704
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1057181400"
     variation       706
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:558389492"
     variation       709
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763415924"
     variation       710
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775660611"
     variation       712
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233627634"
     variation       714
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1285204023"
     variation       720
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375226066"
     variation       725
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746325188"
     variation       730
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1224982795"
     variation       737
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370582865"
     variation       742
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1292428796"
     variation       745
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1436442266"
     variation       748
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373203887"
     variation       751..753
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1462253123"
     variation       751
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143690157"
     variation       753
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1048856763"
     variation       756
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1411510811"
     variation       759
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:566351876"
     variation       761
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758545409"
     variation       763
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1166851806"
     variation       765
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753679636"
     variation       767
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1408860776"
     variation       776
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:566850655"
     variation       777
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756105970"
     variation       778
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767550269"
     variation       780
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1393197417"
     variation       782
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1214100921"
     variation       783
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756896405"
     variation       786
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1436299223"
     variation       787
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1265993944"
     variation       791
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751047795"
     variation       799
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763853539"
     variation       802
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200548641"
     variation       811
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:762467824"
     variation       821
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775958753"
     variation       822
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765564221"
     variation       824
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759926415"
     variation       825
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777060250"
     variation       836
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388437044"
     variation       839
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138195736"
     variation       840
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:376415172"
     variation       846
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747092682"
     variation       850
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:868179494"
     variation       852
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175495961"
     variation       855
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1412765328"
     variation       856
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1322954004"
     variation       858
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773215106"
     variation       862..869
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="gagga"
                     /replace="gaggagga"
                     /db_xref="dbSNP:774544875"
     variation       864
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772303406"
     variation       865
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748279114"
     variation       867
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147443200"
     variation       876
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188021440"
     variation       885
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142976170"
     variation       886
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1445261575"
     variation       888..891
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="tgaa"
                     /replace="tgaatgaa"
                     /db_xref="dbSNP:1207415945"
     variation       889
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374417427"
     variation       897
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:965504112"
     variation       897
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1368948539"
     variation       898
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:138741584"
     variation       907
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1280400131"
     variation       908
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1235724751"
     variation       909
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1365077413"
     variation       919
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147701707"
     variation       922
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757204229"
     variation       931
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457435920"
     variation       932
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:550831260"
     variation       933
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1302424067"
     variation       934
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112923160"
     variation       935
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1433079941"
     variation       936
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763661034"
     variation       937
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1056511629"
     variation       938
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188987098"
     variation       939
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376353509"
     variation       940
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150210505"
     variation       941
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:897361854"
     variation       943
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1172310328"
     variation       944
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1028688747"
     variation       946
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759882503"
     variation       947
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776910520"
     variation       950
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766881298"
     variation       953
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1486444423"
     variation       956
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1230439328"
     variation       958
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369691754"
     variation       961
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141002466"
     variation       964
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772176957"
     variation       967
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748235442"
     variation       969
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3210837"
     variation       971
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768859102"
     variation       972
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745663605"
     variation       974
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781086442"
     variation       985
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1473036951"
     variation       988
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1268340780"
     variation       991
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:895685933"
     variation       999
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357580607"
     variation       1009
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757294613"
     variation       1012
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746987882"
     variation       1013
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376067729"
     variation       1014
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:910111500"
     variation       1015
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1394254714"
     variation       1016
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1001650363"
     variation       1017
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777833539"
     variation       1018
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201696311"
     variation       1022
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752244584"
     variation       1023
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61749591"
     variation       1024
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375136926"
     variation       1026
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1475998115"
     variation       1027
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:921684243"
     variation       1028
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:975836597"
     variation       1032
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754220615"
     variation       1046
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:965763447"
     variation       1048..1049
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:771099064"
     variation       1051
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766689090"
     variation       1053
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:931262941"
     variation       1055
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760996900"
     variation       1057
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:750975779"
     variation       1060
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1312405207"
     variation       1063
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1231788909"
     variation       1064
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1337264094"
     variation       1068
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1294062181"
     variation       1071
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768053983"
     variation       1074
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1411696554"
     variation       1076
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1334115172"
     variation       1078
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761805381"
     variation       1079
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774433785"
     variation       1081
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140686836"
     variation       1082
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763228949"
     variation       1084
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200496180"
     variation       1085
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146877980"
     variation       1086
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145178409"
     variation       1087
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777927634"
     variation       1088
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1365076828"
     variation       1089
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201888825"
     variation       1090
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:563615819"
     variation       1093
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:117691477"
     variation       1094
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779658740"
     variation       1100
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1280868924"
     variation       1107
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1200073815"
     variation       1108
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:756527960"
     variation       1109
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1274179445"
     variation       1114..1120
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="aaga"
                     /replace="aagaaga"
                     /db_xref="dbSNP:1565672785"
     variation       1119
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:113931281"
     variation       1121
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762334085"
     variation       1122
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199949833"
     variation       1126
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764277315"
     variation       1129
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1239815659"
     variation       1131
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1330457624"
     variation       1133
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1301092263"
     variation       1138
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:375546781"
     variation       1139
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1371544075"
     variation       1143
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775916802"
     variation       1149
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1398646076"
     variation       1150
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770140303"
     variation       1151
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760548195"
     variation       1153
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1465047798"
     variation       1154
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772997997"
     variation       1156
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:771923660"
     variation       1161
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1455963031"
     variation       1162
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1254062535"
     variation       1163
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301773905"
     variation       1172
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1192891311"
     variation       1175
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1372935702"
     variation       1180
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200063227"
     variation       1184
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1302589931"
     variation       1190
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768854611"
     variation       1192
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778683696"
     variation       1193
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1205807137"
     variation       1194
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768260291"
     variation       1197
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372183941"
     variation       1205
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779748495"
     variation       1215
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1035017374"
     variation       1218
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755705883"
     variation       1224
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1001746149"
     variation       1226
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746253339"
     variation       1227
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1428334487"
     variation       1231
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1254450168"
     variation       1238
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:897231450"
     variation       1241
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149679620"
     variation       1243
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1193335235"
     variation       1246
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757532141"
     variation       1247
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752160766"
     variation       1252
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866004628"
     variation       1262
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1373161685"
     variation       1263
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1005694721"
     variation       1264
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200757590"
     variation       1265
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758622403"
     variation       1267
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752760966"
     variation       1285
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370739175"
     variation       1292
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:759778513"
     variation       1293
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772909352"
     variation       1300
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765439771"
     variation       1303
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:897200494"
     variation       1304
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:139520851"
     variation       1306
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1485451728"
     variation       1307
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1255560567"
     variation       1309
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1216225639"
     variation       1323
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1213055111"
     variation       1324
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:944302833"
     variation       1329
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761488785"
     variation       1334
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774405060"
     variation       1336
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1306446570"
     variation       1337
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1565672396"
     variation       1338
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1049973935"
     variation       1343
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1270483707"
     variation       1350
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1341279531"
     variation       1353
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1209729329"
     variation       1358
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:891346299"
     variation       1359
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1213536115"
     variation       1362
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768576504"
     variation       1368
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1270547933"
     variation       1369
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:932886675"
     variation       1370
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748810468"
     variation       1371
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147599215"
     variation       1372
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769469897"
     variation       1378
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1414798001"
     variation       1379
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745576102"
     variation       1384
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1328848403"
     variation       1395
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757700360"
     variation       1397
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747334966"
     variation       1403
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145231160"
     variation       1409
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1461114957"
     variation       1410
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:923671734"
     variation       1419
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1475017819"
     variation       1423
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1345591735"
     variation       1425
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758913364"
     exon            1426..1506
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /inference="alignment:Splign:2.1.0"
     variation       1431
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:554520026"
     variation       1441
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1475653327"
     variation       1442
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1407401969"
     variation       1445
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175531822"
     variation       1446
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776413679"
     variation       1452
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:929263777"
     variation       1455
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770427641"
     variation       1456
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1212853840"
     variation       1459
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139691872"
     variation       1467
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1274809596"
     variation       1473
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371004701"
     variation       1481
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213974652"
     variation       1488
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774299371"
     variation       1490
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868622680"
     variation       1495
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:7954976"
     variation       1497
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1415148210"
     variation       1498
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748702925"
     variation       1502
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376176341"
     variation       1503
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779538427"
     variation       1504
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755141563"
     variation       1505
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:902232118"
     variation       1506
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1400874684"
     exon            1507..1578
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /inference="alignment:Splign:2.1.0"
     variation       1510
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1238912017"
     variation       1514
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:779958734"
     variation       1522
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:964758067"
     variation       1525
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756187749"
     variation       1527
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1347194806"
     variation       1531
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750694548"
     variation       1532
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198993028"
     variation       1537
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1259379106"
     variation       1543..1551
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="aacaac"
                     /replace="aacaacaac"
                     /db_xref="dbSNP:1485257013"
     variation       1543
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781380098"
     variation       1545
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1485970579"
     variation       1547
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758258873"
     variation       1549
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:752425161"
     variation       1550
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1279878256"
     variation       1551
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1484994943"
     variation       1552
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1283005011"
     variation       1555
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:765176485"
     variation       1558
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:996930387"
     variation       1559
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1234435628"
     variation       1563
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141365457"
     variation       1565
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:552960490"
     variation       1567
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:765843050"
     variation       1573
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1341312649"
     variation       1575
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199543314"
     variation       1576
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:866046394"
     exon            1579..2069
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /inference="alignment:Splign:2.1.0"
     variation       1581..1602
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="atccacaagtgaaaatccacaa"
                     /replace="atccacaagtgaaaatccacaagtgaaaatccacaa"
                     /db_xref="dbSNP:747890695"
     variation       1583
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1272937553"
     variation       1585
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774116771"
     variation       1586
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:963568018"
     variation       1589
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1337190371"
     variation       1591
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868092809"
     variation       1596
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764416524"
     variation       1599
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1238368049"
     variation       1602
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1565665900"
     variation       1605
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978200633"
     variation       1608
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:548790714"
     variation       1612
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308986214"
     variation       1620
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200333904"
     variation       1625
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775930385"
     variation       1627
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:569628124"
     variation       1629
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1323621125"
     variation       1630
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1462711892"
     variation       1631
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1390956915"
     variation       1633
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1398668835"
     variation       1638
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745964323"
     variation       1644
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776646493"
     variation       1645
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138883094"
     variation       1647
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1288014732"
     variation       1653
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1161052309"
     variation       1654
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1440811991"
     variation       1660
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764182625"
     variation       1663
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1192085835"
     variation       1665
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747268370"
     variation       1669
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1268236915"
     variation       1670
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1204644059"
     variation       1672
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1348701181"
     variation       1675
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1262563991"
     variation       1676
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778030327"
     variation       1677
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:532801981"
     variation       1680
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1301020027"
     variation       1682
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749102853"
     variation       1683
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3759175"
     variation       1684
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:990781805"
     variation       1686
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756057224"
     variation       1687
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371291002"
     variation       1689
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1450533235"
     variation       1690..1693
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="ag"
                     /replace="agag"
                     /db_xref="dbSNP:774197089"
     variation       1690
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489259499"
     variation       1691
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:540928172"
     variation       1693
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1191380970"
     variation       1711
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756806411"
     variation       1712
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:751229471"
     variation       1719
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1475241854"
     variation       1746
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1466039429"
     variation       1755
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:527576206"
     variation       1761
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1160348541"
     variation       1762
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:878957381"
     variation       1766
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1362808052"
     variation       1777
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:997917609"
     variation       1778
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298104717"
     variation       1791
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:955887543"
     variation       1800
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1031481410"
     variation       1802
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:561589573"
     variation       1816
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1450305884"
     variation       1819
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:577136287"
     variation       1823
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1282464462"
     variation       1828
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1378751938"
     variation       1829
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1224523292"
     variation       1854
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:541610919"
     variation       1858
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:576511701"
     variation       1860
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:886637046"
     variation       1870
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1000134515"
     variation       1874
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1292089366"
     variation       1876..1882
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="taa"
                     /replace="taactaa"
                     /db_xref="dbSNP:1226633090"
     variation       1880
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1285239441"
     variation       1884
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1211647961"
     variation       1892
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1026411722"
     variation       1901
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1472283979"
     variation       1902
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:556407389"
     variation       1911
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:546244708"
     variation       1920
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1382611133"
     variation       1930
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146052824"
     variation       1937
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1158351856"
     variation       1940
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143620270"
     variation       1946
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1416610618"
     variation       1951
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1332332630"
     variation       1951
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1358619095"
     variation       1955..1963
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="cacacac"
                     /replace="cacacacac"
                     /db_xref="dbSNP:1565665510"
     variation       1964
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1437743361"
     variation       1979
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:895799391"
     variation       1982
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1443291999"
     variation       1983..1989
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="tct"
                     /replace="tctgtct"
                     /db_xref="dbSNP:1412317062"
     variation       1986
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1311723239"
     variation       1994
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1374878556"
     variation       1998
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1040694358"
     variation       1999
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308195209"
     variation       2013
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753917582"
     variation       2023
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1456358071"
     variation       2024
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:929378389"
     variation       2025
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1044981"
     variation       2032
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1456145298"
     variation       2034
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1178436995"
     variation       2035..2038
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="tttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:1378555724"
     variation       2037
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1166332314"
     variation       2053
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:889447963"
     variation       2054
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1053732952"
     variation       2061..2062
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1412991454"
     variation       2065
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1419520297"
     variation       2069
                     /gene="BIN2"
                     /gene_synonym="BRAP-1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1410618875"
ORIGIN      
acttcctcctcgggggcctcagaaaaccacagggcgcggggccagggcggcggcccccagggagttggcaggatggcagagggcaaggcaggcggcgcggccggcctcttcgccaagcaggtgcagaagaagtttagcagggcccaggagaaggtgctgcagaaattggggaaagctgtagaaaccaaagatgaacgatttgaacaaagcgctagcaacttctaccaacaacaggcagaaggccacaagctgtacaaggacctgaagaacttccttagtgcagtcaaagtgatgcatgaaagttcaaaaagagtgtcagaaaccctgcaggagatctacagcagcgagtgggacggtcatgaggagctgaaggccatcgtatggaataatgatctcctttgggaagactacgaggagaaactggctgaccaggctgtaaggaccatggaaatctatgttgcccagttcagtgaaattaaggagagaattgccaagcggggtcggaaactcgtggactatgacagtgcccgacaccacctggaggcagtgcagaatgccaagaagaaagatgaggccaagactgccaaggcagaggaagagttcaacaaagcccagactgtgtttgaagatctgaaccaagaactactagaggagctgcctattctttataatagcagcaggcgctctttagtcatttctcccccagttcgaacagctacagtctccagtcctcttacctcacctactagtccctctacactttccttgaagagtgagagtgaatctgtctcagcaactgaagatctggcacctgatgcagcccaaggggaagacaattctgagatcaaggagctcttagaagaggaggaaatagagaaggaaggatctgaagcaagctcctctgaggaagatgagcctctaccagcctgcaatggccccgcccaggcccagccctctcctaccactgaaagggccaagtcccaggaggaagttctccccagctccacaactccatcaccaggcggagccctgagcccttcagggcagccttcatcatctgccacagaagtagtcctccgaacccgcaccgcaagtgaaggatctgaacaaccaaagaagagagcctctatccagaggacctcagcaccccctagtaggcctcctccacccagagccactgcaagccccaggccctcctcagggaacataccttccagccctacagcctctggagggggttcacccaccagccctagggcctccttggggactgggactgcaagtcctaggacctccctagaggtctctcctaatccagaaccaccagagaagccagtaagaactcctgaggccaaagaaaatgaaaacatccacaatcagaaccctgaagaactttgtacttcccccaccttaatgacatctcaggttgcttcagagcctggagaggcaaagaagatggaagacaaggaaaaggataataagcttatctcagctaactcctcggagggccaagaccagcttcaagtctccatggtaccagaaaacaacaacctcacagcacctgaacctcaagaagaggtatccacaagtgaaaatccacaactctgaagagaaactaccaagactcctcctgccccaaacctcgccagagaagctcttcaaccagagggtataggtcagagggatataagagccagcatccatccctgggttctcagtaggaatgctggtgctgtctaaagacctggcattaatggaggcggaggagcagccttacgggagggatggagggaggcaggctggggagaagagaacattagactcagggaatatttaattctggttttagcattattagaataagactttatacattaactaaagtggagctttaatcactataaaaagcaaaagtatctatagacacagacacttgcctatacagagacataaccacacacactcagaggatagtgaacaaatctgtctttgacttacgacccattttgcaagacttaaagccggaagaacacattttcagattgttaaataaagtctgattctgacta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]