GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:38:29, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NM_001322075            2304 bp    mRNA    linear   PRI 05-DEC-2018
DEFINITION  Homo sapiens zinc finger and SCAN domain containing 5A (ZSCAN5A),
            transcript variant 14, mRNA.
ACCESSION   NM_001322075
VERSION     NM_001322075.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2304)
  AUTHORS   Kimura K, Wakamatsu A, Suzuki Y, Ota T, Nishikawa T, Yamashita R,
            Yamamoto J, Sekine M, Tsuritani K, Wakaguri H, Ishii S, Sugiyama T,
            Saito K, Isono Y, Irie R, Kushida N, Yoneyama T, Otsuka R, Kanda K,
            Yokoi T, Kondo H, Wagatsuma M, Murakawa K, Ishida S, Ishibashi T,
            Takahashi-Fujii A, Tanase T, Nagai K, Kikuchi H, Nakai K, Isogai T
            and Sugano S.
  TITLE     Diversification of transcriptional modulation: large-scale
            identification and characterization of putative alternative
            promoters of human genes
  JOURNAL   Genome Res. 16 (1), 55-65 (2006)
   PUBMED   16344560
REFERENCE   2  (bases 1 to 2304)
  AUTHORS   Gerhard DS, Wagner L, Feingold EA, Shenmen CM, Grouse LH, Schuler
            G, Klein SL, Old S, Rasooly R, Good P, Guyer M, Peck AM, Derge JG,
            Lipman D, Collins FS, Jang W, Sherry S, Feolo M, Misquitta L, Lee
            E, Rotmistrovsky K, Greenhut SF, Schaefer CF, Buetow K, Bonner TI,
            Haussler D, Kent J, Kiekhaus M, Furey T, Brent M, Prange C,
            Schreiber K, Shapiro N, Bhat NK, Hopkins RF, Hsie F, Driscoll T,
            Soares MB, Casavant TL, Scheetz TE, Brown-stein MJ, Usdin TB,
            Toshiyuki S, Carninci P, Piao Y, Dudekula DB, Ko MS, Kawakami K,
            Suzuki Y, Sugano S, Gruber CE, Smith MR, Simmons B, Moore T,
            Waterman R, Johnson SL, Ruan Y, Wei CL, Mathavan S, Gunaratne PH,
            Wu J, Garcia AM, Hulyk SW, Fuh E, Yuan Y, Sneed A, Kowis C, Hodgson
            A, Muzny DM, McPherson J, Gibbs RA, Fahey J, Helton E, Ketteman M,
            Madan A, Rodrigues S, Sanchez A, Whiting M, Madari A, Young AC,
            Wetherby KD, Granite SJ, Kwong PN, Brinkley CP, Pearson RL,
            Bouffard GG, Blakesly RW, Green ED, Dickson MC, Rodriguez AC,
            Grimwood J, Schmutz J, Myers RM, Butterfield YS, Griffith M,
            Griffith OL, Krzywinski MI, Liao N, Morin R, Palmquist D, Petrescu
            AS, Skalska U, Smailus DE, Stott JM, Schnerch A, Schein JE, Jones
            SJ, Holt RA, Baross A, Marra MA, Clifton S, Makowski KA, Bosak S
            and Malek J.
  CONSRTM   MGC Project Team
  TITLE     The status, quality, and expansion of the NIH full-length cDNA
            project: the Mammalian Gene Collection (MGC)
  JOURNAL   Genome Res. 14 (10B), 2121-2127 (2004)
   PUBMED   15489334
  REMARK    Erratum:[Genome Res. 2006 Jun;16(6):804. Morrin, Ryan [corrected to
            Morin, Ryan]]
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC006116.1 and AC011506.3.
            
            Transcript Variant: This variant (14), along with variants 12-13
            and 15, encodes isoform c.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR1803617.900.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMEA2148093, SAMEA2158188
                                           [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-315               AC006116.1         38588-38902         c
            316-417             AC006116.1         37621-37722         c
            418-928             AC011506.3         42266-42776         c
            929-1132            AC011506.3         41234-41437         c
            1133-1283           AC011506.3         40194-40344         c
            1284-2304           AC011506.3         38906-39926         c
FEATURES             Location/Qualifiers
     source          1..2304
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="19"
                     /map="19q13.43"
     gene            1..2304
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="zinc finger and SCAN domain containing 5A"
                     /db_xref="GeneID:79149"
                     /db_xref="HGNC:HGNC:23710"
     exon            1..315
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436370726"
     variation       2
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1568744982"
     variation       6..7
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1165941836"
     variation       7
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1425713150"
     variation       8
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:926285036"
     variation       11..13
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1568744947"
     variation       14
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1361681884"
     variation       15
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1400116513"
     variation       17
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:980511780"
     variation       18
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:930381427"
     variation       19
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764155213"
     variation       20
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1055278314"
     variation       21
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756327855"
     variation       23..25
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1016268546"
     variation       24
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1210258104"
     variation       27
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1484390864"
     variation       28
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:987044286"
     variation       29
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752809911"
     variation       30
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1028311508"
     variation       39
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12973009"
     variation       43
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1257795290"
     variation       47
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:945816203"
     variation       51
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1484439682"
     variation       52
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1254686005"
     variation       59
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866198795"
     variation       60
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:912933595"
     variation       61
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1054220081"
     variation       65
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:935637530"
     variation       75
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1354342302"
     variation       79
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:921616583"
     variation       82
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:8107755"
     variation       83
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1276668648"
     variation       96..98
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="ata"
                     /db_xref="dbSNP:143531834"
     variation       100
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1568744657"
     variation       101
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184573688"
     variation       104
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1056803532"
     variation       105
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1456561897"
     variation       107
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1398080251"
     variation       112
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:867109867"
     variation       113
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1239163029"
     variation       114
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454274612"
     variation       116
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1189953392"
     variation       118
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:911724599"
     variation       126
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1415707144"
     variation       143
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:983648942"
     variation       147..148
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="aa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1176104502"
     variation       150
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:950588279"
     variation       151
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1568744560"
     variation       153
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1376686527"
     variation       157
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1302099370"
     variation       161..164
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="tt"
                     /replace="tttt"
                     /db_xref="dbSNP:1377352545"
     variation       161
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:904884692"
     variation       164
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1044702978"
     variation       165
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1276416803"
     variation       166
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:77962822"
     variation       174
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:973530125"
     variation       181..184
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="ct"
                     /replace="ctct"
                     /db_xref="dbSNP:1219894570"
     variation       182
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:537028616"
     variation       183
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:959348949"
     variation       184..189
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="tttt"
                     /replace="tttttt"
                     /db_xref="dbSNP:1156241584"
     variation       186
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277585142"
     variation       188
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1316360268"
     variation       190
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1259156003"
     variation       191
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456249471"
     variation       193
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:920348401"
     variation       195
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1033671411"
     variation       196
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577696022"
     variation       199
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1003744000"
     variation       208
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1191279504"
     variation       209
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:774409835"
     variation       210
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908688370"
     variation       217..219
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1321265387"
     variation       218
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:192640844"
     variation       219
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1021168192"
     variation       225
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:955638081"
     variation       226
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1486452970"
     variation       231
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1028363898"
     variation       233
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1010117865"
     variation       234
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1250460480"
     variation       236
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1338481589"
     variation       237
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:8104516"
     variation       241
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:968003817"
     variation       246
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1206828965"
     variation       251
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1292394272"
     variation       258
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1452752678"
     variation       260..265
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="tg"
                     /replace="tgtttg"
                     /db_xref="dbSNP:1216513711"
     variation       278
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1261882645"
     variation       284
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1487007528"
     variation       288
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770832546"
     variation       290
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762802046"
     variation       297
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1195148126"
     variation       312
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373320419"
     variation       314
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:893988714"
     variation       315
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1273958727"
     exon            316..417
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /inference="alignment:Splign:2.1.0"
     variation       316
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:894060388"
     variation       320
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1280543171"
     variation       329
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:549655200"
     variation       331
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:537463526"
     variation       335..340
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="ctct"
                     /replace="ctctct"
                     /db_xref="dbSNP:1279494527"
     variation       335
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1053081928"
     variation       336..346
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="tctctt"
                     /replace="tctcttctctt"
                     /db_xref="dbSNP:1219194721"
     variation       353
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34709084"
     variation       355
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149410489"
     variation       357
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1233972453"
     variation       358
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:927932605"
     variation       359
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1449944817"
     variation       360
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1361174474"
     variation       363
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1335074004"
     variation       365
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1409501624"
     variation       366
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1398245132"
     variation       377
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481238456"
     variation       388
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:528542040"
     variation       389
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1242758416"
     variation       390
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:566162679"
     variation       391
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1176676470"
     variation       395
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1568742796"
     variation       396
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:549625573"
     variation       398
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172849421"
     variation       400
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1478444016"
     variation       401
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766795772"
     variation       405
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186336270"
     variation       409
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763437142"
     variation       410
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237745021"
     variation       417
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1355050694"
     variation       417
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278199706"
     exon            418..928
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /inference="alignment:Splign:2.1.0"
     variation       418
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:914942136"
     variation       431
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568610299"
     variation       433
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1259271509"
     variation       437
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1389160473"
     variation       439
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1427305263"
     variation       443
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:989143748"
     variation       444
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1397167785"
     variation       452
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1337555191"
     variation       454
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1321363037"
     variation       455
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:932234980"
     variation       459
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:900640741"
     variation       461
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1297194539"
     variation       470
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1340276887"
     variation       475
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1250946162"
     variation       477..478
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="gg"
                     /replace="ggctgg"
                     /db_xref="dbSNP:1043637202"
     variation       478
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1234327913"
     variation       480
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:557087803"
     variation       484
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:910831084"
     variation       490
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1292628554"
     variation       492
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1469239765"
     variation       493
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1440362092"
     variation       499
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768725998"
     variation       501
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199505732"
     variation       504
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373285653"
     variation       505
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1194704910"
     variation       507
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:577751579"
     variation       513
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1167542000"
     variation       517
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:557793195"
     misc_feature    521..523
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="upstream in-frame stop codon"
     variation       524
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757635740"
     variation       526
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751258534"
     variation       527
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777559748"
     variation       530
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:758036342"
     variation       534
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:752121591"
     variation       535
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764768627"
     variation       537
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1266638616"
     variation       538
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1245439478"
     variation       540
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:865819479"
     variation       541
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:970396316"
     variation       543
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759416767"
     CDS             545..2032
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="isoform c is encoded by transcript variant 14; zinc
                     finger protein 495; zinc finger and SCAN domain containing
                     5; zinc finger and SCAN domain-containing protein 5A"
                     /codon_start=1
                     /product="zinc finger and SCAN domain-containing protein
                     5A isoform c"
                     /protein_id="NP_001309004.1"
                     /db_xref="CCDS:CCDS82403.1"
                     /db_xref="GeneID:79149"
                     /db_xref="HGNC:HGNC:23710"
                     /translation="
MAANCTSSWSLGESCNRPGLELPRSMASSETQLGNHDVDPEISHVNFRMFSCPKESDPIQALRKLTELCHLWLRPDLHTKEQILDMLVMEQFMISMPQELQVLVMMNGVQSCKDLEDLLRNNRRPKKWSVVTFHGKEYIVQDSDIEMAEAPSSVRDDLKDVSSQRASSVNQMRPGEGQAHRELQILPRVPALSRRQGEDFLLHKSIDVTGDPKSLRPKQTLEKDLKENREENPGLTSPEPQLPKSPNLVRAKEGKDPPKIASVENVDADTPSACVVEREASTHSGNRGDALNLSSPKRSKPDASSISQEEPQGEATPVGNRESPGQAGMNSIHSPGPASPVSHPDGQEAKALPPFACDVCEKRFTCNSKLVIHKRSHTGERLFQCNLCGKRFMQLISLQFHQRTHTGERPYTCDVCQKQFTQKSYLKCHKRSHTGEKPFECKDCKKVFTYRGSLKEHQRIHSGEKPYKCSKCPRAFSRLKLLRRHQKTHPEATSQ"
     misc_feature    662..916
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="SCAN oligomerization domain; Region: SCAN; cd07936"
                     /db_xref="CDD:153421"
     misc_feature    order(683..688,692..700,713..721,725..730,737..742,
                     749..754,758..769,779..784,791..796,803..811,815..820,
                     824..835,890..892,899..904,908..916)
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:153421"
     misc_feature    <1556..2017
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="FOG: Zn-finger [General function prediction only];
                     Region: COG5048"
                     /db_xref="CDD:227381"
     misc_feature    1613..1675
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn
                     finger"
                     /db_xref="CDD:275368"
     misc_feature    order(1613..1615,1622..1624,1661..1663,1673..1675)
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:275368"
     misc_feature    1652..1720
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="Zinc-finger double domain; Region: zf-H2C2_2;
                     pfam13465"
                     /db_xref="CDD:290200"
     misc_feature    1697..1759
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn
                     finger"
                     /db_xref="CDD:275368"
     misc_feature    order(1697..1699,1706..1708,1745..1747,1757..1759)
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:275368"
     misc_feature    1733..1810
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="Zinc-finger double domain; Region: zf-H2C2_2;
                     pfam13465"
                     /db_xref="CDD:290200"
     misc_feature    1781..1843
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn
                     finger"
                     /db_xref="CDD:275368"
     misc_feature    order(1781..1783,1790..1792,1829..1831,1841..1843)
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:275368"
     misc_feature    order(1796..1798,1802..1804,1808..1810,1814..1819,
                     1826..1831,1838..1840,1880..1882,1886..1888,1898..1903,
                     1910..1915,1922..1924,1964..1966,1970..1972,1976..1978,
                     1982..1987,1994..1999,2006..2008)
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="putative nucleic acid binding site [nucleotide
                     binding]; other site"
                     /db_xref="CDD:275368"
     misc_feature    1817..1894
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="Zinc-finger double domain; Region: zf-H2C2_2;
                     pfam13465"
                     /db_xref="CDD:290200"
     misc_feature    1865..1927
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn
                     finger"
                     /db_xref="CDD:275368"
     misc_feature    order(1865..1867,1874..1876,1913..1915,1925..1927)
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:275368"
     misc_feature    1901..1978
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="Zinc-finger double domain; Region: zf-H2C2_2;
                     pfam13465"
                     /db_xref="CDD:290200"
     misc_feature    1949..2011
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn
                     finger"
                     /db_xref="CDD:275368"
     misc_feature    order(1949..1951,1958..1960,1997..1999,2009..2011)
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:275368"
     variation       545
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:765269516"
     variation       550
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200884320"
     variation       552
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766094247"
     variation       556
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760459681"
     variation       557
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774614802"
     variation       558
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775624525"
     variation       559
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1363805885"
     variation       568
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373938329"
     variation       570
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1242687972"
     variation       572
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1015349106"
     variation       575
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368670022"
     variation       577
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363696128"
     variation       579
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142822213"
     variation       584
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775462486"
     variation       586
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1473788109"
     variation       587
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201140936"
     variation       588
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198240932"
     variation       592
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1330585976"
     variation       594
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1302156262"
     variation       595
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746372429"
     variation       596
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112550672"
     variation       600
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1268909867"
     variation       603
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781673650"
     variation       608
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771485540"
     variation       613
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1012832889"
     variation       614
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149425471"
     variation       615
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777612921"
     variation       616
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758159159"
     variation       619
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752348974"
     variation       620
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1223191449"
     variation       623
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778303494"
     variation       624
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:754446242"
     variation       625
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:753787290"
     variation       629
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766292035"
     variation       630
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1287660582"
     variation       633
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:755953393"
     variation       642
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1389854732"
     variation       649
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536245284"
     variation       652
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139035140"
     variation       653
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:543522736"
     variation       655
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777058512"
     variation       656
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:550648749"
     variation       657
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:531042856"
     variation       662
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:945144346"
     variation       664
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138415436"
     variation       669
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747763578"
     variation       672
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376633535"
     variation       676
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150105146"
     variation       677
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748809925"
     variation       682
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1258004722"
     variation       691
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200848409"
     variation       697
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140787974"
     variation       702
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756076357"
     variation       703
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750310913"
     variation       704
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201874615"
     variation       705
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:757008317"
     variation       706
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1413148211"
     variation       711
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150925266"
     variation       712
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765481925"
     variation       713
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:974056867"
     variation       716
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1461123353"
     variation       722
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867974029"
     variation       724
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759580162"
     variation       725
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776817209"
     variation       736
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766522832"
     variation       740
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761280855"
     variation       753
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436150555"
     variation       755
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773792328"
     variation       757
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1568609131"
     variation       769
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373202448"
     variation       770
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371935466"
     variation       778
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376204582"
     variation       780
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:982577386"
     variation       787
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367880708"
     variation       788
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1409286401"
     variation       789
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1395888384"
     variation       796
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773925891"
     variation       797
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768324013"
     variation       802
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:528793290"
     variation       809
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1392357412"
     variation       811
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1300974044"
     variation       814
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1342904429"
     variation       815
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1315010377"
     variation       827
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779562174"
     variation       828
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1302878387"
     variation       830
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755562475"
     variation       833
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1348062471"
     variation       836
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1203771251"
     variation       839
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745808092"
     variation       847
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1390530216"
     variation       853
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:781100410"
     variation       858
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201600248"
     variation       860
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200493184"
     variation       863
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779039539"
     variation       865
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755255762"
     variation       866
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143462624"
     variation       867
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374088582"
     variation       869
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141426263"
     variation       876
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1166742592"
     variation       880
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1003158548"
     variation       882
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1356824594"
     variation       886
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768047832"
     variation       895
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:762126209"
     variation       896
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1020466986"
     variation       902
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774809636"
     variation       903
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:73619433"
     variation       910
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762607068"
     variation       912
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1227165658"
     variation       915
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775056079"
     variation       921
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:769359428"
     variation       924
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1229403566"
     exon            929..1132
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /inference="alignment:Splign:2.1.0"
     variation       930
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773021892"
     variation       934
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1368883049"
     variation       935
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189644637"
     variation       936
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1325604605"
     variation       938
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144517223"
     variation       945
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479065619"
     variation       946
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147680558"
     variation       947
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188499793"
     variation       949
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1463923285"
     variation       952
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1270489245"
     variation       956
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780465273"
     variation       957
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1322451938"
     variation       965
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756436404"
     variation       966
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746040402"
     variation       968
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213445099"
     variation       974
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013394886"
     variation       978
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781344716"
     variation       979
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140466399"
     variation       980
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145011101"
     variation       981
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1367234162"
     variation       982
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758808063"
     variation       983
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1469122932"
     variation       989
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1205973207"
     variation       996
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759720886"
     variation       997
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759204689"
     variation       998
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1416325075"
     variation       999
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150002888"
     variation       1001
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1168030056"
     variation       1013
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139322292"
     variation       1016
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760092983"
     variation       1017
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1189715420"
     variation       1020
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773253511"
     variation       1022
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1236034703"
     variation       1024
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111907569"
     variation       1025
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368509037"
     variation       1026
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746106028"
     variation       1027
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763156569"
     variation       1030
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781265590"
     variation       1031
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199964698"
     variation       1036
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747034599"
     variation       1037
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201225377"
     variation       1038
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200678839"
     variation       1040
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1304354265"
     variation       1043
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765594071"
     variation       1044
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1286568737"
     variation       1045
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:914983296"
     variation       1046
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141990164"
     variation       1047
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753586762"
     variation       1048
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201727637"
     variation       1050
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760274039"
     variation       1051
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772630163"
     variation       1055
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762366673"
     variation       1058
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201825488"
     variation       1060
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1183933184"
     variation       1061
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768639394"
     variation       1062
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375744187"
     variation       1066
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199886337"
     variation       1069
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1187948759"
     variation       1070
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1202541382"
     variation       1071..1077
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="aaggcca"
                     /replace="aaggccaaggcca"
                     /db_xref="dbSNP:776494916"
     variation       1073
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762640862"
     variation       1076
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1274656497"
     variation       1078..1080
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="ggc"
                     /db_xref="dbSNP:1164786006"
     variation       1080
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:776959267"
     variation       1081
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367599578"
     variation       1082
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1314655845"
     variation       1083
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61736534"
     variation       1085
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777848514"
     variation       1086
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748724493"
     variation       1090
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765368134"
     variation       1093
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1414104798"
     variation       1095
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779383095"
     variation       1096
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1399688711"
     variation       1101
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776925397"
     variation       1102
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346525169"
     variation       1104
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754123866"
     variation       1105
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1348625983"
     variation       1106
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780427415"
     variation       1108
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1568606103"
     variation       1111
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755747347"
     variation       1112
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:991659846"
     variation       1113
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568606072"
     variation       1117
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4801692"
     variation       1118
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143076677"
     variation       1124
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1473360888"
     variation       1125
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1251988547"
     variation       1126
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1208693820"
     variation       1128
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1487490655"
     variation       1129
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1329028809"
     exon            1133..1283
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /inference="alignment:Splign:2.1.0"
     variation       1133
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752618641"
     variation       1135
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764941691"
     variation       1138
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770631493"
     variation       1142
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277082812"
     variation       1144
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773477056"
     variation       1145
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761986359"
     variation       1147
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:527674624"
     variation       1150
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1319020766"
     variation       1152
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138391803"
     variation       1158
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1456998392"
     variation       1162
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143209101"
     variation       1163
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381699289"
     variation       1165
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746211159"
     variation       1166
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149533881"
     variation       1167
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1422920448"
     variation       1168
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757000446"
     variation       1169
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002851045"
     variation       1172
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376620359"
     variation       1173
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777158698"
     variation       1175
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1190390490"
     variation       1179
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757855433"
     variation       1180
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:923976422"
     variation       1183
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:977963990"
     variation       1184
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:576450386"
     variation       1185
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1343129395"
     variation       1186
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1257876094"
     variation       1188
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:971073966"
     variation       1194
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765201989"
     variation       1200
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373606524"
     variation       1201
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1316444550"
     variation       1204
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1231169189"
     variation       1208
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754811958"
     variation       1213
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149479488"
     variation       1215
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:766115556"
     variation       1216
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:959240087"
     variation       1219
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457842727"
     variation       1220
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1313061260"
     variation       1222
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1428578747"
     variation       1224
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1387716387"
     variation       1226
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:546332373"
     variation       1234
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:577513858"
     variation       1235
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1367744432"
     variation       1237
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764148776"
     variation       1240
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568603953"
     variation       1243
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1440957615"
     variation       1244
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:573687081"
     variation       1245
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763074148"
     variation       1249
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775908186"
     variation       1250
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:770303549"
     variation       1251
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1006010126"
     variation       1252
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1463840782"
     variation       1254
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1173157535"
     variation       1262
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:950351225"
     variation       1265
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1026009423"
     variation       1268
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1464708925"
     variation       1270
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:997211124"
     variation       1272
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370671539"
     variation       1273
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777154770"
     variation       1276
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771360506"
     variation       1277
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746661136"
     variation       1282
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138065226"
     exon            1284..2304
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /inference="alignment:Splign:2.1.0"
     variation       1284
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759681374"
     variation       1286
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754451246"
     variation       1288
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1343686122"
     variation       1289
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200579325"
     variation       1291
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1568603105"
     variation       1292
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761049322"
     variation       1293
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1371614696"
     variation       1295
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1319753986"
     variation       1296
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773652552"
     variation       1297
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1043111296"
     variation       1300
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:267605713"
     variation       1303
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1432676836"
     variation       1306
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1449167317"
     variation       1310
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772271198"
     variation       1311
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376227013"
     variation       1312..1317
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="ccccc"
                     /replace="cccccc"
                     /db_xref="dbSNP:1568602903"
     variation       1312
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:75630877"
     variation       1313
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:943302585"
     variation       1314
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141071964"
     variation       1316
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1170863184"
     variation       1317..1318
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="ag"
                     /replace="ca"
                     /db_xref="dbSNP:386811187"
     variation       1317
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:531717987"
     variation       1318
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:562997139"
     variation       1319
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188440623"
     variation       1321
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:769752546"
     variation       1322
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1298190151"
     variation       1323
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371706721"
     variation       1329
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1216130869"
     variation       1330
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781053046"
     variation       1331
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756931660"
     variation       1332
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753025630"
     variation       1334
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746812478"
     variation       1336
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1347924314"
     variation       1339
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1256436567"
     variation       1344
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779261455"
     variation       1353
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199734240"
     variation       1355
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369979986"
     variation       1356..1360
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="ct"
                     /replace="cttct"
                     /db_xref="dbSNP:781592643"
     variation       1358
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1367170573"
     variation       1359
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754005392"
     variation       1361
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766521204"
     variation       1363
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756662052"
     variation       1364
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750830064"
     variation       1365
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767992521"
     variation       1366
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1436693020"
     variation       1367
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762073087"
     variation       1373
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774040814"
     variation       1376
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763703447"
     variation       1378
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762551023"
     variation       1386
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146091512"
     variation       1387
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758759166"
     variation       1391
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745819251"
     variation       1393
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1212496803"
     variation       1396
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376507043"
     variation       1397
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770814502"
     variation       1401
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142298937"
     variation       1409
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373460555"
     variation       1411
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150978724"
     variation       1412
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142635871"
     variation       1414
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376644398"
     variation       1419
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541954467"
     variation       1421
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780289351"
     variation       1424
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1399171539"
     variation       1426
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:540546268"
     variation       1427
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369166936"
     variation       1431
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757681849"
     variation       1432
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:554150542"
     variation       1433
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1320023602"
     variation       1438
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:751950329"
     variation       1439
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423606016"
     variation       1443
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764392490"
     variation       1446
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762607046"
     variation       1447
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775056297"
     variation       1449
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:764864405"
     variation       1450
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145786370"
     variation       1453
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1031165831"
     variation       1454
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:150193964"
     variation       1458
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770740273"
     variation       1465
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746897980"
     variation       1469
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773158381"
     variation       1473
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:575289949"
     variation       1474
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780127351"
     variation       1476
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:957040506"
     variation       1481
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756269092"
     variation       1482
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745906838"
     variation       1484
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781291200"
     variation       1485
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757726095"
     variation       1490
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752005370"
     variation       1491
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:889057869"
     variation       1494
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375144691"
     variation       1496
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457835463"
     variation       1501
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1419087095"
     variation       1502
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1348572050"
     variation       1503
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112797581"
     variation       1507
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:140003734"
     variation       1510
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1461687779"
     variation       1512
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274868780"
     variation       1515
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146066402"
     variation       1516
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142326109"
     variation       1518
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764771843"
     variation       1521
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1302516361"
     variation       1523
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759123388"
     variation       1527
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1230111602"
     variation       1531
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1315890203"
     variation       1533
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1190599831"
     variation       1534
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:566696787"
     variation       1535
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1353068534"
     variation       1538
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1254701329"
     variation       1539
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1214068737"
     variation       1540
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1328165333"
     variation       1541
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765860208"
     variation       1545
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1447964428"
     variation       1547
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760696171"
     variation       1548
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372118564"
     variation       1549
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:773281724"
     variation       1550
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772051310"
     variation       1551
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:34187696"
     variation       1552
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150874997"
     variation       1554
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781144172"
     variation       1557..1558
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="ag"
                     /db_xref="dbSNP:1409321067"
     variation       1557
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770929966"
     variation       1558
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388275865"
     variation       1559
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369515811"
     variation       1560
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:917909045"
     variation       1561..1563
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="ccc"
                     /db_xref="dbSNP:1568601473"
     variation       1562
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1410021145"
     variation       1564
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778235623"
     variation       1565..1570
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="gtcagt"
                     /db_xref="dbSNP:1396834795"
     variation       1565
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1174707253"
     variation       1567
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758807941"
     variation       1573..1575
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1349591254"
     variation       1573
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200236800"
     variation       1574
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754602114"
     variation       1575..1576
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="ca"
                     /db_xref="dbSNP:1568601351"
     variation       1575
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141546124"
     variation       1576
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765875730"
     variation       1577..1578
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="ga"
                     /db_xref="dbSNP:1568601299"
     variation       1577
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:929236830"
     variation       1578
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:897634015"
     variation       1579
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1040182401"
     variation       1585
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376538628"
     variation       1586
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201043563"
     variation       1590
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:910267008"
     variation       1591
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:767531928"
     variation       1592
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306271519"
     variation       1595
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201814043"
     variation       1596
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774035887"
     variation       1597
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:531722937"
     variation       1598
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759680447"
     variation       1602
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61736533"
     variation       1605
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771052526"
     variation       1606
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:552619938"
     variation       1618
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144472423"
     variation       1619
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368749222"
     variation       1624
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:181999776"
     variation       1625
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748955875"
     variation       1627
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1029947326"
     variation       1630
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1428847488"
     variation       1636
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779831050"
     variation       1638
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1200016620"
     variation       1639
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755725806"
     variation       1641
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1282542978"
     variation       1647
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:267605712"
     variation       1652
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749986484"
     variation       1654
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769527556"
     variation       1656
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268836925"
     variation       1658
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1230100724"
     variation       1665
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764198709"
     variation       1669
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373715695"
     variation       1672
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:556354363"
     variation       1674
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002322602"
     variation       1676
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1412527430"
     variation       1678
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757272050"
     variation       1681
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:540386597"
     variation       1682
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1309243403"
     variation       1682
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142761513"
     variation       1687
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138632150"
     variation       1688
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:887596912"
     variation       1689
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766554094"
     variation       1691..1693
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:757629283"
     variation       1692
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198134919"
     variation       1693
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1244857477"
     variation       1694
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760843837"
     variation       1695
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1462311947"
     variation       1696
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773300751"
     variation       1701
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1199796859"
     variation       1705
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748673755"
     variation       1707
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774911834"
     variation       1708
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768951640"
     variation       1712
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1040699984"
     variation       1714
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1397352549"
     variation       1715
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141778812"
     variation       1716
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767840197"
     variation       1721
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1271541908"
     variation       1722
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:780526729"
     variation       1723
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1159063289"
     variation       1727
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755854941"
     variation       1728
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1405947331"
     variation       1729
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278029108"
     variation       1730
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1338892198"
     variation       1732
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1216451336"
     variation       1733
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1271546678"
     variation       1736
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371435309"
     variation       1738
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1208689694"
     variation       1740
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780851722"
     variation       1741
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756785643"
     variation       1746
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751509325"
     variation       1748
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:935777084"
     variation       1750
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:935576464"
     variation       1752
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1333412548"
     variation       1756
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202185472"
     variation       1760
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762646155"
     variation       1763
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1391880425"
     variation       1765
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752565451"
     variation       1772
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:979644056"
     variation       1775
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:764960786"
     variation       1778
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1420320327"
     variation       1779
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760894715"
     variation       1780
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543909314"
     variation       1785
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:767645679"
     variation       1786
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761935616"
     variation       1787
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151298410"
     variation       1794
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1312356736"
     variation       1798
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769241349"
     variation       1799
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1212239028"
     variation       1811
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749713033"
     variation       1819
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776012886"
     variation       1820
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:879111754"
     variation       1821
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1360973466"
     variation       1822
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770214112"
     variation       1825
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:926806437"
     variation       1828
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:986319839"
     variation       1830
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1347992536"
     variation       1831
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745578928"
     variation       1844
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:953131591"
     variation       1847
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760512080"
     variation       1848
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1206634336"
     variation       1849
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1262710280"
     variation       1861
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780974355"
     variation       1862
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373832268"
     variation       1864
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1207958029"
     variation       1869
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1245081507"
     variation       1871
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746496094"
     variation       1877
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777107193"
     variation       1878
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1378959092"
     variation       1879
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758381341"
     variation       1882
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752570364"
     variation       1894
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1400337385"
     variation       1896
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:997107282"
     variation       1897
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778748709"
     variation       1898..1902
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="gggag"
                     /db_xref="dbSNP:1311715337"
     variation       1899
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1401934021"
     variation       1900
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1470525817"
     variation       1903..1904
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="aaat"
                     /db_xref="dbSNP:1302215050"
     variation       1903
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754756520"
     variation       1904
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750694178"
     variation       1909
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1165279042"
     variation       1919
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1027751672"
     variation       1920
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767752949"
     variation       1921
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761905483"
     variation       1922
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:751685333"
     variation       1923
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370816406"
     variation       1930
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202145068"
     variation       1931
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770336761"
     variation       1932
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759953639"
     variation       1934
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776463840"
     variation       1939
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375794609"
     variation       1942
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746592895"
     variation       1943
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142259207"
     variation       1944
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1261161283"
     variation       1945
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771480317"
     variation       1947
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748143740"
     variation       1951
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1401366145"
     variation       1953
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778801688"
     variation       1957
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200882365"
     variation       1959
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1172385623"
     variation       1960
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754807953"
     variation       1961
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753667989"
     variation       1962
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779668524"
     variation       1973
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757517666"
     variation       1974
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1243518159"
     variation       1976
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751669053"
     variation       1978
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1441346322"
     variation       1980
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1387807684"
     variation       1981
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1277553411"
     variation       1993
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1568599422"
     variation       1994
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764297887"
     variation       1995
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763109321"
     variation       1996
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296720189"
     variation       1998
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1212621175"
     variation       2000
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1363734969"
     variation       2001
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1272163921"
     variation       2003
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1290075656"
     variation       2007
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1431740131"
     variation       2008
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753302376"
     variation       2013
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765803270"
     variation       2017
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1437172257"
     variation       2018
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1421460298"
     variation       2020
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138110009"
     variation       2021
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777075627"
     variation       2022
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199652968"
     variation       2026
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:772728170"
     variation       2027
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1186801962"
     variation       2029
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150349355"
     variation       2031
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747626844"
     variation       2037
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773810597"
     variation       2038
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1485690494"
     variation       2042
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761391841"
     variation       2043
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202216893"
     variation       2044
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371193579"
     variation       2045
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747310164"
     variation       2048
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777832426"
     variation       2049
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758587498"
     variation       2051
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752854954"
     variation       2052
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:377759902"
     variation       2053
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755554696"
     variation       2054
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1298118040"
     variation       2063..2071
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="aagaag"
                     /replace="aagaagaag"
                     /db_xref="dbSNP:781680429"
     variation       2064
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1056705456"
     variation       2065
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:939621457"
     variation       2070
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1249762511"
     variation       2071
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1481642813"
     variation       2075..2079
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="at"
                     /replace="atgat"
                     /db_xref="dbSNP:980905918"
     variation       2076
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754229834"
     variation       2077
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:536449963"
     variation       2078
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:777505765"
     variation       2078
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:368375280"
     variation       2080
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201961052"
     variation       2085
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:930804885"
     variation       2087
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142383251"
     variation       2088
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1388069954"
     variation       2091
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148798821"
     variation       2094
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1324294064"
     variation       2097
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1407225420"
     variation       2104
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1411933834"
     variation       2106
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298706929"
     variation       2111..2115
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="acaca"
                     /db_xref="dbSNP:1402883729"
     variation       2114
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1389838551"
     variation       2117
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1285025769"
     variation       2118
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1472518727"
     variation       2122
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1218298858"
     variation       2123
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367602756"
     variation       2124
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1019389882"
     variation       2125
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:535253175"
     variation       2127
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1265375719"
     variation       2136..2139
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="agag"
                     /db_xref="dbSNP:1270100402"
     variation       2137
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:987509992"
     variation       2139
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181267764"
     variation       2143
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867605732"
     variation       2149
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1186672715"
     variation       2151
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1488154797"
     variation       2159
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1185595889"
     variation       2161
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:62122488"
     variation       2162
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376608225"
     variation       2163
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:553702469"
     variation       2166
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1170460175"
     variation       2167
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1012057459"
     variation       2168
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:189379942"
     variation       2171
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1056585723"
     variation       2182
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184916518"
     variation       2185
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780033261"
     variation       2189
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1399112918"
     variation       2191
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1245662819"
     variation       2193
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1364269273"
     variation       2194
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1312182106"
     variation       2204
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:902547969"
     variation       2205
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1248862278"
     variation       2212
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192216899"
     variation       2220
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1293076219"
     variation       2222
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:113647041"
     variation       2223
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:946963745"
     variation       2225
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:544866397"
     variation       2226..2235
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="t"
                     /replace="ttgttttctt"
                     /db_xref="dbSNP:905409701"
     variation       2234
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:937035338"
     variation       2237
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1050362839"
     variation       2239
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1365102143"
     variation       2240
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1275466462"
     variation       2241..2243
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1438725359"
     variation       2245
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1348341080"
     variation       2253
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771969606"
     variation       2254
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77400154"
     variation       2263
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:930794695"
     variation       2265
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:920794931"
     variation       2271
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:972157870"
     variation       2273
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1156599428"
     variation       2276
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:975836451"
     variation       2277
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539826176"
     variation       2281
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1166500398"
     variation       2286
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907534199"
     variation       2287
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139078993"
     variation       2296
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:952068215"
     variation       2298
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1028864763"
     variation       2300
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376733066"
     variation       2301
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1023528590"
     variation       2302
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1286868075"
ORIGIN      
ggagattcgtgggaggaccgagcccggggatgggactggaggagtttccgtgaccttgcgggctgtttgtgctgagggacagctttatttaaataataatatgcgtgcaggcgccctgcatgattcctggccgcgtgctttctagtaagtgcgcagagacttttcgcaagaattgattcactcttttttccttccctcccgatttttgattggaaacccagacttcctttcacgcctgtcgccaggttaactaggtcactgtttgctctcaggagcaaccctgcctcccgcagttcgcttggtccttgattacaggggaggttccctgctcaagctctcttctcttgtctgctgccatgtgagacgtgcctttgaccttctgccatgattgtgaggcctccccagccacgtgaaactacttctgaatgaacagtgaatctattactgaggaaaaccagaggaagcctgtgtagataggtatcaattagataccagctactggaagagctttctcagagactgattaaaaaattctccactagatatggctgcaaattgcacatcctcatggagtctaggagaatcctgcaacagacctgggttggagctgccacggtctatggcatcctcagaaactcaacttggaaatcacgacgtggaccctgagatttctcacgtgaacttcaggatgttcagctgcccgaaggagtcggaccccatccaggctctgaggaaactcactgagctgtgccatctgtggctgaggcccgacctccacaccaaagagcagatcctggacatgctggtgatggagcagttcatgatctccatgccccaggagctccaggtcttagtcatgatgaacggtgtgcagagctgcaaagacctggaggacctgctacgaaataacagaagacccaagaaatggtctgtggtcaccttccacggaaaggaatatattgtgcaggactcagatatcgagatggctgaagccccctccagtgtcagagatgatctgaaagacgtgtccagccaacgggcctcctcggtgaaccagatgcgtccaggggaaggccaggcccaccgagagctgcagatcctgcccagggtccctgcattgtccaggaggcagggagaggactttctgctacacaagagtattgacgtaacaggtgacccaaagtctctgagacccaagcagaccttggagaaggatctgaaggaaaacagggaagagaacccaggactgacatccccagagcctcagcttccaaagagtcccaatctggtgagagcaaaggaggggaaggaccccccaaaaatagcctctgtggaaaatgtggatgctgacacaccttctgcctgcgttgtggagagagaagcttcgactcacagcgggaacagaggagacgctctgaatctgagcagtcccaaaagaagcaaaccagatgcctcctccatttcccaagaagagcctcaaggagaagccacacctgtgggcaacagagaatccccgggacaagctgggatgaattcaattcattccccaggccctgcgagcccagtcagtcacccggatggccaagaagccaaggcactgccgccctttgcatgtgacgtgtgcgagaagaggtttacgtgtaattccaagctagtcatccacaagagatcacacacaggcgagagactctttcaatgtaatctctgtgggaagcgcttcatgcagcttattagcctccaatttcaccagcgaacccacactggcgagaggccctacacgtgtgacgtctgccagaagcagttcacccagaagtcctacttgaagtgtcacaagagaagccacacaggggagaagcccttcgaatgtaaagactgcaagaaagttttcacctacagggggagcctgaaggagcaccagcgcatccactccggagagaaaccctacaaatgttccaagtgtccaagagccttcagtcggctgaaattgttaagacgccaccagaaaacacatccagaagctacttctcagtgattgcataatccggtctatgccttctgcaccaagaagaagtgaatgatatttttcatcaatgttatcagatgacatttgacacatgcaagggcgtctgacacacagagggagtgccctagatatgaattgccaggatgtttgagtaaatatgtgtcctccccactgagctttgttttctgtttcattatgtccattgttttcttataggtttattttggtttgtgttgctgttcttccaataaacgatcatcttattagttttcaatattgta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]