GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2018-06-23 22:45:03, GGRNA.v2 : RefSeq release 88 (May, 2018)

LOCUS       NM_001329305            1765 bp    mRNA    linear   VRT 10-JUL-2016
DEFINITION  Ictalurus punctatus claudin 1 (cldn1), mRNA.
ACCESSION   NM_001329305 XM_017491765
VERSION     NM_001329305.1
KEYWORDS    RefSeq.
SOURCE      Ictalurus punctatus (channel catfish)
  ORGANISM  Ictalurus punctatus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Siluriformes;
            Ictaluridae; Ictalurus.
REFERENCE   1  (bases 1 to 1765)
  AUTHORS   Sun L, Liu S, Bao L, Li Y, Feng J and Liu Z.
  TITLE     Claudin multigene family in channel catfish and their expression
            profiles in response to bacterial infection and hypoxia as revealed
            by meta-analysis of RNA-Seq datasets
  JOURNAL   Comp. Biochem. Physiol. Part D Genomics Proteomics 13, 60-69 (2015)
   PUBMED   25681604
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from KM870803.1.
            On Jul 9, 2016 this sequence version replaced XM_017491765.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: KM870803.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00774075 [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..1765
                     /organism="Ictalurus punctatus"
                     /mol_type="mRNA"
                     /db_xref="taxon:7998"
                     /chromosome="17"
                     /map="17"
     gene            1..1765
                     /gene="cldn1"
                     /gene_synonym="Claudin-10; CLDN10; CLDN26"
                     /note="claudin 1"
                     /db_xref="GeneID:108278410"
     misc_feature    810..812
                     /gene="cldn1"
                     /gene_synonym="Claudin-10; CLDN10; CLDN26"
                     /note="upstream in-frame stop codon"
     CDS             882..1547
                     /gene="cldn1"
                     /gene_synonym="Claudin-10; CLDN10; CLDN26"
                     /note="claudin 26"
                     /codon_start=1
                     /product="claudin 1 precursor"
                     /protein_id="NP_001316234.1"
                     /db_xref="GeneID:108278410"
                     /translation="
MAEVMVEVMGVVLAILGWCLESSSTNSAVWRIHTNADSVMTSSSQYEGLWKSCASNNMGVQCVTHPTTLGLPAHVQACRALMIIALLLGLASILLSVLGLKCTKLGGMKETSKGRLTLTAGLMFILSGLCVLTAVSWYASRIVQEFNDPFYVGTKSELGTGLYLGWAAAVCVIMGGAMLCGSFKRARSPKPTDGYRYKSSANQQIYKTGTHLESSTSRAYV"
     sig_peptide     882..953
                     /gene="cldn1"
                     /gene_synonym="Claudin-10; CLDN10; CLDN26"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     misc_feature    918..1418
                     /gene="cldn1"
                     /gene_synonym="Claudin-10; CLDN10; CLDN26"
                     /note="PMP-22/EMP/MP20/Claudin family; Region:
                     PMP22_Claudin; cl21598"
                     /db_xref="CDD:304458"
ORIGIN      
attagaagttaaaagttaaggttggggattgatgttggggatttaggattagttttatgcattaggaattaggatttgagagttaaggtccggacggaaggtttaggagttaatgttgggaattaggttttaagattgaggattttaggggttactgttatgttagggattatgattttgggtttgggagctaacattggggattagcttttatgctttagaagttattgatttagattggggtattatggtttagaaattaggtattaacattgggagttatgatatatgatttaggagctgaggtcctgtattaggattgagggtttagacatttaggcaaggattaggatttgggttagggattaagattagggtttaggagaacatgatggggatttggacttaatgacataaagttggggactaggattcaagtgttaaaagttaaggtctggagttaatgctttagagtgtaggagtttagaaatgtttgggtgttggagtttaggatttaggacagggtttatcagtgttgaagagttagaggtggagattggggtttaggagttgtgttgggcttcatgaattagggtttaacagtaaagaaggctaaaaagtagggttctggagattggggatgttcgttttagatattatatttggtgtcaggagtttaggactttgtgtttgttgtgatgggctaatcttttccagcacacatctagccctcctgaacaaaatccactgccgttgtgtttagctgctctgttttgggggtcactgacccaaagccaatattaacacagtgacttacacgactcgagacagtgaggcagaaccgcacactgtttaacactcaggagactcacagagcagcgatggcggaggtaatggtggaggtgatgggcgtggtcctggccattctcggttggtgtttggagtcgagcagcacaaactcagcggtgtggcggatacacaccaatgccgactcagtgatgacgagcagctcacagtatgaaggcttgtggaagagctgcgcttccaacaacatgggggtgcagtgtgtgacacaccccacaacactggggctgcctgcccatgtgcaggcatgccgtgctctgatgatcatagccctgctgcttggactcgcctcgatcctcctctctgtcctggggctgaagtgcaccaaactgggcggcatgaaggagacgagtaaaggacgactcacactcaccgctggattgatgttcatactgtctggcttgtgtgtgctgacggctgtgtcgtggtacgcgtcgcgcatcgttcaggagttcaacgaccccttttacgtgggaacaaaatctgagctgggaactggtctgtatttgggttgggccgcggcggtgtgtgtgattatgggaggagccatgctgtgtggatcgttcaagagagcaagatcaccaaaacccacagatggttacaggtacaagtcgtcagccaatcagcagatctataaaacaggcactcacttggagagcagcacctccagagcgtacgtctgagcccagaaccctctacacacactggaaatgaaaattgtctataaaaatgtttctggcacatagcatgtgtgagtgtgtgtgttgtttgtggtgttaaacatgatgtctttgtgttgttattgtgaataaatgtttgcgaaattgcaggcttttgcctttatgaattaagatgtttttgttttgtgttgttgttgtttggggtttttgtttgtttgttt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]