GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-07 23:23:32, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NM_001353767            3815 bp    mRNA    linear   PRI 02-JUL-2018
DEFINITION  Homo sapiens coiled-coil domain containing 191 (CCDC191),
            transcript variant 4, mRNA.
ACCESSION   NM_001353767 XM_017006956
VERSION     NM_001353767.2
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3815)
  AUTHORS   Strausberg RL, Feingold EA, Grouse LH, Derge JG, Klausner RD,
            Collins FS, Wagner L, Shenmen CM, Schuler GD, Altschul SF, Zeeberg
            B, Buetow KH, Schaefer CF, Bhat NK, Hopkins RF, Jordan H, Moore T,
            Max SI, Wang J, Hsieh F, Diatchenko L, Marusina K, Farmer AA, Rubin
            GM, Hong L, Stapleton M, Soares MB, Bonaldo MF, Casavant TL,
            Scheetz TE, Brownstein MJ, Usdin TB, Toshiyuki S, Carninci P,
            Prange C, Raha SS, Loquellano NA, Peters GJ, Abramson RD, Mullahy
            SJ, Bosak SA, McEwan PJ, McKernan KJ, Malek JA, Gunaratne PH,
            Richards S, Worley KC, Hale S, Garcia AM, Gay LJ, Hulyk SW,
            Villalon DK, Muzny DM, Sodergren EJ, Lu X, Gibbs RA, Fahey J,
            Helton E, Ketteman M, Madan A, Rodrigues S, Sanchez A, Whiting M,
            Madan A, Young AC, Shevchenko Y, Bouffard GG, Blakesley RW,
            Touchman JW, Green ED, Dickson MC, Rodriguez AC, Grimwood J,
            Schmutz J, Myers RM, Butterfield YS, Krzywinski MI, Skalska U,
            Smailus DE, Schnerch A, Schein JE, Jones SJ and Marra MA.
  CONSRTM   Mammalian Gene Collection Program Team
  TITLE     Generation and initial analysis of more than 15,000 full-length
            human and mouse cDNA sequences
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 99 (26), 16899-16903 (2002)
   PUBMED   12477932
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC092896.9, AC128687.10 and AF509494.1.
            On or before Jan 13, 2018 this sequence version replaced
            XM_017006956.1, NM_001353767.1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR1803611.163064.1,
                                           SRR1660803.29818.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMEA1965299, SAMEA1966682
                                           [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-237               AC092896.9         51818-52054         c
            238-381             AC092896.9         38144-38287         c
            382-560             AC092896.9         32049-32227         c
            561-784             AC092896.9         30366-30589         c
            785-938             AC092896.9         27067-27220         c
            939-1129            AC092896.9         14119-14309         c
            1130-1379           AC092896.9         6213-6462           c
            1380-1834           AC128687.10        602-1056
            1835-1944           AC128687.10        1818-1927
            1945-2027           AC128687.10        4026-4108
            2028-2129           AC128687.10        4868-4969
            2130-2273           AC128687.10        25771-25914
            2274-2426           AC128687.10        27554-27706
            2427-2572           AC128687.10        28233-28378
            2573-3404           AC128687.10        41205-42036
            3405-3815           AF509494.1         3586-3996
FEATURES             Location/Qualifiers
     source          1..3815
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="3"
                     /map="3q13.31"
     gene            1..3815
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /note="coiled-coil domain containing 191"
                     /db_xref="GeneID:57577"
                     /db_xref="HGNC:HGNC:29272"
     exon            1..237
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:557116872"
     variation       3
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144883187"
     variation       4
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765153829"
     variation       5
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759106396"
     variation       6
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776020295"
     variation       7
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1329961657"
     variation       8
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770407913"
     variation       11
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1166987506"
     variation       17
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1281702536"
     variation       18
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426099985"
     variation       21
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760276967"
     variation       25..26
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1329104757"
     variation       25
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1157893139"
     variation       26
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772876231"
     variation       27
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1461640038"
     variation       28
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:894143988"
     CDS             33..2777
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /note="isoform 3 is encoded by transcript variant 4;
                     coiled-coil domain-containing protein 191"
                     /codon_start=1
                     /product="coiled-coil domain-containing protein 191
                     isoform 3"
                     /protein_id="NP_001340696.2"
                     /db_xref="GeneID:57577"
                     /db_xref="HGNC:HGNC:29272"
                     /translation="
MPAFLAGGGTTIPSVTRRQPGQKGGCCSFGRGSGSNLENAPGASGKVLLKEKDGAESLETVHKEAESQAQELVNDWLDTKLKQELASEEEGDAKNTVSSVTIMPEANGHLKYDKFDDLCGYLEEEEESTTVQKFIDHLLHKNVVDSAMMEDLGRKENQDKKQQKDPRLTMEMRHKQVKENRLRREKELEYQRIEKTLKKSAFLEAQCLVQEEKKRKALEAKKEEEEIQREMVKLRREIIERRRTVKAAWKIEKKRQEENSQNSSEKVMFQSTHILPDEEKMVKERKRKLKEVLIQTFKENQQCQKRYFAAWHKLILDHRIKLGKAGTLSDWKIQLKVLRAWRDYTRFQKLERETQALENDLREENRKQQLATEYNRKQVLRHCFTEWQHWHGAELLKRELALTKEETRKKMDALLQAASLGKLSANGLSGISLPEEATAMVGPPVKNGQETAVPPLWEKPPLGSSGCMLSPPLGRTTTGNLQGSLQNVSLSAPGNKQHKTLGAEPSQQPGSNETLRTTSQKAEPLCLGHFHNRHVFQQQLIEKQKKKLQEQQKTILELKKNLQLAEAQWAAEHALAVTEAQSHLLSKPREEEPRTCQMLVNSPVASPGTEGRSDSRNSLSGLRRKPKQLMTPHPILKAMEERAIQRAECRRILAEKKKKQEEEKLAQLKAQEEERQKREAEEKEAQLERKREEKRLKKMKELEKQKRIKRNQQLEAIAKEHYERVLLRKKGLEPWKRLRMQSKQNIQVAEEHYSLFLQRKYMLTWFQRSQESLARKMAQADQFYSQILLKRVIQSWLQYVIDLQEEVRKFCVHFLQKKIFRAWFNMVREVKIDSQGKHEIAAEHSDRRILWITLRTWKKFVKFMKEERVKEERRQQLRRKVVEILPDFQVPGRYHELYQQSDTWSLSKTSLVNE"
     misc_feature    2025..>2324
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /note="Autophagy protein Apg6; Region: APG6; pfam04111"
                     /db_xref="CDD:309295"
     misc_feature    2199..>2609
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /note="Sfi1 spindle body protein; Region: Sfi1; pfam08457"
                     /db_xref="CDD:312082"
     variation       33
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772618046"
     variation       34
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1026576089"
     variation       36
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748496258"
     variation       37
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779632401"
     variation       39
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201879888"
     variation       40
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769297632"
     variation       43
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262705432"
     variation       45
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1229593249"
     variation       46
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1214969953"
     variation       47
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749743182"
     variation       48
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780024395"
     variation       49
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756165200"
     variation       50
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1345833676"
     variation       51
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:544917530"
     variation       53
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1343687589"
     variation       54
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750660546"
     variation       57
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1406237279"
     variation       58
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781444666"
     variation       70
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758254680"
     variation       71
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752474146"
     variation       74
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764956708"
     variation       76
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1159752804"
     variation       78
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372900926"
     variation       79
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759476252"
     variation       80
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765828818"
     variation       81
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772783475"
     variation       82
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:115516714"
     variation       83
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762329178"
     variation       84
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769099461"
     variation       85..98
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="ggcagcccgggcag"
                     /replace="ggcagcccgggcagcccgggcag"
                     /db_xref="dbSNP:765500678"
     variation       85
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1450101650"
     variation       89
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749778523"
     variation       90
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776038549"
     variation       91
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769803280"
     variation       93..104
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="gggc"
                     /replace="gggcagaagggc"
                     /db_xref="dbSNP:760404191"
     variation       93
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745953938"
     variation       94
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781325143"
     variation       95
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1323561959"
     variation       96
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757485609"
     variation       98
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1311002343"
     variation       100
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:747168517"
     variation       101
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373974678"
     variation       102
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754719768"
     variation       103
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:573863211"
     variation       104
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1403878222"
     variation       105
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1265688065"
     variation       108
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766312164"
     variation       109
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1190457275"
     variation       110
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:755649525"
     variation       111
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1399555023"
     variation       116
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:562045865"
     variation       121
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1176622793"
     variation       122
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767065876"
     variation       123
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375228287"
     variation       126
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774094383"
     variation       127
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:992582673"
     variation       130
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371120616"
     variation       131
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1245538807"
     variation       133
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377278615"
     variation       135
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775928337"
     variation       136
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768569928"
     variation       138
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1256806993"
     variation       143
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770319669"
     variation       144
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308962940"
     variation       145
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746300908"
     variation       149
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776697659"
     variation       150
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770960439"
     variation       151
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1214631969"
     variation       153
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:952206214"
     variation       154
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747254332"
     variation       155
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140131124"
     variation       156
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373191955"
     variation       158
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908020876"
     variation       159
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1296588625"
     variation       161
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1176641773"
     variation       163
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754773558"
     variation       165
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1258758228"
     variation       171
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749109056"
     variation       173
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1164290692"
     variation       174
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:543702207"
     variation       175
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1187867245"
     variation       177
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75378787"
     variation       179
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:750284136"
     variation       183
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146204297"
     variation       184
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756802038"
     variation       186
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763833183"
     variation       189
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1265411744"
     variation       190
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141653520"
     variation       193
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1251560851"
     variation       194
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1159979671"
     variation       195
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753117530"
     variation       196
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765455852"
     variation       198
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1293741748"
     variation       202
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760122720"
     variation       203
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1376116962"
     variation       205
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1259216992"
     variation       208
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777074210"
     variation       211
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1393240733"
     variation       212
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771048587"
     variation       213
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760717876"
     variation       216
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773493799"
     variation       217
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772327186"
     variation       218
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139882718"
     variation       221
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779927586"
     variation       227
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1439123852"
     variation       228
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140813529"
     variation       230
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745846314"
     variation       232
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781240507"
     variation       236
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:188278742"
     exon            238..381
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /inference="alignment:Splign:2.1.0"
     variation       245
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768191743"
     variation       248
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1559931695"
     variation       253
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762440898"
     variation       256..257
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace=""
                     /replace="ac"
                     /db_xref="dbSNP:758343375"
     variation       257
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775178775"
     variation       262
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769447289"
     variation       263
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1338744669"
     variation       265
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1476563890"
     variation       266
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1484016589"
     variation       268
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1184006878"
     variation       271
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745456963"
     variation       273
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200389873"
     variation       274
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771278181"
     variation       276..282
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="aag"
                     /replace="aagcaag"
                     /db_xref="dbSNP:750529614"
     variation       277
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1260768425"
     variation       280
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1205014805"
     variation       281
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1018463979"
     variation       287
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149286123"
     variation       290
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1212611903"
     variation       297
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200394017"
     variation       315
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:758620351"
     variation       319..320
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace=""
                     /replace="ct"
                     /db_xref="dbSNP:765328498"
     variation       320..329
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace=""
                     /replace="tgtgtcaagt"
                     /db_xref="dbSNP:752459882"
     variation       320..324
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="tgt"
                     /replace="tgtgt"
                     /db_xref="dbSNP:762053916"
     variation       320
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1451758952"
     variation       321
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372324891"
     variation       322
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:953021972"
     variation       327
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752812133"
     variation       328
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1354183289"
     variation       328
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779081372"
     variation       332
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1412003904"
     variation       333
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299681031"
     variation       336
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1365321424"
     variation       339
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1232992807"
     variation       340
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:778729374"
     variation       343
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755162939"
     variation       344
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369705876"
     variation       345
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767242473"
     variation       351
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439075666"
     variation       352
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761635114"
     variation       355
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751561342"
     variation       367
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1256970404"
     variation       368
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1231989287"
     variation       373
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202171733"
     exon            382..560
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /inference="alignment:Splign:2.1.0"
     variation       390
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751367174"
     variation       391
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403523529"
     variation       392
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:113172829"
     variation       394
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1294648499"
     variation       400
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1453751591"
     variation       402
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758362704"
     variation       405
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752580346"
     variation       412
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372907622"
     variation       414
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146492005"
     variation       420
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368183662"
     variation       422
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776214964"
     variation       423
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144461478"
     variation       424
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1210208297"
     variation       426
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:760347994"
     variation       431
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:773719094"
     variation       433
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1031780972"
     variation       440
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:772528132"
     variation       442..458
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="at"
                     /replace="atctgctccataaaaat"
                     /db_xref="dbSNP:1221856915"
     variation       444..448
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="ct"
                     /replace="ctgct"
                     /db_xref="dbSNP:781677772"
     variation       447
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1329889893"
     variation       449
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367564103"
     variation       453
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774903401"
     variation       459
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:971589415"
     variation       464
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1347611142"
     variation       466
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:117103025"
     variation       467
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749369504"
     variation       469
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142418256"
     variation       473
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756361058"
     variation       475
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1458360699"
     variation       479
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1053744296"
     variation       486
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1469463343"
     variation       490
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175070865"
     variation       494..526
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="gaagga"
                     /replace="gaaggaaaaccaagacaagaagcagcagaagga"
                     /db_xref="dbSNP:1463143252"
     variation       496
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746048386"
     variation       499..502
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1559927266"
     variation       500
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1378970431"
     variation       501
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1199371882"
     variation       503
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777564368"
     variation       509
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1237186958"
     variation       510..515
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="aag"
                     /replace="aagaag"
                     /db_xref="dbSNP:747626532"
     variation       513
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138419795"
     variation       514
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1410574616"
     variation       518
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1164756389"
     variation       519
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1315367024"
     variation       525
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765216580"
     variation       527
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:150401939"
     variation       531
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1399855485"
     variation       532
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370275908"
     variation       534
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1262656110"
     variation       538
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1281459805"
     variation       540
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765742513"
     variation       542
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760438150"
     variation       545
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:965467942"
     variation       550
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:529892538"
     variation       554
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1291433342"
     variation       558
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1227190380"
     variation       560
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1336771262"
     exon            561..784
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /inference="alignment:Splign:2.1.0"
     variation       561
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1359417561"
     variation       565
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1313493482"
     variation       567
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374309452"
     variation       572
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:557048722"
     variation       573
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778514406"
     variation       574
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754949284"
     variation       575
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:898537237"
     variation       576
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:544828104"
     variation       577
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:965643534"
     variation       582
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779640915"
     variation       583
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:577503930"
     variation       585
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:769208091"
     variation       585
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1359473117"
     variation       590
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1216006618"
     variation       592
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:111865143"
     variation       598
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:767261812"
     variation       600
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761495424"
     variation       605
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1181167736"
     variation       606
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:986254245"
     variation       607
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140467596"
     variation       612
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1278820953"
     variation       614
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:764322897"
     variation       618
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:61746075"
     variation       619
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150210060"
     variation       624..629
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /db_xref="dbSNP:747402148"
     variation       628
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1290226999"
     variation       629
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1230469766"
     variation       631
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775836695"
     variation       632
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769901640"
     variation       634
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759607303"
     variation       646
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191576929"
     variation       647
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1410210760"
     variation       648
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771156673"
     variation       653
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301046050"
     variation       658
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:747134807"
     variation       659
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141909400"
     variation       661
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1158119058"
     variation       662
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:936245254"
     variation       666
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142468996"
     variation       667
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201817007"
     variation       669
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1183084919"
     variation       673..699
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="aaag"
                     /replace="aaaggaaggctctggaggccaagaaag"
                     /db_xref="dbSNP:1284158152"
     variation       676
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1369705633"
     variation       677
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780111754"
     variation       678
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1267283397"
     variation       684
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1559925928"
     variation       690
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1234040427"
     variation       695
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1301651015"
     variation       698
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1224237025"
     variation       699
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755756296"
     variation       705
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1295564781"
     variation       706
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:749962237"
     variation       718..726
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="gg"
                     /replace="gggagatgg"
                     /db_xref="dbSNP:1415933359"
     variation       720
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780778075"
     variation       729..730
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:780367512"
     variation       734
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756998446"
     variation       735
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374764425"
     variation       736
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773981418"
     variation       740
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763194115"
     variation       741
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775985138"
     variation       745
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765718906"
     variation       746..747
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="aa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1390856971"
     variation       746
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1399031117"
     variation       747
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:966830796"
     variation       755
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61741386"
     variation       757
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1157987619"
     variation       758
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6776294"
     variation       759
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773288014"
     variation       760
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768540332"
     variation       762
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:888536657"
     variation       764
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1242081825"
     variation       765
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1559925716"
     variation       768
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:749037472"
     variation       776
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775362911"
     variation       778
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:571088502"
     variation       783
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1269542867"
     exon            785..938
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /inference="alignment:Splign:2.1.0"
     variation       787..805
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="agaaga"
                     /replace="agaagaaaaggcaagaaga"
                     /db_xref="dbSNP:779090905"
     variation       788
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1214620990"
     variation       791
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144428629"
     variation       795
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769660260"
     variation       797
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776676351"
     variation       800
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1431962091"
     variation       801
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770540385"
     variation       803
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1163430770"
     variation       812
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139862408"
     variation       814..817
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:757450793"
     variation       818
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1559923234"
     variation       820
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1248813305"
     variation       827
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746486872"
     variation       828
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:549454864"
     variation       830
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757991867"
     variation       835
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:747759280"
     variation       842
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1275272612"
     variation       846..851
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="ac"
                     /replace="actcac"
                     /db_xref="dbSNP:1319845251"
     variation       847
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1221727605"
     variation       849..852
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="caca"
                     /replace="cacaca"
                     /db_xref="dbSNP:1047908851"
     variation       852
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537292664"
     variation       855
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:540841017"
     variation       856
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199685847"
     variation       863
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755315773"
     variation       864
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752199460"
     variation       866
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1412069930"
     variation       868
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766795779"
     variation       876
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750469447"
     variation       877
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200315000"
     variation       888
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:761960768"
     variation       898..901
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace=""
                     /replace="tgaa"
                     /db_xref="dbSNP:754118659"
     variation       898
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1334714767"
     variation       906
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1446159009"
     variation       907
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:751806825"
     variation       911
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:369644568"
     variation       913
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1184202307"
     variation       915
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:533470938"
     variation       917
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768155369"
     variation       926
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759399168"
     variation       927
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776766175"
     variation       930
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770787159"
     variation       935
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198377286"
     variation       936
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1487491534"
     variation       937
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1267089247"
     exon            939..1129
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /inference="alignment:Splign:2.1.0"
     variation       942
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143973768"
     variation       945
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:760553102"
     variation       948
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773180074"
     variation       949
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149867008"
     variation       955
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:978773468"
     variation       956
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761311667"
     variation       957
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1231573488"
     variation       961
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774053294"
     variation       965
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866199822"
     variation       966
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1288422792"
     variation       969..970
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1363599500"
     variation       969
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1382218879"
     variation       973
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:768298220"
     variation       979
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:967429503"
     variation       984
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1436581297"
     variation       985..987
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="ata"
                     /db_xref="dbSNP:1559913483"
     variation       985
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780318300"
     variation       986
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770166704"
     variation       988..1000
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="gg"
                     /replace="ggattaagctggg"
                     /db_xref="dbSNP:751388166"
     variation       988
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1396690891"
     variation       989
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171563514"
     variation       990
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146010906"
     variation       992
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746413349"
     variation       993..1010
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="aagctggggaaagctggg"
                     /replace="aagctggggaaagctggggaaagctggg"
                     /db_xref="dbSNP:1388224602"
     variation       997
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781716712"
     variation       998..1001
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:766182167"
     variation       1001
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757480047"
     variation       1005
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1358529717"
     variation       1007
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777942018"
     variation       1014..1020
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="ctg"
                     /replace="ctgtctg"
                     /db_xref="dbSNP:1433888714"
     variation       1018
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1348993134"
     variation       1033
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1020335606"
     variation       1040
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:563503788"
     variation       1041
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1255745217"
     variation       1044
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1051534375"
     variation       1047
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:563222564"
     variation       1048
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:544561740"
     variation       1053
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256991710"
     variation       1062
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755913299"
     variation       1068
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139042636"
     variation       1082
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767435186"
     variation       1083
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143674870"
     variation       1085
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1162618094"
     variation       1086
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17603649"
     variation       1087
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:76418892"
     variation       1090
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:762637903"
     variation       1092
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1403865178"
     variation       1093
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775189458"
     variation       1095
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:573009516"
     variation       1096
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746240655"
     variation       1098
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138967102"
     variation       1100
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771579392"
     variation       1102
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:941444028"
     variation       1107
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:908689415"
     variation       1108
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1368032938"
     variation       1112
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747470336"
     variation       1113
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:888732913"
     variation       1120
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:982997177"
     exon            1130..1379
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /inference="alignment:Splign:2.1.0"
     variation       1134
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468322100"
     variation       1135..1136
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1264142189"
     variation       1137
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771382952"
     variation       1139
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:560339513"
     variation       1148
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368601845"
     variation       1149
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773831557"
     variation       1152
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759582479"
     variation       1158
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147187136"
     variation       1159
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147328745"
     variation       1172
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1340726322"
     variation       1173
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138387426"
     variation       1174
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755237699"
     variation       1179
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1207585580"
     variation       1180
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1357771775"
     variation       1181
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:749418667"
     variation       1184
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1373404506"
     variation       1186
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781010215"
     variation       1194
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757028037"
     variation       1196
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760334099"
     variation       1198
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777686653"
     variation       1199
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758204572"
     variation       1204
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:962063472"
     variation       1208
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752266963"
     variation       1209
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143944825"
     variation       1210..1211
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:201851070"
     variation       1211
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759264737"
     variation       1212
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753510309"
     variation       1220
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766898238"
     variation       1221
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773921248"
     variation       1225
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772635141"
     variation       1235
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1194041672"
     variation       1239
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201008915"
     variation       1240
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:191818836"
     variation       1241
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1355092311"
     variation       1244
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370789272"
     variation       1247
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1245491871"
     variation       1251
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1201575084"
     variation       1254
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768591952"
     variation       1256
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1399792586"
     variation       1261
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:749564915"
     variation       1264
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377341775"
     variation       1268
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1295951960"
     variation       1270
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780244085"
     variation       1271
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:567435479"
     variation       1275
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770780931"
     variation       1276
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1331056624"
     variation       1281
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1224130786"
     variation       1286
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1343956257"
     variation       1290
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:954526177"
     variation       1294
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1028810766"
     variation       1296
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276729100"
     variation       1299
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746813283"
     variation       1304
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148921355"
     variation       1305
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:968701041"
     variation       1308
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758383419"
     variation       1309
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752536646"
     variation       1314..1315
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1284163729"
     variation       1318
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778524999"
     variation       1321
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1265701063"
     variation       1322
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754423929"
     variation       1329
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753602165"
     variation       1331
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1414273740"
     variation       1334
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201202715"
     variation       1336
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:760334030"
     variation       1338
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201867663"
     variation       1340
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767722618"
     variation       1343
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372716725"
     variation       1345
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1377763752"
     variation       1347
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774703441"
     variation       1348
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768842813"
     variation       1350
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1020856207"
     variation       1352
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1216132431"
     variation       1358
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1441478835"
     variation       1362
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1009507796"
     variation       1364
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111297405"
     variation       1367..1372
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /db_xref="dbSNP:35258202"
     variation       1367
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1220716763"
     variation       1371
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:775483992"
     variation       1373
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1559906903"
     variation       1379
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199806660"
     exon            1380..1834
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /inference="alignment:Splign:2.1.0"
     variation       1383
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1432245024"
     variation       1388
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:952297045"
     variation       1389
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1355613445"
     variation       1393
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1026472352"
     variation       1395
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:575617276"
     variation       1400
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747888612"
     variation       1401
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1475317173"
     variation       1408
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1250850161"
     variation       1409
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1179740359"
     variation       1410
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:267599553"
     variation       1411
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:774127712"
     variation       1413
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:267599552"
     variation       1414
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:267599551"
     variation       1416
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1206764995"
     variation       1418
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768725383"
     variation       1420
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1220929010"
     variation       1421
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1482613904"
     variation       1424
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:369047651"
     variation       1425
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1019212246"
     variation       1429
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749185948"
     variation       1431
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1350099542"
     variation       1432
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1161668569"
     variation       1436
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375835044"
     variation       1440
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:866223445"
     variation       1441
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1412002102"
     variation       1444
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1420080438"
     variation       1447
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779738802"
     variation       1452
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1293415720"
     variation       1457..1466
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="aacaaca"
                     /replace="aacaacaaca"
                     /db_xref="dbSNP:745719777"
     variation       1459
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745596395"
     variation       1462
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1331393070"
     variation       1468
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1180637241"
     variation       1470
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:540414241"
     variation       1472
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780708681"
     variation       1476
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:563703570"
     variation       1478
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1410748424"
     variation       1480
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:545514904"
     variation       1481
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764471489"
     variation       1489
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1008329015"
     variation       1491
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1453155748"
     variation       1495
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1296592840"
     variation       1496
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1251189442"
     variation       1497
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1190598668"
     variation       1503
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1340038680"
     variation       1507
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1487448885"
     variation       1509
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758936813"
     variation       1511
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1214387949"
     variation       1517
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:889486530"
     variation       1520
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61738786"
     variation       1524
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1559902124"
     variation       1531
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:753171237"
     variation       1532
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1207358883"
     variation       1536
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1238882448"
     variation       1539
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765350355"
     variation       1540
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:572489038"
     variation       1545
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1028477916"
     variation       1548
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759597170"
     variation       1549
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776977805"
     variation       1557
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766512013"
     variation       1561
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1218021948"
     variation       1565
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1000654704"
     variation       1568
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150202005"
     variation       1569..1572
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="ga"
                     /replace="gaga"
                     /db_xref="dbSNP:768435774"
     variation       1569
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774035593"
     variation       1572
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1440926215"
     variation       1575
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1240839689"
     variation       1576
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1318070939"
     variation       1577
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768529138"
     variation       1579
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1364210351"
     variation       1580
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175089320"
     variation       1585
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1431427240"
     variation       1590
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1170179672"
     variation       1597
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1396750159"
     variation       1602
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1194344960"
     variation       1603
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141402448"
     variation       1604
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200803511"
     variation       1605
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769498318"
     variation       1609
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745377651"
     variation       1613
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1470418760"
     variation       1614
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780699034"
     variation       1618
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1208440760"
     variation       1621
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770513486"
     variation       1622
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1320077436"
     variation       1624..1625
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace=""
                     /replace="ag"
                     /db_xref="dbSNP:1432592410"
     variation       1624
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1362779613"
     variation       1627
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:78275314"
     variation       1628..1629
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="cc"
                     /replace="cccccccccc"
                     /db_xref="dbSNP:144847583"
     variation       1629
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778151730"
     variation       1630
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758740675"
     variation       1631
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294731708"
     variation       1633
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1357331641"
     variation       1639
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753260923"
     variation       1640
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779388802"
     variation       1641
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755444201"
     variation       1643
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1464299379"
     variation       1647
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1377235091"
     variation       1649
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753875401"
     variation       1652
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766430501"
     variation       1654
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760836041"
     variation       1655
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1280105894"
     variation       1663
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1195408113"
     variation       1666
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1429396769"
     variation       1670
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1255658743"
     variation       1672
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750623673"
     variation       1680
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:534894776"
     variation       1681
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1281689722"
     variation       1683
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1205129843"
     variation       1685
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1340658537"
     variation       1688
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1271936150"
     variation       1693
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:574319149"
     variation       1695
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775362694"
     variation       1700
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763956498"
     variation       1701
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759473063"
     variation       1704
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776038634"
     variation       1705
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:770148598"
     variation       1709
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770446442"
     variation       1715
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1032599988"
     variation       1716
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1189606155"
     variation       1718
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1169734900"
     variation       1719
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746689297"
     variation       1720
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1368143180"
     variation       1724
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:926671044"
     variation       1725
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777392808"
     variation       1731
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:985271595"
     variation       1734
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772492371"
     variation       1740
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1454048843"
     variation       1747
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1258744731"
     variation       1748
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748517702"
     variation       1752
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372934728"
     variation       1760
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1559901479"
     variation       1763
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1253205604"
     variation       1765
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1197071691"
     variation       1768
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:919394310"
     variation       1771
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755461389"
     variation       1772
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:555759990"
     variation       1777
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368237536"
     variation       1781
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1290630359"
     variation       1782
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1559901408"
     variation       1787
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1293739693"
     variation       1789
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376524383"
     variation       1794..1796
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:747287862"
     variation       1795
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1009088453"
     variation       1796
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750728574"
     variation       1800
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:890283037"
     variation       1805
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763047841"
     variation       1806
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762073735"
     variation       1810
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1285380160"
     variation       1811
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:752564780"
     variation       1814
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765086011"
     variation       1817
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1451337441"
     variation       1822
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759433088"
     variation       1824
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1271638825"
     variation       1828
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1471792913"
     variation       1829
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776608757"
     variation       1834
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1183228031"
     exon            1835..1944
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /inference="alignment:Splign:2.1.0"
     variation       1845
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754789035"
     variation       1845
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:746436892"
     variation       1848
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753785543"
     variation       1849
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766344497"
     variation       1851
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:926243781"
     variation       1852
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1374285782"
     variation       1855
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:921662261"
     variation       1856
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1312626036"
     variation       1859
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1559900599"
     variation       1864
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1559900586"
     variation       1865
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1559900573"
     variation       1869
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:760547589"
     variation       1872
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772731461"
     variation       1877
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1273777563"
     variation       1878
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371532208"
     variation       1879
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746915123"
     variation       1884..1888
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="tct"
                     /replace="tctct"
                     /db_xref="dbSNP:1559900522"
     variation       1888
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1559900512"
     variation       1889
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115484497"
     variation       1893
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1371878776"
     variation       1896
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768957777"
     variation       1899
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1433250837"
     variation       1905
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1482723629"
     variation       1913
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749656507"
     variation       1917
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142575692"
     variation       1919
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1414195421"
     variation       1924
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:967692869"
     variation       1925
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770358548"
     variation       1926
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1400727904"
     variation       1927
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746341909"
     variation       1928
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115137198"
     variation       1930
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:757390174"
     variation       1933
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1187379458"
     variation       1937
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747294756"
     variation       1944
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777023580"
     exon            1945..2027
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /inference="alignment:Splign:2.1.0"
     variation       1946
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771577283"
     variation       1947
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761036859"
     variation       1949
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298262924"
     variation       1952..1959
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="agagag"
                     /replace="agagagag"
                     /db_xref="dbSNP:753394793"
     variation       1953
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1439432961"
     variation       1955
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1391875648"
     variation       1960
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198273884"
     variation       1968
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144435002"
     variation       1969
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201586377"
     variation       1972
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144232350"
     variation       1973
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748447916"
     variation       1974
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778986082"
     variation       1975
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769640813"
     variation       1977
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:533252501"
     variation       1978
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140608742"
     variation       1981
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1362572964"
     variation       1983
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780918643"
     variation       1984
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200341116"
     variation       1992
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1214597014"
     variation       1996..2024
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="agaagaagaaaaa"
                     /replace="agaagaagaaaaaacaagaagaagaaaaa"
                     /db_xref="dbSNP:758251611"
     variation       1996..2005
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="agaagaa"
                     /replace="agaagaagaa"
                     /db_xref="dbSNP:1388478593"
     variation       2004..2009
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="aaaaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:1559898159"
     variation       2006..2012
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="aa"
                     /replace="aaaacaa"
                     /db_xref="dbSNP:1559898135"
     variation       2007
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:147229985"
     variation       2009
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777395402"
     variation       2010
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757834443"
     variation       2011..2021
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="aagaagaa"
                     /replace="aagaagaagaa"
                     /db_xref="dbSNP:766242380"
     variation       2013
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143587881"
     variation       2021
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1559898100"
     variation       2022
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1247039872"
     variation       2025
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139157890"
     exon            2028..2129
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /inference="alignment:Splign:2.1.0"
     variation       2031
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1383542118"
     variation       2033
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1038440174"
     variation       2036
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1362451542"
     variation       2038
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201645694"
     variation       2039
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747625463"
     variation       2051
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778515420"
     variation       2052
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754706776"
     variation       2054
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:6784095"
     variation       2055
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370146102"
     variation       2056
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377280799"
     variation       2065
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:955658660"
     variation       2066
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:562548722"
     variation       2072
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1352024461"
     variation       2077
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1442071723"
     variation       2086
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751001031"
     variation       2094
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1331329651"
     variation       2098
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:922901576"
     variation       2103
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:975793972"
     variation       2104..2117
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="gagaagaga"
                     /replace="gagaagagaagaga"
                     /db_xref="dbSNP:761348034"
     variation       2104
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767911543"
     variation       2111
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1355669241"
     variation       2114
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:888443284"
     variation       2115
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762319745"
     variation       2116
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774449430"
     variation       2118
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1559897268"
     variation       2119
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1211010749"
     variation       2127
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1236350643"
     exon            2130..2273
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /inference="alignment:Splign:2.1.0"
     variation       2147
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755722371"
     variation       2152
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1231249533"
     variation       2153..2158
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="aa"
                     /replace="aattaa"
                     /db_xref="dbSNP:763799787"
     variation       2157
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750762956"
     variation       2158
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:372330906"
     variation       2161..2162
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1171743356"
     variation       2165
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202215581"
     variation       2171
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:35546981"
     variation       2177
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:557579461"
     variation       2181
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369714095"
     variation       2182
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1391968486"
     variation       2183
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1482727322"
     variation       2186
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138194399"
     variation       2204
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763020547"
     variation       2205..2206
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace=""
                     /replace="aaaaaaaaa"
                     /db_xref="dbSNP:1463184161"
     variation       2209
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752707186"
     variation       2210
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374610112"
     variation       2211
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1469065460"
     variation       2213
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1559878371"
     variation       2214
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1212459774"
     variation       2215..2216
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace=""
                     /replace="gg"
                     /db_xref="dbSNP:1183398070"
     variation       2215
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:572045412"
     variation       2220
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1439724522"
     variation       2222
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1485766690"
     variation       2224
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148332091"
     variation       2227
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772909666"
     variation       2229
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1475001350"
     variation       2231
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370724918"
     variation       2232
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1290396756"
     variation       2235
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753646696"
     variation       2236
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200521026"
     variation       2238
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1169610447"
     variation       2241
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1348457704"
     variation       2244
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774417809"
     variation       2247
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:768343931"
     variation       2253
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1431346776"
     variation       2254
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:574869510"
     variation       2259..2261
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:760415241"
     variation       2259
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144981495"
     variation       2260
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:779556883"
     variation       2266
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769352282"
     variation       2272
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1445311990"
     exon            2274..2426
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /inference="alignment:Splign:2.1.0"
     variation       2274
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752797292"
     variation       2278
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:966028365"
     variation       2281
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1423364699"
     variation       2282
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1018494756"
     variation       2286
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366630008"
     variation       2287..2289
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="att"
                     /replace="atttatt"
                     /db_xref="dbSNP:1415513403"
     variation       2287
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:901778071"
     variation       2291..2294
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="ct"
                     /replace="ctct"
                     /db_xref="dbSNP:746358181"
     variation       2291
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759715102"
     variation       2294
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754067797"
     variation       2296
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1425457136"
     variation       2301
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1167007765"
     variation       2302
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767273110"
     variation       2306
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761695639"
     variation       2308
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368014179"
     variation       2316
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:564016706"
     variation       2317
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1283469087"
     variation       2323
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762932133"
     variation       2324
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760940575"
     variation       2327
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1354160867"
     variation       2329
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1248130616"
     variation       2332
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:767720916"
     variation       2334
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769327510"
     variation       2335
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370787784"
     variation       2337
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200206953"
     variation       2339
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1437845385"
     variation       2344
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1233518735"
     variation       2347
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:994569699"
     variation       2353
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773167106"
     variation       2354
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1443294408"
     variation       2355
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1159685386"
     variation       2359
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1472210603"
     variation       2363
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1354148667"
     variation       2364
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1355159647"
     variation       2365
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376073972"
     variation       2371
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:756761866"
     variation       2377
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:778063883"
     variation       2382
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138456017"
     variation       2384
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1559876236"
     variation       2388
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201121137"
     variation       2395
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199616776"
     variation       2397
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1036165185"
     variation       2398
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1003343112"
     variation       2404
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1421118442"
     variation       2406
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:977598886"
     variation       2410
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:755071914"
     variation       2411
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1171169704"
     variation       2424
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:754074579"
     variation       2425
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225915198"
     variation       2426
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:906444092"
     exon            2427..2572
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /inference="alignment:Splign:2.1.0"
     variation       2429
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145896589"
     variation       2430
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1275456969"
     variation       2431
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:112972710"
     variation       2434
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1316875337"
     variation       2435
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:559557017"
     variation       2441
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750640586"
     variation       2446..2447
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1352383927"
     variation       2448
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747116452"
     variation       2452
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1283276370"
     variation       2455
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1444007307"
     variation       2461
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1309349979"
     variation       2462
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1439778925"
     variation       2463
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1368256822"
     variation       2466
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140650637"
     variation       2469
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1386279688"
     variation       2470
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1458181235"
     variation       2473
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764041543"
     variation       2481..2487
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="aaga"
                     /replace="aagaaga"
                     /db_xref="dbSNP:779707287"
     variation       2481
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:768362271"
     variation       2488..2491
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="tttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:1421406630"
     variation       2488
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752372708"
     variation       2495
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373006163"
     variation       2500
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1193025846"
     variation       2502
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1424382899"
     variation       2504..2509
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="t"
                     /replace="taacat"
                     /db_xref="dbSNP:1452813774"
     variation       2507
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1247196212"
     variation       2509..2512
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="t"
                     /replace="tggt"
                     /db_xref="dbSNP:748496715"
     variation       2512
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1018846704"
     variation       2513
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1251945380"
     variation       2520
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1192166059"
     variation       2523
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759343108"
     variation       2528
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776236811"
     variation       2529
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765845553"
     variation       2532
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1355032318"
     variation       2533
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202109497"
     variation       2540
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1232834895"
     variation       2543
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1559875253"
     variation       2546
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:772490727"
     variation       2547
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:750256199"
     variation       2556
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:765216908"
     variation       2556
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748550116"
     variation       2557
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145062166"
     variation       2558
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200402239"
     variation       2561
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369084438"
     variation       2564
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149961381"
     variation       2570
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780318115"
     variation       2572
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769983903"
     exon            2573..3795
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /inference="alignment:Splign:2.1.0"
     variation       2573
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140176565"
     variation       2576
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1461680713"
     variation       2588
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1016606081"
     variation       2589
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200348566"
     variation       2591
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:112136393"
     variation       2595
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781372595"
     variation       2596
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199960106"
     variation       2600
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:151181828"
     variation       2601
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1156402686"
     variation       2606
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1559860719"
     variation       2613
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426070269"
     variation       2614
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1257729081"
     variation       2615
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1559860693"
     variation       2616..2617
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace=""
                     /replace="tac"
                     /db_xref="dbSNP:763709193"
     variation       2616
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1200463236"
     variation       2618
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1249211005"
     variation       2619
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754718431"
     variation       2621
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753837325"
     variation       2622
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779967566"
     variation       2624
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1362872030"
     variation       2626
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:755984112"
     variation       2628
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113480805"
     variation       2641..2648
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="aagaa"
                     /replace="aagaagaa"
                     /db_xref="dbSNP:1313534466"
     variation       2646
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202012960"
     variation       2650
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766897006"
     variation       2652
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761565825"
     variation       2653
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144192553"
     variation       2654
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1466309620"
     variation       2655
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1394291669"
     variation       2658
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764588009"
     variation       2664
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369421288"
     variation       2665
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775941056"
     variation       2666
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:901073389"
     variation       2669
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760084450"
     variation       2674
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776895230"
     variation       2675
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1011396828"
     variation       2676
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1235800079"
     variation       2684
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:770895905"
     variation       2685
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:747316219"
     variation       2688
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201146772"
     variation       2689
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140308365"
     variation       2690
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1332775914"
     variation       2696..2697
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:892956920"
     variation       2700
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1207773359"
     variation       2704
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749091283"
     variation       2710
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1411163741"
     variation       2717
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779771225"
     variation       2718
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1163843548"
     variation       2718
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147633710"
     variation       2723
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:796891887"
     variation       2731
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:745773307"
     variation       2734
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1447867832"
     variation       2739
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1167670557"
     variation       2746
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780801592"
     variation       2747
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1167557221"
     variation       2751
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:377095209"
     variation       2756
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751017097"
     variation       2761
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763667765"
     variation       2763
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1158538878"
     variation       2770
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758075380"
     variation       2771
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145304274"
     variation       2772
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765670138"
     variation       2776
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1327240682"
     variation       2777..2778
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace=""
                     /replace="tcat"
                     /db_xref="dbSNP:1439927822"
     variation       2781
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1251943310"
     variation       2782
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:565629371"
     variation       2786
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:901855675"
     variation       2787
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1292924664"
     variation       2787
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:547428603"
     variation       2789
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760673436"
     variation       2790
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1204554476"
     variation       2792
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773282867"
     variation       2794
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:535231602"
     variation       2795
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1240878079"
     variation       2802
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:193002499"
     variation       2806
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1301586399"
     variation       2807
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:769552948"
     variation       2808
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745861392"
     variation       2809
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371602916"
     variation       2811
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757162059"
     variation       2812
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:553590803"
     variation       2819
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1299529804"
     variation       2821
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777296671"
     variation       2823
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369522532"
     variation       2824..2830
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="tgtgt"
                     /replace="tgtgtgt"
                     /db_xref="dbSNP:1482548273"
     variation       2825
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765757981"
     variation       2833
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:549713096"
     variation       2834
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249206887"
     variation       2839
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:943469371"
     variation       2840
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:991443216"
     variation       2844
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1188003190"
     variation       2850..2864
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="acatacatacataca"
                     /replace="acatacatacatacataca"
                     /db_xref="dbSNP:919408085"
     variation       2851
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1372046162"
     variation       2852
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1049138249"
     variation       2856
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112265538"
     variation       2862
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:963663133"
     variation       2863
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1430830611"
     variation       2864
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1209905540"
     variation       2876
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1017006779"
     variation       2878
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1373840168"
     variation       2880
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1005249384"
     variation       2881
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:972329988"
     variation       2882
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:951100808"
     variation       2884
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:531212298"
     variation       2895
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1342547487"
     variation       2926
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1255274625"
     variation       2932..2934
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace=""
                     /replace="ttt"
                     /db_xref="dbSNP:1209926788"
     variation       2937
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1231067531"
     variation       2944
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1277967293"
     variation       2951
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138535716"
     variation       2974
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1025425451"
     variation       2976
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:997955214"
     variation       2977
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376912556"
     variation       2981
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:551478109"
     variation       2982
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:900979899"
     variation       2985
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1039548277"
     variation       2986..3002
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace=""
                     /replace="catccaaaggaacattc"
                     /db_xref="dbSNP:1173378412"
     variation       2988
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1007181388"
     variation       2989
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1191606449"
     variation       2992
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:533321440"
     variation       2993
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:745826111"
     variation       3000
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1450683796"
     variation       3004
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1023163457"
     variation       3005
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:958706673"
     variation       3005
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1436813934"
     variation       3008
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:893763900"
     variation       3010
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1011261449"
     variation       3011
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1310096791"
     variation       3012
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1054189204"
     variation       3027
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:957218982"
     variation       3031
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1031436398"
     variation       3041
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1402027282"
     variation       3043
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:747977630"
     variation       3044
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301591625"
     variation       3051
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:559597240"
     variation       3057
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1559859677"
     variation       3074..3081
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="ctga"
                     /replace="ctgactga"
                     /db_xref="dbSNP:1484586665"
     variation       3084
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468075187"
     variation       3085
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777660582"
     variation       3093
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:923961714"
     variation       3095
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1261884872"
     variation       3102
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1046434746"
     variation       3103
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541488525"
     variation       3106
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1251455551"
     variation       3111
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114330037"
     variation       3112
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:117631522"
     variation       3118
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375710221"
     variation       3119
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:991041433"
     variation       3122
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1451943388"
     variation       3127
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1160350298"
     variation       3139
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1389546287"
     variation       3140..3144
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="aaaca"
                     /replace="aaacaaaca"
                     /db_xref="dbSNP:1440074207"
     variation       3144..3146
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="aga"
                     /db_xref="dbSNP:1323810458"
     variation       3148
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1049198434"
     variation       3154..3155
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace=""
                     /replace="ag"
                     /db_xref="dbSNP:548508991"
     variation       3155
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:930693309"
     variation       3157
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1240822657"
     variation       3160
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1268208788"
     variation       3164
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1409246014"
     variation       3165
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:543341981"
     variation       3167
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372413301"
     variation       3168
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:963955342"
     variation       3171..3178
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="aagg"
                     /replace="aaggaagg"
                     /db_xref="dbSNP:1250311166"
     variation       3173
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779184007"
     variation       3176
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1036500774"
     variation       3180
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1417542033"
     variation       3181
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:575927117"
     variation       3186
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1412711422"
     variation       3188
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1460997333"
     variation       3190
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:557774149"
     variation       3194
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:939588438"
     variation       3210
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198627361"
     variation       3214
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:62265442"
     variation       3217
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1297381300"
     variation       3221
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1371000969"
     variation       3224
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1025330164"
     variation       3231
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766039692"
     variation       3233
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:965128805"
     variation       3234
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1354217759"
     variation       3238
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:533534526"
     variation       3241
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274544847"
     variation       3242
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:553604638"
     variation       3245
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1223019527"
     variation       3258
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1006759004"
     variation       3260
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1327165678"
     variation       3273
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1207487536"
     variation       3279
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:893696352"
     variation       3283
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:915554680"
     variation       3284
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1290437134"
     variation       3292
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1229305673"
     variation       3297
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:989870445"
     variation       3304
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424328425"
     variation       3308
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1169667471"
     variation       3317..3327
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="tt"
                     /replace="ttatcctgatt"
                     /db_xref="dbSNP:1352490315"
     variation       3328
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1463354984"
     variation       3332
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:868372197"
     variation       3337
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1340224304"
     variation       3338..3339
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace=""
                     /replace="tg"
                     /db_xref="dbSNP:1308216110"
     variation       3341
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1374440969"
     variation       3342
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:563189652"
     variation       3346
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1412593129"
     variation       3361
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756562879"
     variation       3362
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1379349417"
     variation       3363
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144868774"
     variation       3364
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:567891972"
     variation       3366
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306076368"
     variation       3378
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403476344"
     variation       3380
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:555973423"
     variation       3398
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1485460585"
     variation       3403
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:977264326"
     variation       3405
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6438176"
     variation       3406..3409
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="ct"
                     /replace="ctct"
                     /db_xref="dbSNP:1385893694"
     variation       3414
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:532574780"
     variation       3424
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1417337824"
     variation       3425
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1007459139"
     variation       3437
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1160913893"
     variation       3440
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141146844"
     variation       3444
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1314335635"
     variation       3449
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766868707"
     variation       3453
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1359176890"
     variation       3454
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1429438749"
     variation       3457
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1027630400"
     variation       3458
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:544955778"
     variation       3468
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138011995"
     variation       3469..3475
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="aata"
                     /replace="aataata"
                     /db_xref="dbSNP:767042833"
     variation       3474
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1425346215"
     variation       3475..3478
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="ac"
                     /replace="acac"
                     /db_xref="dbSNP:1036437333"
     variation       3476..3481
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="ca"
                     /replace="cactca"
                     /replace="cactcactca"
                     /db_xref="dbSNP:1281027839"
     variation       3476
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1347620739"
     variation       3480
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:942237937"
     variation       3481
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:909391551"
     variation       3492
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773788738"
     variation       3502
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1240478784"
     variation       3522..3525
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="ga"
                     /replace="gaga"
                     /db_xref="dbSNP:1390808373"
     variation       3525
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1466185943"
     variation       3528..3529
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1189211038"
     variation       3532
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1463587905"
     variation       3535
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1452354110"
     variation       3539
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1270148078"
     variation       3541
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1425467802"
     variation       3550
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:939541411"
     variation       3560
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1156298634"
     variation       3568
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1390290334"
     variation       3570
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:929554638"
     variation       3576
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1559858856"
     variation       3578
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:574227665"
     variation       3587
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1209562169"
     variation       3588
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1355860086"
     variation       3590
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:906681248"
     variation       3591
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1247368284"
     variation       3596
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1341452958"
     variation       3601
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277018438"
     variation       3602..3606
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="tgt"
                     /replace="tgtgt"
                     /db_xref="dbSNP:1297505941"
     variation       3604
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1345946667"
     variation       3608..3612
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="agaga"
                     /db_xref="dbSNP:1362377281"
     variation       3609
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:571066285"
     variation       3628..3633
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="aat"
                     /replace="aataat"
                     /db_xref="dbSNP:1209215713"
     variation       3639
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:948300467"
     variation       3641
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564042886"
     variation       3646
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:150338643"
     variation       3647
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1018052282"
     variation       3662
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140297319"
     variation       3667
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:543201855"
     variation       3679
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1413460899"
     variation       3686
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:531493906"
     variation       3698
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1457335924"
     variation       3712
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1459243976"
     variation       3713
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:957867792"
     variation       3725
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1032596377"
     variation       3727
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1447626708"
     variation       3729
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762729592"
     variation       3732
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1325924338"
     variation       3733
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:999358162"
     variation       3736
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1441659285"
     variation       3751
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1286698767"
     variation       3754
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1352359968"
     variation       3767..3773
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="aaataaa"
                     /replace="aaataaataaa"
                     /db_xref="dbSNP:1292788405"
     variation       3772
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1229121019"
     variation       3783..3788
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="tttttt"
                     /replace="ttttttt"
                     /db_xref="dbSNP:59647151"
     variation       3789..3790
                     /gene="CCDC191"
                     /gene_synonym="KIAA1407"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1553735764"
ORIGIN      
gcctcgtgggagtggtggttcgacggtgtcctatgcctgctttccttgcgggcggaggaactacaattcccagcgtgacccggaggcagcccgggcagaagggcggttgctgcagctttggccgaggttcgggctcgaacttggaaaatgctcctggcgcctcagggaaggtccttctcaaagaaaaggatggggctgaatcgctggaaacggttcacaaggaagccgagtcccaagctcaggagctggtcaatgactggttagacaccaaacttaagcaagaattagcaagtgaggaagaaggtgatgctaaaaacactgtgtcaagtgtcactattatgccggaagccaatggccatttgaaatatgacaagtttgatgatttatgtggctatttggaggaagaagaggaaagtaccaccgttcaaaaatttatagaccatctgctccataaaaatgtggtagattctgcaatgatggaagatcttggaaggaaggaaaaccaagacaagaagcagcagaaggatcctcgtcttaccatggagatgagacataagcaggtaaaagaaaatcgcttaagacgtgagaaagaactggagtaccagagaatagaaaagaccctgaaaaaatcggccttcttggaggctcagtgtctggtgcaagaagagaagaaaaggaaggctctggaggccaagaaagaggaagaggagattcaaagggagatggtgaagctgcggagggagataattgagaggagacgcactgtgaaagcagcatggaaaatagagaagaaaaggcaagaagagaattctcaaaatagttcagaaaaagtcatgtttcaaagtactcacattcttccagatgaggaaaaaatggtgaaggaaagaaaaaggaaattgaaagaagtattaatccaaactttcaaagaaaatcaacagtgtcaaaaacggtatttcgctgcctggcacaagctgattcttgatcataggattaagctggggaaagctgggaccctgtctgactggaagattcagctgaaggtcctgcgggcctggagagactacacaagattccagaagttggagcgggagactcaagccttggaaaatgatcttagggaagaaaacagaaaacaacaactggccactgagtataaccggaaacaagttctccgacactgctttacagaatggcagcattggcatggcgccgagctcctgaagagagagctggctctcacaaaagaggaaactaggaagaagatggatgcactgctgcaggcagcatcactggggaaactcagtgccaatgggttatcaggcatcagtctacctgaggaggcaacagccatggtgggtccaccagtaaaaaatggacaggagactgctgtgccccctttgtgggaaaagcctcccttgggaagcagtggttgtatgctcagtcctcccctgggaagaacaacaacaggcaacttgcagggttcccttcagaatgtctctctgagtgcacctggcaataagcagcacaagaccctgggtgctgaaccctctcaacagcctggcagcaacgagacactcagaactaccagccagaaagcagaaccgctttgcttgggtcatttccacaaccgccatgtcttccagcaacagctgattgagaagcaaaagaagaaacttcaggaacagcagaaaacaattctcgagctgaagaaaaacctgcagctggcagaggctcagtgggcagcagagcatgccttagcagtcacagaagcacagagccacctgctgtcaaagcccagagaagaggaaccaagaacctgccagatgcttgtgaattcacctgttgcttcccctgggactgaaggcagaagtgactcccgaaattctctttctggactcagaaggaaaccaaagcaattgatgacaccgcatcccatactaaaagctatggaagagagagcaattcaacgagctgaatgtaggcggatcttggcagagaagaagaaaaaacaagaagaagaaaaattggcccagttaaaggcccaagaggaggaacgtcagaaaagggaggcagaagaaaaggaggcacagcttgaaagaaaacgagaagagaagagactgaagaaaatgaaagaacttgagaagcagaagagaattaagaggaaccagcagctggaagcaatagccaaagaacattatgaaagggtcttgctaaggaaaaaaggtctagagccttggaagagattgagaatgcaaagcaaacaaaacatccaggtggcagaagaacattactctttgttcctgcagaggaaatacatgctgacgtggttccagcgtagtcaggaaagtctggctagaaagatggcccaggctgatcaattttattcccaaatactgcttaagagagtcatccagagctggctacagtacgtgattgatctgcaggaagaagtaagaaaattttgtgtacattttcttcaaaagaagattttcagggcctggtttaacatggtcagggaggtgaagatcgattctcagggcaagcatgagattgcagcggagcacagtgacaggaggatcctctggatcacccttcggacatggaagaagtttgtaaaatttatgaaagaggaaagagtaaaagaagaaaggcgacagcaacttcgtaggaaggtagttgaaattcttccagacttccaggtacctggaaggtaccacgagctatatcagcaatcagatacttggtccttgagtaagacaagtctggtgaacgaatgagccagattagtgtaatatttaggacaggaagctcgactagtctgtatgtgtgttatctccacccacccacacacatacatacatacacctggtttattctctacgagctacttcttagatcaaaggaattattttgagaatttttattcccttctttgacttttcctggattgctagtcattcactatagcatttatcacagtgggatcatccaaaggaacattctagagatcgtctgttcaaatatatcctatatatttttagcatagtaaactttaaaaaggacaagtgtttgcctgactgagcctgtgaagaaaatgtgtccgtatagcacgacaggagttgctgatgtgaccttaatgaaacagaaataaacaggggtgagtgctcggaaaggaagggcgggccaaggcactcagccttctagtgcagtagcatcagtgacacgcaccccaccagacctcgtccactttcaccacccctgaaggcagaccatgtatgaaaaggttctctacacagctgctgcagaggacagcagcttatcctgatttcagagaaactgaggcaccagagatgcttctcttccgtgcaccttgataagcatgaaggacattccaaaaggtaataactctatcatgacagtccagcaattcattaaattatctgttcatgctcccacctgcaactgctgaataatacactcagtttgtcttctagtactcagctcagtttgatctagatattgagatacctatcttgaattcaaagaatgttttcatctttaagatgctataaagactgataaaatgctctcttctatgaattgtgttagagaattacctgctagaaaaataatttttcattataaaatacacatttattatataacaaattcaagtagtccataaatgcatatggtaaaatgagaaagtcctgtgcagtcctgagatgattactcttatttggtgtgctgaaaatttgagttgacaaaataaaattctgtggttttttaagtgaaaaaaaaaaaaaaaaaaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]