GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 03:54:21, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NM_001322076            2179 bp    mRNA    linear   PRI 05-DEC-2018
DEFINITION  Homo sapiens zinc finger and SCAN domain containing 5A (ZSCAN5A),
            transcript variant 15, mRNA.
ACCESSION   NM_001322076
VERSION     NM_001322076.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2179)
  AUTHORS   Kimura K, Wakamatsu A, Suzuki Y, Ota T, Nishikawa T, Yamashita R,
            Yamamoto J, Sekine M, Tsuritani K, Wakaguri H, Ishii S, Sugiyama T,
            Saito K, Isono Y, Irie R, Kushida N, Yoneyama T, Otsuka R, Kanda K,
            Yokoi T, Kondo H, Wagatsuma M, Murakawa K, Ishida S, Ishibashi T,
            Takahashi-Fujii A, Tanase T, Nagai K, Kikuchi H, Nakai K, Isogai T
            and Sugano S.
  TITLE     Diversification of transcriptional modulation: large-scale
            identification and characterization of putative alternative
            promoters of human genes
  JOURNAL   Genome Res. 16 (1), 55-65 (2006)
   PUBMED   16344560
REFERENCE   2  (bases 1 to 2179)
  AUTHORS   Gerhard DS, Wagner L, Feingold EA, Shenmen CM, Grouse LH, Schuler
            G, Klein SL, Old S, Rasooly R, Good P, Guyer M, Peck AM, Derge JG,
            Lipman D, Collins FS, Jang W, Sherry S, Feolo M, Misquitta L, Lee
            E, Rotmistrovsky K, Greenhut SF, Schaefer CF, Buetow K, Bonner TI,
            Haussler D, Kent J, Kiekhaus M, Furey T, Brent M, Prange C,
            Schreiber K, Shapiro N, Bhat NK, Hopkins RF, Hsie F, Driscoll T,
            Soares MB, Casavant TL, Scheetz TE, Brown-stein MJ, Usdin TB,
            Toshiyuki S, Carninci P, Piao Y, Dudekula DB, Ko MS, Kawakami K,
            Suzuki Y, Sugano S, Gruber CE, Smith MR, Simmons B, Moore T,
            Waterman R, Johnson SL, Ruan Y, Wei CL, Mathavan S, Gunaratne PH,
            Wu J, Garcia AM, Hulyk SW, Fuh E, Yuan Y, Sneed A, Kowis C, Hodgson
            A, Muzny DM, McPherson J, Gibbs RA, Fahey J, Helton E, Ketteman M,
            Madan A, Rodrigues S, Sanchez A, Whiting M, Madari A, Young AC,
            Wetherby KD, Granite SJ, Kwong PN, Brinkley CP, Pearson RL,
            Bouffard GG, Blakesly RW, Green ED, Dickson MC, Rodriguez AC,
            Grimwood J, Schmutz J, Myers RM, Butterfield YS, Griffith M,
            Griffith OL, Krzywinski MI, Liao N, Morin R, Palmquist D, Petrescu
            AS, Skalska U, Smailus DE, Stott JM, Schnerch A, Schein JE, Jones
            SJ, Holt RA, Baross A, Marra MA, Clifton S, Makowski KA, Bosak S
            and Malek J.
  CONSRTM   MGC Project Team
  TITLE     The status, quality, and expansion of the NIH full-length cDNA
            project: the Mammalian Gene Collection (MGC)
  JOURNAL   Genome Res. 14 (10B), 2121-2127 (2004)
   PUBMED   15489334
  REMARK    Erratum:[Genome Res. 2006 Jun;16(6):804. Morrin, Ryan [corrected to
            Morin, Ryan]]
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC006116.1 and AC011506.3.
            
            Transcript Variant: This variant (15), along with variants 12-14,
            encodes isoform c.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR1803613.216363.1,
                                           SRR1660803.288862.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMEA2148093, SAMEA2158188
                                           [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-315               AC006116.1         38588-38902         c
            316-417             AC006116.1         37621-37722         c
            418-803             AC011506.3         42266-42651         c
            804-1007            AC011506.3         41234-41437         c
            1008-1158           AC011506.3         40194-40344         c
            1159-2179           AC011506.3         38906-39926         c
FEATURES             Location/Qualifiers
     source          1..2179
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="19"
                     /map="19q13.43"
     gene            1..2179
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="zinc finger and SCAN domain containing 5A"
                     /db_xref="GeneID:79149"
                     /db_xref="HGNC:HGNC:23710"
     exon            1..315
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436370726"
     variation       2
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1568744982"
     variation       6..7
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1165941836"
     variation       7
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1425713150"
     variation       8
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:926285036"
     variation       11..13
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1568744947"
     variation       14
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1361681884"
     variation       15
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1400116513"
     variation       17
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:980511780"
     variation       18
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:930381427"
     variation       19
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764155213"
     variation       20
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1055278314"
     variation       21
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756327855"
     variation       23..25
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1016268546"
     variation       24
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1210258104"
     variation       27
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1484390864"
     variation       28
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:987044286"
     variation       29
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752809911"
     variation       30
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1028311508"
     variation       39
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12973009"
     variation       43
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1257795290"
     variation       47
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:945816203"
     variation       51
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1484439682"
     variation       52
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1254686005"
     variation       59
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866198795"
     variation       60
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:912933595"
     variation       61
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1054220081"
     variation       65
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:935637530"
     variation       75
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1354342302"
     variation       79
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:921616583"
     variation       82
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:8107755"
     variation       83
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1276668648"
     variation       96..98
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="ata"
                     /db_xref="dbSNP:143531834"
     variation       100
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1568744657"
     variation       101
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184573688"
     variation       104
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1056803532"
     variation       105
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1456561897"
     variation       107
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1398080251"
     variation       112
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:867109867"
     variation       113
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1239163029"
     variation       114
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454274612"
     variation       116
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1189953392"
     variation       118
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:911724599"
     variation       126
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1415707144"
     variation       143
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:983648942"
     variation       147..148
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="aa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1176104502"
     variation       150
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:950588279"
     variation       151
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1568744560"
     variation       153
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1376686527"
     variation       157
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1302099370"
     variation       161..164
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="tt"
                     /replace="tttt"
                     /db_xref="dbSNP:1377352545"
     variation       161
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:904884692"
     variation       164
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1044702978"
     variation       165
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1276416803"
     variation       166
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:77962822"
     variation       174
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:973530125"
     variation       181..184
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="ct"
                     /replace="ctct"
                     /db_xref="dbSNP:1219894570"
     variation       182
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:537028616"
     variation       183
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:959348949"
     variation       184..189
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="tttt"
                     /replace="tttttt"
                     /db_xref="dbSNP:1156241584"
     variation       186
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277585142"
     variation       188
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1316360268"
     variation       190
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1259156003"
     variation       191
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456249471"
     variation       193
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:920348401"
     variation       195
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1033671411"
     variation       196
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577696022"
     variation       199
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1003744000"
     variation       208
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1191279504"
     variation       209
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:774409835"
     variation       210
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908688370"
     variation       217..219
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1321265387"
     variation       218
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:192640844"
     variation       219
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1021168192"
     variation       225
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:955638081"
     variation       226
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1486452970"
     variation       231
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1028363898"
     variation       233
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1010117865"
     variation       234
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1250460480"
     variation       236
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1338481589"
     variation       237
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:8104516"
     variation       241
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:968003817"
     variation       246
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1206828965"
     variation       251
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1292394272"
     variation       258
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1452752678"
     variation       260..265
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="tg"
                     /replace="tgtttg"
                     /db_xref="dbSNP:1216513711"
     variation       278
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1261882645"
     variation       284
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1487007528"
     variation       288
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770832546"
     variation       290
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762802046"
     variation       297
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1195148126"
     variation       312
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373320419"
     variation       314
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:893988714"
     variation       315
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1273958727"
     exon            316..417
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /inference="alignment:Splign:2.1.0"
     variation       316
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:894060388"
     variation       320
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1280543171"
     variation       329
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:549655200"
     variation       331
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:537463526"
     variation       335..340
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="ctct"
                     /replace="ctctct"
                     /db_xref="dbSNP:1279494527"
     variation       335
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1053081928"
     variation       336..346
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="tctctt"
                     /replace="tctcttctctt"
                     /db_xref="dbSNP:1219194721"
     variation       353
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34709084"
     variation       355
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149410489"
     variation       357
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1233972453"
     variation       358
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:927932605"
     variation       359
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1449944817"
     variation       360
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1361174474"
     variation       363
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1335074004"
     variation       365
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1409501624"
     variation       366
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1398245132"
     variation       377
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481238456"
     variation       388
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:528542040"
     variation       389
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1242758416"
     variation       390
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:566162679"
     variation       391
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1176676470"
     variation       395
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1568742796"
     variation       396
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:549625573"
     variation       398
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172849421"
     variation       400
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1478444016"
     variation       401
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766795772"
     variation       405
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186336270"
     variation       409
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763437142"
     variation       410
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237745021"
     misc_feature    411..413
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="upstream in-frame stop codon"
     variation       417
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1355050694"
     variation       417
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278199706"
     exon            418..803
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /inference="alignment:Splign:2.1.0"
     variation       418
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759416767"
     CDS             420..1907
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="isoform c is encoded by transcript variant 15; zinc
                     finger protein 495; zinc finger and SCAN domain containing
                     5; zinc finger and SCAN domain-containing protein 5A"
                     /codon_start=1
                     /product="zinc finger and SCAN domain-containing protein
                     5A isoform c"
                     /protein_id="NP_001309005.1"
                     /db_xref="CCDS:CCDS82403.1"
                     /db_xref="GeneID:79149"
                     /db_xref="HGNC:HGNC:23710"
                     /translation="
MAANCTSSWSLGESCNRPGLELPRSMASSETQLGNHDVDPEISHVNFRMFSCPKESDPIQALRKLTELCHLWLRPDLHTKEQILDMLVMEQFMISMPQELQVLVMMNGVQSCKDLEDLLRNNRRPKKWSVVTFHGKEYIVQDSDIEMAEAPSSVRDDLKDVSSQRASSVNQMRPGEGQAHRELQILPRVPALSRRQGEDFLLHKSIDVTGDPKSLRPKQTLEKDLKENREENPGLTSPEPQLPKSPNLVRAKEGKDPPKIASVENVDADTPSACVVEREASTHSGNRGDALNLSSPKRSKPDASSISQEEPQGEATPVGNRESPGQAGMNSIHSPGPASPVSHPDGQEAKALPPFACDVCEKRFTCNSKLVIHKRSHTGERLFQCNLCGKRFMQLISLQFHQRTHTGERPYTCDVCQKQFTQKSYLKCHKRSHTGEKPFECKDCKKVFTYRGSLKEHQRIHSGEKPYKCSKCPRAFSRLKLLRRHQKTHPEATSQ"
     misc_feature    537..791
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="SCAN oligomerization domain; Region: SCAN; cd07936"
                     /db_xref="CDD:153421"
     misc_feature    order(558..563,567..575,588..596,600..605,612..617,
                     624..629,633..644,654..659,666..671,678..686,690..695,
                     699..710,765..767,774..779,783..791)
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:153421"
     misc_feature    <1431..1892
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="FOG: Zn-finger [General function prediction only];
                     Region: COG5048"
                     /db_xref="CDD:227381"
     misc_feature    1488..1550
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn
                     finger"
                     /db_xref="CDD:275368"
     misc_feature    order(1488..1490,1497..1499,1536..1538,1548..1550)
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:275368"
     misc_feature    1527..1595
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="Zinc-finger double domain; Region: zf-H2C2_2;
                     pfam13465"
                     /db_xref="CDD:290200"
     misc_feature    1572..1634
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn
                     finger"
                     /db_xref="CDD:275368"
     misc_feature    order(1572..1574,1581..1583,1620..1622,1632..1634)
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:275368"
     misc_feature    1608..1685
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="Zinc-finger double domain; Region: zf-H2C2_2;
                     pfam13465"
                     /db_xref="CDD:290200"
     misc_feature    1656..1718
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn
                     finger"
                     /db_xref="CDD:275368"
     misc_feature    order(1656..1658,1665..1667,1704..1706,1716..1718)
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:275368"
     misc_feature    order(1671..1673,1677..1679,1683..1685,1689..1694,
                     1701..1706,1713..1715,1755..1757,1761..1763,1773..1778,
                     1785..1790,1797..1799,1839..1841,1845..1847,1851..1853,
                     1857..1862,1869..1874,1881..1883)
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="putative nucleic acid binding site [nucleotide
                     binding]; other site"
                     /db_xref="CDD:275368"
     misc_feature    1692..1769
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="Zinc-finger double domain; Region: zf-H2C2_2;
                     pfam13465"
                     /db_xref="CDD:290200"
     misc_feature    1740..1802
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn
                     finger"
                     /db_xref="CDD:275368"
     misc_feature    order(1740..1742,1749..1751,1788..1790,1800..1802)
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:275368"
     misc_feature    1776..1853
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="Zinc-finger double domain; Region: zf-H2C2_2;
                     pfam13465"
                     /db_xref="CDD:290200"
     misc_feature    1824..1886
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn
                     finger"
                     /db_xref="CDD:275368"
     misc_feature    order(1824..1826,1833..1835,1872..1874,1884..1886)
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:275368"
     variation       420
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:765269516"
     variation       425
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200884320"
     variation       427
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766094247"
     variation       431
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760459681"
     variation       432
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774614802"
     variation       433
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775624525"
     variation       434
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1363805885"
     variation       443
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373938329"
     variation       445
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1242687972"
     variation       447
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1015349106"
     variation       450
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368670022"
     variation       452
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363696128"
     variation       454
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142822213"
     variation       459
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775462486"
     variation       461
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1473788109"
     variation       462
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201140936"
     variation       463
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198240932"
     variation       467
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1330585976"
     variation       469
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1302156262"
     variation       470
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746372429"
     variation       471
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112550672"
     variation       475
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1268909867"
     variation       478
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781673650"
     variation       483
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771485540"
     variation       488
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1012832889"
     variation       489
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149425471"
     variation       490
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777612921"
     variation       491
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758159159"
     variation       494
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752348974"
     variation       495
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1223191449"
     variation       498
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778303494"
     variation       499
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:754446242"
     variation       500
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:753787290"
     variation       504
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766292035"
     variation       505
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1287660582"
     variation       508
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:755953393"
     variation       517
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1389854732"
     variation       524
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536245284"
     variation       527
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139035140"
     variation       528
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:543522736"
     variation       530
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777058512"
     variation       531
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:550648749"
     variation       532
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:531042856"
     variation       537
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:945144346"
     variation       539
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138415436"
     variation       544
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747763578"
     variation       547
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376633535"
     variation       551
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150105146"
     variation       552
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748809925"
     variation       557
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1258004722"
     variation       566
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200848409"
     variation       572
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140787974"
     variation       577
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756076357"
     variation       578
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750310913"
     variation       579
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201874615"
     variation       580
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:757008317"
     variation       581
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1413148211"
     variation       586
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150925266"
     variation       587
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765481925"
     variation       588
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:974056867"
     variation       591
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1461123353"
     variation       597
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867974029"
     variation       599
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759580162"
     variation       600
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776817209"
     variation       611
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766522832"
     variation       615
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761280855"
     variation       628
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436150555"
     variation       630
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773792328"
     variation       632
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1568609131"
     variation       644
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373202448"
     variation       645
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371935466"
     variation       653
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376204582"
     variation       655
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:982577386"
     variation       662
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367880708"
     variation       663
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1409286401"
     variation       664
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1395888384"
     variation       671
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773925891"
     variation       672
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768324013"
     variation       677
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:528793290"
     variation       684
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1392357412"
     variation       686
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1300974044"
     variation       689
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1342904429"
     variation       690
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1315010377"
     variation       702
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779562174"
     variation       703
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1302878387"
     variation       705
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755562475"
     variation       708
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1348062471"
     variation       711
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1203771251"
     variation       714
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745808092"
     variation       722
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1390530216"
     variation       728
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:781100410"
     variation       733
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201600248"
     variation       735
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200493184"
     variation       738
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779039539"
     variation       740
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755255762"
     variation       741
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143462624"
     variation       742
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374088582"
     variation       744
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141426263"
     variation       751
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1166742592"
     variation       755
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1003158548"
     variation       757
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1356824594"
     variation       761
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768047832"
     variation       770
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:762126209"
     variation       771
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1020466986"
     variation       777
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774809636"
     variation       778
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:73619433"
     variation       785
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762607068"
     variation       787
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1227165658"
     variation       790
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775056079"
     variation       796
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:769359428"
     variation       799
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1229403566"
     exon            804..1007
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /inference="alignment:Splign:2.1.0"
     variation       805
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773021892"
     variation       809
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1368883049"
     variation       810
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189644637"
     variation       811
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1325604605"
     variation       813
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144517223"
     variation       820
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479065619"
     variation       821
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147680558"
     variation       822
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188499793"
     variation       824
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1463923285"
     variation       827
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1270489245"
     variation       831
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780465273"
     variation       832
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1322451938"
     variation       840
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756436404"
     variation       841
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746040402"
     variation       843
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213445099"
     variation       849
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013394886"
     variation       853
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781344716"
     variation       854
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140466399"
     variation       855
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145011101"
     variation       856
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1367234162"
     variation       857
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758808063"
     variation       858
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1469122932"
     variation       864
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1205973207"
     variation       871
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759720886"
     variation       872
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759204689"
     variation       873
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1416325075"
     variation       874
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150002888"
     variation       876
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1168030056"
     variation       888
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139322292"
     variation       891
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760092983"
     variation       892
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1189715420"
     variation       895
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773253511"
     variation       897
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1236034703"
     variation       899
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111907569"
     variation       900
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368509037"
     variation       901
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746106028"
     variation       902
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763156569"
     variation       905
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781265590"
     variation       906
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199964698"
     variation       911
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747034599"
     variation       912
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201225377"
     variation       913
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200678839"
     variation       915
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1304354265"
     variation       918
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765594071"
     variation       919
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1286568737"
     variation       920
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:914983296"
     variation       921
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141990164"
     variation       922
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753586762"
     variation       923
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201727637"
     variation       925
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760274039"
     variation       926
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772630163"
     variation       930
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762366673"
     variation       933
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201825488"
     variation       935
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1183933184"
     variation       936
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768639394"
     variation       937
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375744187"
     variation       941
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199886337"
     variation       944
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1187948759"
     variation       945
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1202541382"
     variation       946..952
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="aaggcca"
                     /replace="aaggccaaggcca"
                     /db_xref="dbSNP:776494916"
     variation       948
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762640862"
     variation       951
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1274656497"
     variation       953..955
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="ggc"
                     /db_xref="dbSNP:1164786006"
     variation       955
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:776959267"
     variation       956
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367599578"
     variation       957
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1314655845"
     variation       958
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61736534"
     variation       960
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777848514"
     variation       961
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748724493"
     variation       965
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765368134"
     variation       968
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1414104798"
     variation       970
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779383095"
     variation       971
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1399688711"
     variation       976
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776925397"
     variation       977
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346525169"
     variation       979
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754123866"
     variation       980
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1348625983"
     variation       981
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780427415"
     variation       983
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1568606103"
     variation       986
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755747347"
     variation       987
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:991659846"
     variation       988
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568606072"
     variation       992
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4801692"
     variation       993
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143076677"
     variation       999
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1473360888"
     variation       1000
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1251988547"
     variation       1001
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1208693820"
     variation       1003
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1487490655"
     variation       1004
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1329028809"
     exon            1008..1158
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /inference="alignment:Splign:2.1.0"
     variation       1008
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752618641"
     variation       1010
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764941691"
     variation       1013
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770631493"
     variation       1017
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277082812"
     variation       1019
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773477056"
     variation       1020
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761986359"
     variation       1022
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:527674624"
     variation       1025
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1319020766"
     variation       1027
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138391803"
     variation       1033
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1456998392"
     variation       1037
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143209101"
     variation       1038
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381699289"
     variation       1040
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746211159"
     variation       1041
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149533881"
     variation       1042
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1422920448"
     variation       1043
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757000446"
     variation       1044
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002851045"
     variation       1047
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376620359"
     variation       1048
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777158698"
     variation       1050
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1190390490"
     variation       1054
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757855433"
     variation       1055
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:923976422"
     variation       1058
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:977963990"
     variation       1059
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:576450386"
     variation       1060
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1343129395"
     variation       1061
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1257876094"
     variation       1063
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:971073966"
     variation       1069
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765201989"
     variation       1075
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373606524"
     variation       1076
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1316444550"
     variation       1079
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1231169189"
     variation       1083
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754811958"
     variation       1088
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149479488"
     variation       1090
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:766115556"
     variation       1091
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:959240087"
     variation       1094
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457842727"
     variation       1095
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1313061260"
     variation       1097
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1428578747"
     variation       1099
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1387716387"
     variation       1101
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:546332373"
     variation       1109
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:577513858"
     variation       1110
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1367744432"
     variation       1112
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764148776"
     variation       1115
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568603953"
     variation       1118
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1440957615"
     variation       1119
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:573687081"
     variation       1120
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763074148"
     variation       1124
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775908186"
     variation       1125
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:770303549"
     variation       1126
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1006010126"
     variation       1127
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1463840782"
     variation       1129
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1173157535"
     variation       1137
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:950351225"
     variation       1140
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1026009423"
     variation       1143
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1464708925"
     variation       1145
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:997211124"
     variation       1147
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370671539"
     variation       1148
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777154770"
     variation       1151
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771360506"
     variation       1152
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746661136"
     variation       1157
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138065226"
     exon            1159..2179
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /inference="alignment:Splign:2.1.0"
     variation       1159
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759681374"
     variation       1161
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754451246"
     variation       1163
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1343686122"
     variation       1164
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200579325"
     variation       1166
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1568603105"
     variation       1167
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761049322"
     variation       1168
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1371614696"
     variation       1170
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1319753986"
     variation       1171
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773652552"
     variation       1172
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1043111296"
     variation       1175
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:267605713"
     variation       1178
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1432676836"
     variation       1181
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1449167317"
     variation       1185
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772271198"
     variation       1186
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376227013"
     variation       1187..1192
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="ccccc"
                     /replace="cccccc"
                     /db_xref="dbSNP:1568602903"
     variation       1187
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:75630877"
     variation       1188
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:943302585"
     variation       1189
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141071964"
     variation       1191
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1170863184"
     variation       1192..1193
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="ag"
                     /replace="ca"
                     /db_xref="dbSNP:386811187"
     variation       1192
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:531717987"
     variation       1193
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:562997139"
     variation       1194
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188440623"
     variation       1196
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:769752546"
     variation       1197
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1298190151"
     variation       1198
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371706721"
     variation       1204
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1216130869"
     variation       1205
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781053046"
     variation       1206
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756931660"
     variation       1207
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753025630"
     variation       1209
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746812478"
     variation       1211
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1347924314"
     variation       1214
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1256436567"
     variation       1219
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779261455"
     variation       1228
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199734240"
     variation       1230
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369979986"
     variation       1231..1235
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="ct"
                     /replace="cttct"
                     /db_xref="dbSNP:781592643"
     variation       1233
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1367170573"
     variation       1234
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754005392"
     variation       1236
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766521204"
     variation       1238
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756662052"
     variation       1239
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750830064"
     variation       1240
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767992521"
     variation       1241
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1436693020"
     variation       1242
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762073087"
     variation       1248
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774040814"
     variation       1251
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763703447"
     variation       1253
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762551023"
     variation       1261
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146091512"
     variation       1262
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758759166"
     variation       1266
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745819251"
     variation       1268
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1212496803"
     variation       1271
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376507043"
     variation       1272
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770814502"
     variation       1276
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142298937"
     variation       1284
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373460555"
     variation       1286
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150978724"
     variation       1287
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142635871"
     variation       1289
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376644398"
     variation       1294
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541954467"
     variation       1296
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780289351"
     variation       1299
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1399171539"
     variation       1301
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:540546268"
     variation       1302
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369166936"
     variation       1306
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757681849"
     variation       1307
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:554150542"
     variation       1308
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1320023602"
     variation       1313
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:751950329"
     variation       1314
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423606016"
     variation       1318
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764392490"
     variation       1321
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762607046"
     variation       1322
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775056297"
     variation       1324
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:764864405"
     variation       1325
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145786370"
     variation       1328
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1031165831"
     variation       1329
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:150193964"
     variation       1333
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770740273"
     variation       1340
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746897980"
     variation       1344
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773158381"
     variation       1348
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:575289949"
     variation       1349
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780127351"
     variation       1351
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:957040506"
     variation       1356
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756269092"
     variation       1357
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745906838"
     variation       1359
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781291200"
     variation       1360
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757726095"
     variation       1365
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752005370"
     variation       1366
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:889057869"
     variation       1369
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375144691"
     variation       1371
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457835463"
     variation       1376
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1419087095"
     variation       1377
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1348572050"
     variation       1378
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112797581"
     variation       1382
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:140003734"
     variation       1385
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1461687779"
     variation       1387
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274868780"
     variation       1390
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146066402"
     variation       1391
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142326109"
     variation       1393
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764771843"
     variation       1396
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1302516361"
     variation       1398
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759123388"
     variation       1402
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1230111602"
     variation       1406
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1315890203"
     variation       1408
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1190599831"
     variation       1409
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:566696787"
     variation       1410
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1353068534"
     variation       1413
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1254701329"
     variation       1414
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1214068737"
     variation       1415
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1328165333"
     variation       1416
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765860208"
     variation       1420
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1447964428"
     variation       1422
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760696171"
     variation       1423
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372118564"
     variation       1424
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:773281724"
     variation       1425
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772051310"
     variation       1426
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:34187696"
     variation       1427
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150874997"
     variation       1429
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781144172"
     variation       1432..1433
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="ag"
                     /db_xref="dbSNP:1409321067"
     variation       1432
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770929966"
     variation       1433
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388275865"
     variation       1434
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369515811"
     variation       1435
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:917909045"
     variation       1436..1438
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="ccc"
                     /db_xref="dbSNP:1568601473"
     variation       1437
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1410021145"
     variation       1439
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778235623"
     variation       1440..1445
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="gtcagt"
                     /db_xref="dbSNP:1396834795"
     variation       1440
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1174707253"
     variation       1442
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758807941"
     variation       1448..1450
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1349591254"
     variation       1448
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200236800"
     variation       1449
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754602114"
     variation       1450..1451
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="ca"
                     /db_xref="dbSNP:1568601351"
     variation       1450
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141546124"
     variation       1451
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765875730"
     variation       1452..1453
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="ga"
                     /db_xref="dbSNP:1568601299"
     variation       1452
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:929236830"
     variation       1453
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:897634015"
     variation       1454
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1040182401"
     variation       1460
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376538628"
     variation       1461
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201043563"
     variation       1465
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:910267008"
     variation       1466
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:767531928"
     variation       1467
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306271519"
     variation       1470
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201814043"
     variation       1471
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774035887"
     variation       1472
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:531722937"
     variation       1473
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759680447"
     variation       1477
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61736533"
     variation       1480
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771052526"
     variation       1481
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:552619938"
     variation       1493
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144472423"
     variation       1494
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368749222"
     variation       1499
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:181999776"
     variation       1500
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748955875"
     variation       1502
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1029947326"
     variation       1505
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1428847488"
     variation       1511
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779831050"
     variation       1513
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1200016620"
     variation       1514
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755725806"
     variation       1516
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1282542978"
     variation       1522
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:267605712"
     variation       1527
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749986484"
     variation       1529
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769527556"
     variation       1531
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268836925"
     variation       1533
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1230100724"
     variation       1540
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764198709"
     variation       1544
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373715695"
     variation       1547
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:556354363"
     variation       1549
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002322602"
     variation       1551
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1412527430"
     variation       1553
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757272050"
     variation       1556
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:540386597"
     variation       1557
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1309243403"
     variation       1557
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142761513"
     variation       1562
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138632150"
     variation       1563
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:887596912"
     variation       1564
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766554094"
     variation       1566..1568
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:757629283"
     variation       1567
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198134919"
     variation       1568
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1244857477"
     variation       1569
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760843837"
     variation       1570
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1462311947"
     variation       1571
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773300751"
     variation       1576
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1199796859"
     variation       1580
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748673755"
     variation       1582
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774911834"
     variation       1583
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768951640"
     variation       1587
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1040699984"
     variation       1589
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1397352549"
     variation       1590
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141778812"
     variation       1591
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767840197"
     variation       1596
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1271541908"
     variation       1597
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:780526729"
     variation       1598
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1159063289"
     variation       1602
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755854941"
     variation       1603
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1405947331"
     variation       1604
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278029108"
     variation       1605
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1338892198"
     variation       1607
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1216451336"
     variation       1608
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1271546678"
     variation       1611
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371435309"
     variation       1613
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1208689694"
     variation       1615
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780851722"
     variation       1616
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756785643"
     variation       1621
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751509325"
     variation       1623
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:935777084"
     variation       1625
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:935576464"
     variation       1627
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1333412548"
     variation       1631
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202185472"
     variation       1635
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762646155"
     variation       1638
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1391880425"
     variation       1640
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752565451"
     variation       1647
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:979644056"
     variation       1650
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:764960786"
     variation       1653
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1420320327"
     variation       1654
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760894715"
     variation       1655
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543909314"
     variation       1660
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:767645679"
     variation       1661
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761935616"
     variation       1662
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151298410"
     variation       1669
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1312356736"
     variation       1673
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769241349"
     variation       1674
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1212239028"
     variation       1686
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749713033"
     variation       1694
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776012886"
     variation       1695
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:879111754"
     variation       1696
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1360973466"
     variation       1697
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770214112"
     variation       1700
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:926806437"
     variation       1703
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:986319839"
     variation       1705
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1347992536"
     variation       1706
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745578928"
     variation       1719
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:953131591"
     variation       1722
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760512080"
     variation       1723
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1206634336"
     variation       1724
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1262710280"
     variation       1736
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780974355"
     variation       1737
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373832268"
     variation       1739
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1207958029"
     variation       1744
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1245081507"
     variation       1746
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746496094"
     variation       1752
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777107193"
     variation       1753
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1378959092"
     variation       1754
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758381341"
     variation       1757
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752570364"
     variation       1769
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1400337385"
     variation       1771
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:997107282"
     variation       1772
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778748709"
     variation       1773..1777
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="gggag"
                     /db_xref="dbSNP:1311715337"
     variation       1774
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1401934021"
     variation       1775
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1470525817"
     variation       1778..1779
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="aaat"
                     /db_xref="dbSNP:1302215050"
     variation       1778
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754756520"
     variation       1779
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750694178"
     variation       1784
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1165279042"
     variation       1794
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1027751672"
     variation       1795
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767752949"
     variation       1796
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761905483"
     variation       1797
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:751685333"
     variation       1798
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370816406"
     variation       1805
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202145068"
     variation       1806
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770336761"
     variation       1807
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759953639"
     variation       1809
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776463840"
     variation       1814
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375794609"
     variation       1817
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746592895"
     variation       1818
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142259207"
     variation       1819
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1261161283"
     variation       1820
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771480317"
     variation       1822
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748143740"
     variation       1826
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1401366145"
     variation       1828
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778801688"
     variation       1832
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200882365"
     variation       1834
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1172385623"
     variation       1835
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754807953"
     variation       1836
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753667989"
     variation       1837
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779668524"
     variation       1848
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757517666"
     variation       1849
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1243518159"
     variation       1851
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751669053"
     variation       1853
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1441346322"
     variation       1855
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1387807684"
     variation       1856
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1277553411"
     variation       1868
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1568599422"
     variation       1869
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764297887"
     variation       1870
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763109321"
     variation       1871
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296720189"
     variation       1873
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1212621175"
     variation       1875
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1363734969"
     variation       1876
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1272163921"
     variation       1878
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1290075656"
     variation       1882
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1431740131"
     variation       1883
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753302376"
     variation       1888
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765803270"
     variation       1892
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1437172257"
     variation       1893
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1421460298"
     variation       1895
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138110009"
     variation       1896
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777075627"
     variation       1897
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199652968"
     variation       1901
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:772728170"
     variation       1902
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1186801962"
     variation       1904
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150349355"
     variation       1906
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747626844"
     variation       1912
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773810597"
     variation       1913
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1485690494"
     variation       1917
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761391841"
     variation       1918
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202216893"
     variation       1919
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371193579"
     variation       1920
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747310164"
     variation       1923
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777832426"
     variation       1924
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758587498"
     variation       1926
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752854954"
     variation       1927
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:377759902"
     variation       1928
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755554696"
     variation       1929
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1298118040"
     variation       1938..1946
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="aagaag"
                     /replace="aagaagaag"
                     /db_xref="dbSNP:781680429"
     variation       1939
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1056705456"
     variation       1940
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:939621457"
     variation       1945
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1249762511"
     variation       1946
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1481642813"
     variation       1950..1954
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="at"
                     /replace="atgat"
                     /db_xref="dbSNP:980905918"
     variation       1951
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754229834"
     variation       1952
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:536449963"
     variation       1953
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:777505765"
     variation       1953
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:368375280"
     variation       1955
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201961052"
     variation       1960
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:930804885"
     variation       1962
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142383251"
     variation       1963
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1388069954"
     variation       1966
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148798821"
     variation       1969
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1324294064"
     variation       1972
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1407225420"
     variation       1979
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1411933834"
     variation       1981
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298706929"
     variation       1986..1990
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="acaca"
                     /db_xref="dbSNP:1402883729"
     variation       1989
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1389838551"
     variation       1992
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1285025769"
     variation       1993
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1472518727"
     variation       1997
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1218298858"
     variation       1998
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367602756"
     variation       1999
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1019389882"
     variation       2000
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:535253175"
     variation       2002
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1265375719"
     variation       2011..2014
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="agag"
                     /db_xref="dbSNP:1270100402"
     variation       2012
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:987509992"
     variation       2014
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181267764"
     variation       2018
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867605732"
     variation       2024
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1186672715"
     variation       2026
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1488154797"
     variation       2034
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1185595889"
     variation       2036
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:62122488"
     variation       2037
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376608225"
     variation       2038
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:553702469"
     variation       2041
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1170460175"
     variation       2042
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1012057459"
     variation       2043
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:189379942"
     variation       2046
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1056585723"
     variation       2057
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184916518"
     variation       2060
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780033261"
     variation       2064
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1399112918"
     variation       2066
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1245662819"
     variation       2068
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1364269273"
     variation       2069
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1312182106"
     variation       2079
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:902547969"
     variation       2080
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1248862278"
     variation       2087
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192216899"
     variation       2095
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1293076219"
     variation       2097
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:113647041"
     variation       2098
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:946963745"
     variation       2100
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:544866397"
     variation       2101..2110
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="t"
                     /replace="ttgttttctt"
                     /db_xref="dbSNP:905409701"
     variation       2109
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:937035338"
     variation       2112
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1050362839"
     variation       2114
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1365102143"
     variation       2115
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1275466462"
     variation       2116..2118
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1438725359"
     variation       2120
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1348341080"
     variation       2128
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771969606"
     variation       2129
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77400154"
     variation       2138
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:930794695"
     variation       2140
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:920794931"
     variation       2146
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:972157870"
     variation       2148
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1156599428"
     variation       2151
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:975836451"
     variation       2152
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539826176"
     variation       2156
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1166500398"
     variation       2161
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907534199"
     variation       2162
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139078993"
     variation       2171
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:952068215"
     variation       2173
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1028864763"
     variation       2175
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376733066"
     variation       2176
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1023528590"
     variation       2177
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1286868075"
ORIGIN      
ggagattcgtgggaggaccgagcccggggatgggactggaggagtttccgtgaccttgcgggctgtttgtgctgagggacagctttatttaaataataatatgcgtgcaggcgccctgcatgattcctggccgcgtgctttctagtaagtgcgcagagacttttcgcaagaattgattcactcttttttccttccctcccgatttttgattggaaacccagacttcctttcacgcctgtcgccaggttaactaggtcactgtttgctctcaggagcaaccctgcctcccgcagttcgcttggtccttgattacaggggaggttccctgctcaagctctcttctcttgtctgctgccatgtgagacgtgcctttgaccttctgccatgattgtgaggcctccccagccacgtgaaactatatggctgcaaattgcacatcctcatggagtctaggagaatcctgcaacagacctgggttggagctgccacggtctatggcatcctcagaaactcaacttggaaatcacgacgtggaccctgagatttctcacgtgaacttcaggatgttcagctgcccgaaggagtcggaccccatccaggctctgaggaaactcactgagctgtgccatctgtggctgaggcccgacctccacaccaaagagcagatcctggacatgctggtgatggagcagttcatgatctccatgccccaggagctccaggtcttagtcatgatgaacggtgtgcagagctgcaaagacctggaggacctgctacgaaataacagaagacccaagaaatggtctgtggtcaccttccacggaaaggaatatattgtgcaggactcagatatcgagatggctgaagccccctccagtgtcagagatgatctgaaagacgtgtccagccaacgggcctcctcggtgaaccagatgcgtccaggggaaggccaggcccaccgagagctgcagatcctgcccagggtccctgcattgtccaggaggcagggagaggactttctgctacacaagagtattgacgtaacaggtgacccaaagtctctgagacccaagcagaccttggagaaggatctgaaggaaaacagggaagagaacccaggactgacatccccagagcctcagcttccaaagagtcccaatctggtgagagcaaaggaggggaaggaccccccaaaaatagcctctgtggaaaatgtggatgctgacacaccttctgcctgcgttgtggagagagaagcttcgactcacagcgggaacagaggagacgctctgaatctgagcagtcccaaaagaagcaaaccagatgcctcctccatttcccaagaagagcctcaaggagaagccacacctgtgggcaacagagaatccccgggacaagctgggatgaattcaattcattccccaggccctgcgagcccagtcagtcacccggatggccaagaagccaaggcactgccgccctttgcatgtgacgtgtgcgagaagaggtttacgtgtaattccaagctagtcatccacaagagatcacacacaggcgagagactctttcaatgtaatctctgtgggaagcgcttcatgcagcttattagcctccaatttcaccagcgaacccacactggcgagaggccctacacgtgtgacgtctgccagaagcagttcacccagaagtcctacttgaagtgtcacaagagaagccacacaggggagaagcccttcgaatgtaaagactgcaagaaagttttcacctacagggggagcctgaaggagcaccagcgcatccactccggagagaaaccctacaaatgttccaagtgtccaagagccttcagtcggctgaaattgttaagacgccaccagaaaacacatccagaagctacttctcagtgattgcataatccggtctatgccttctgcaccaagaagaagtgaatgatatttttcatcaatgttatcagatgacatttgacacatgcaagggcgtctgacacacagagggagtgccctagatatgaattgccaggatgtttgagtaaatatgtgtcctccccactgagctttgttttctgtttcattatgtccattgttttcttataggtttattttggtttgtgttgctgttcttccaataaacgatcatcttattagttttcaatattgta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]