GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:26:49, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NM_001322070            2182 bp    mRNA    linear   PRI 05-DEC-2018
DEFINITION  Homo sapiens zinc finger and SCAN domain containing 5A (ZSCAN5A),
            transcript variant 10, mRNA.
ACCESSION   NM_001322070
VERSION     NM_001322070.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2182)
  AUTHORS   Kimura K, Wakamatsu A, Suzuki Y, Ota T, Nishikawa T, Yamashita R,
            Yamamoto J, Sekine M, Tsuritani K, Wakaguri H, Ishii S, Sugiyama T,
            Saito K, Isono Y, Irie R, Kushida N, Yoneyama T, Otsuka R, Kanda K,
            Yokoi T, Kondo H, Wagatsuma M, Murakawa K, Ishida S, Ishibashi T,
            Takahashi-Fujii A, Tanase T, Nagai K, Kikuchi H, Nakai K, Isogai T
            and Sugano S.
  TITLE     Diversification of transcriptional modulation: large-scale
            identification and characterization of putative alternative
            promoters of human genes
  JOURNAL   Genome Res. 16 (1), 55-65 (2006)
   PUBMED   16344560
REFERENCE   2  (bases 1 to 2182)
  AUTHORS   Gerhard DS, Wagner L, Feingold EA, Shenmen CM, Grouse LH, Schuler
            G, Klein SL, Old S, Rasooly R, Good P, Guyer M, Peck AM, Derge JG,
            Lipman D, Collins FS, Jang W, Sherry S, Feolo M, Misquitta L, Lee
            E, Rotmistrovsky K, Greenhut SF, Schaefer CF, Buetow K, Bonner TI,
            Haussler D, Kent J, Kiekhaus M, Furey T, Brent M, Prange C,
            Schreiber K, Shapiro N, Bhat NK, Hopkins RF, Hsie F, Driscoll T,
            Soares MB, Casavant TL, Scheetz TE, Brown-stein MJ, Usdin TB,
            Toshiyuki S, Carninci P, Piao Y, Dudekula DB, Ko MS, Kawakami K,
            Suzuki Y, Sugano S, Gruber CE, Smith MR, Simmons B, Moore T,
            Waterman R, Johnson SL, Ruan Y, Wei CL, Mathavan S, Gunaratne PH,
            Wu J, Garcia AM, Hulyk SW, Fuh E, Yuan Y, Sneed A, Kowis C, Hodgson
            A, Muzny DM, McPherson J, Gibbs RA, Fahey J, Helton E, Ketteman M,
            Madan A, Rodrigues S, Sanchez A, Whiting M, Madari A, Young AC,
            Wetherby KD, Granite SJ, Kwong PN, Brinkley CP, Pearson RL,
            Bouffard GG, Blakesly RW, Green ED, Dickson MC, Rodriguez AC,
            Grimwood J, Schmutz J, Myers RM, Butterfield YS, Griffith M,
            Griffith OL, Krzywinski MI, Liao N, Morin R, Palmquist D, Petrescu
            AS, Skalska U, Smailus DE, Stott JM, Schnerch A, Schein JE, Jones
            SJ, Holt RA, Baross A, Marra MA, Clifton S, Makowski KA, Bosak S
            and Malek J.
  CONSRTM   MGC Project Team
  TITLE     The status, quality, and expansion of the NIH full-length cDNA
            project: the Mammalian Gene Collection (MGC)
  JOURNAL   Genome Res. 14 (10B), 2121-2127 (2004)
   PUBMED   15489334
  REMARK    Erratum:[Genome Res. 2006 Jun;16(6):804. Morrin, Ryan [corrected to
            Morin, Ryan]]
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC006116.1 and AC011506.3.
            
            Transcript Variant: This variant (10), along with variants 3-8 and
            11, encodes isoform b.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR1803617.127844.1,
                                           SRR1660809.62488.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMEA2148093, SAMEA2158188
                                           [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-315               AC006116.1         38588-38902         c
            316-417             AC006116.1         37621-37722         c
            418-803             AC011506.3         42266-42651         c
            804-1007            AC011506.3         41234-41437         c
            1008-1158           AC011506.3         40194-40344         c
            1159-2182           AC011506.3         38906-39929         c
FEATURES             Location/Qualifiers
     source          1..2182
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="19"
                     /map="19q13.43"
     gene            1..2182
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="zinc finger and SCAN domain containing 5A"
                     /db_xref="GeneID:79149"
                     /db_xref="HGNC:HGNC:23710"
     exon            1..315
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436370726"
     variation       2
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1568744982"
     variation       6..7
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1165941836"
     variation       7
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1425713150"
     variation       8
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:926285036"
     variation       11..13
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1568744947"
     variation       14
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1361681884"
     variation       15
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1400116513"
     variation       17
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:980511780"
     variation       18
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:930381427"
     variation       19
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764155213"
     variation       20
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1055278314"
     variation       21
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756327855"
     variation       23..25
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1016268546"
     variation       24
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1210258104"
     variation       27
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1484390864"
     variation       28
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:987044286"
     variation       29
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752809911"
     variation       30
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1028311508"
     variation       39
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12973009"
     variation       43
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1257795290"
     variation       47
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:945816203"
     variation       51
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1484439682"
     variation       52
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1254686005"
     variation       59
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866198795"
     variation       60
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:912933595"
     variation       61
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1054220081"
     variation       65
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:935637530"
     variation       75
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1354342302"
     variation       79
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:921616583"
     variation       82
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:8107755"
     variation       83
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1276668648"
     variation       96..98
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="ata"
                     /db_xref="dbSNP:143531834"
     variation       100
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1568744657"
     variation       101
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184573688"
     variation       104
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1056803532"
     variation       105
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1456561897"
     variation       107
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1398080251"
     variation       112
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:867109867"
     variation       113
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1239163029"
     variation       114
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454274612"
     variation       116
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1189953392"
     variation       118
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:911724599"
     variation       126
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1415707144"
     variation       143
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:983648942"
     variation       147..148
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="aa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1176104502"
     variation       150
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:950588279"
     variation       151
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1568744560"
     variation       153
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1376686527"
     variation       157
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1302099370"
     variation       161..164
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="tt"
                     /replace="tttt"
                     /db_xref="dbSNP:1377352545"
     variation       161
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:904884692"
     variation       164
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1044702978"
     variation       165
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1276416803"
     variation       166
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:77962822"
     variation       174
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:973530125"
     variation       181..184
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="ct"
                     /replace="ctct"
                     /db_xref="dbSNP:1219894570"
     variation       182
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:537028616"
     variation       183
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:959348949"
     variation       184..189
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="tttt"
                     /replace="tttttt"
                     /db_xref="dbSNP:1156241584"
     variation       186
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277585142"
     variation       188
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1316360268"
     variation       190
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1259156003"
     variation       191
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456249471"
     variation       193
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:920348401"
     variation       195
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1033671411"
     variation       196
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577696022"
     variation       199
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1003744000"
     variation       208
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1191279504"
     variation       209
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:774409835"
     variation       210
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908688370"
     variation       217..219
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1321265387"
     variation       218
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:192640844"
     variation       219
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1021168192"
     variation       225
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:955638081"
     variation       226
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1486452970"
     variation       231
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1028363898"
     variation       233
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1010117865"
     variation       234
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1250460480"
     variation       236
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1338481589"
     variation       237
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:8104516"
     variation       241
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:968003817"
     variation       246
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1206828965"
     variation       251
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1292394272"
     variation       258
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1452752678"
     variation       260..265
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="tg"
                     /replace="tgtttg"
                     /db_xref="dbSNP:1216513711"
     variation       278
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1261882645"
     variation       284
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1487007528"
     variation       288
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770832546"
     variation       290
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762802046"
     variation       297
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1195148126"
     variation       312
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373320419"
     variation       314
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:893988714"
     variation       315
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1273958727"
     exon            316..417
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /inference="alignment:Splign:2.1.0"
     variation       316
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:894060388"
     variation       320
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1280543171"
     variation       329
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:549655200"
     variation       331
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:537463526"
     variation       335..340
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="ctct"
                     /replace="ctctct"
                     /db_xref="dbSNP:1279494527"
     variation       335
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1053081928"
     variation       336..346
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="tctctt"
                     /replace="tctcttctctt"
                     /db_xref="dbSNP:1219194721"
     variation       353
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34709084"
     variation       355
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149410489"
     variation       357
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1233972453"
     variation       358
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:927932605"
     variation       359
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1449944817"
     variation       360
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1361174474"
     variation       363
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1335074004"
     variation       365
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1409501624"
     variation       366
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1398245132"
     variation       377
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481238456"
     variation       388
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:528542040"
     variation       389
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1242758416"
     variation       390
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:566162679"
     variation       391
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1176676470"
     variation       395
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1568742796"
     variation       396
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:549625573"
     variation       398
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172849421"
     variation       400
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1478444016"
     variation       401
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766795772"
     variation       405
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186336270"
     variation       409
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763437142"
     variation       410
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237745021"
     misc_feature    411..413
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="upstream in-frame stop codon"
     variation       417
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1355050694"
     variation       417
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278199706"
     exon            418..803
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /inference="alignment:Splign:2.1.0"
     variation       418
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759416767"
     CDS             420..1910
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="isoform b is encoded by transcript variant 10; zinc
                     finger protein 495; zinc finger and SCAN domain containing
                     5; zinc finger and SCAN domain-containing protein 5A"
                     /codon_start=1
                     /product="zinc finger and SCAN domain-containing protein
                     5A isoform b"
                     /protein_id="NP_001308999.1"
                     /db_xref="CCDS:CCDS12941.1"
                     /db_xref="GeneID:79149"
                     /db_xref="HGNC:HGNC:23710"
                     /translation="
MAANCTSSWSLGESCNRPGLELPRSMASSETQLGNHDVDPEISHVNFRMFSCPKESDPIQALRKLTELCHLWLRPDLHTKEQILDMLVMEQFMISMPQELQVLVMMNGVQSCKDLEDLLRNNRRPKKWSVVTFHGKEYIVQDSDIEMAEAPSSVRDDLKDVSSQRASSVNQMRPGEGQAHRELQILPRVPALSRRQGEDFLLHKSIDVTGDPKSLRPKQTLEKDLKENREENPGLTSPEPQLPKSPTDLVRAKEGKDPPKIASVENVDADTPSACVVEREASTHSGNRGDALNLSSPKRSKPDASSISQEEPQGEATPVGNRESPGQAGMNSIHSPGPASPVSHPDGQEAKALPPFACDVCEKRFTCNSKLVIHKRSHTGERLFQCNLCGKRFMQLISLQFHQRTHTGERPYTCDVCQKQFTQKSYLKCHKRSHTGEKPFECKDCKKVFTYRGSLKEHQRIHSGEKPYKCSKCPRAFSRLKLLRRHQKTHPEATSQ"
     misc_feature    537..791
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="SCAN oligomerization domain; Region: SCAN; cd07936"
                     /db_xref="CDD:153421"
     misc_feature    order(558..563,567..575,588..596,600..605,612..617,
                     624..629,633..644,654..659,666..671,678..686,690..695,
                     699..710,765..767,774..779,783..791)
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:153421"
     misc_feature    <1056..>1484
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="Treacher Collins syndrome protein Treacle; Region:
                     Treacle; pfam03546"
                     /db_xref="CDD:308903"
     misc_feature    <1434..1895
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="FOG: Zn-finger [General function prediction only];
                     Region: COG5048"
                     /db_xref="CDD:227381"
     misc_feature    1491..1553
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn
                     finger"
                     /db_xref="CDD:275368"
     misc_feature    order(1491..1493,1500..1502,1539..1541,1551..1553)
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:275368"
     misc_feature    1575..1637
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn
                     finger"
                     /db_xref="CDD:275368"
     misc_feature    order(1575..1577,1584..1586,1623..1625,1635..1637)
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:275368"
     misc_feature    1611..1688
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="Zinc-finger double domain; Region: zf-H2C2_2;
                     pfam13465"
                     /db_xref="CDD:316026"
     misc_feature    1659..1721
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn
                     finger"
                     /db_xref="CDD:275368"
     misc_feature    order(1659..1661,1668..1670,1707..1709,1719..1721)
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:275368"
     misc_feature    order(1674..1676,1680..1682,1686..1688,1692..1697,
                     1704..1709,1716..1718,1758..1760,1764..1766,1776..1781,
                     1788..1793,1800..1802,1842..1844,1848..1850,1854..1856,
                     1860..1865,1872..1877,1884..1886)
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="putative nucleic acid binding site [nucleotide
                     binding]; other site"
                     /db_xref="CDD:275368"
     misc_feature    1743..1805
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn
                     finger"
                     /db_xref="CDD:275368"
     misc_feature    order(1743..1745,1752..1754,1791..1793,1803..1805)
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:275368"
     misc_feature    1779..1856
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="Zinc-finger double domain; Region: zf-H2C2_2;
                     pfam13465"
                     /db_xref="CDD:316026"
     misc_feature    1827..1889
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn
                     finger"
                     /db_xref="CDD:275368"
     misc_feature    order(1827..1829,1836..1838,1875..1877,1887..1889)
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:275368"
     variation       420
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:765269516"
     variation       425
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200884320"
     variation       427
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766094247"
     variation       431
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760459681"
     variation       432
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774614802"
     variation       433
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775624525"
     variation       434
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1363805885"
     variation       443
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373938329"
     variation       445
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1242687972"
     variation       447
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1015349106"
     variation       450
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368670022"
     variation       452
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363696128"
     variation       454
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142822213"
     variation       459
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775462486"
     variation       461
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1473788109"
     variation       462
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201140936"
     variation       463
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198240932"
     variation       467
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1330585976"
     variation       469
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1302156262"
     variation       470
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746372429"
     variation       471
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112550672"
     variation       475
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1268909867"
     variation       478
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781673650"
     variation       483
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771485540"
     variation       488
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1012832889"
     variation       489
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149425471"
     variation       490
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777612921"
     variation       491
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758159159"
     variation       494
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752348974"
     variation       495
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1223191449"
     variation       498
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778303494"
     variation       499
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:754446242"
     variation       500
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:753787290"
     variation       504
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766292035"
     variation       505
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1287660582"
     variation       508
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:755953393"
     variation       517
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1389854732"
     variation       524
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536245284"
     variation       527
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139035140"
     variation       528
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:543522736"
     variation       530
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777058512"
     variation       531
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:550648749"
     variation       532
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:531042856"
     variation       537
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:945144346"
     variation       539
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138415436"
     variation       544
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747763578"
     variation       547
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376633535"
     variation       551
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150105146"
     variation       552
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748809925"
     variation       557
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1258004722"
     variation       566
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200848409"
     variation       572
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140787974"
     variation       577
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756076357"
     variation       578
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750310913"
     variation       579
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201874615"
     variation       580
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:757008317"
     variation       581
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1413148211"
     variation       586
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150925266"
     variation       587
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765481925"
     variation       588
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:974056867"
     variation       591
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1461123353"
     variation       597
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867974029"
     variation       599
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759580162"
     variation       600
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776817209"
     variation       611
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766522832"
     variation       615
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761280855"
     variation       628
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436150555"
     variation       630
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773792328"
     variation       632
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1568609131"
     variation       644
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373202448"
     variation       645
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371935466"
     variation       653
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376204582"
     variation       655
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:982577386"
     variation       662
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367880708"
     variation       663
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1409286401"
     variation       664
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1395888384"
     variation       671
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773925891"
     variation       672
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768324013"
     variation       677
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:528793290"
     variation       684
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1392357412"
     variation       686
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1300974044"
     variation       689
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1342904429"
     variation       690
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1315010377"
     variation       702
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779562174"
     variation       703
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1302878387"
     variation       705
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755562475"
     variation       708
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1348062471"
     variation       711
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1203771251"
     variation       714
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745808092"
     variation       722
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1390530216"
     variation       728
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:781100410"
     variation       733
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201600248"
     variation       735
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200493184"
     variation       738
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779039539"
     variation       740
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755255762"
     variation       741
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143462624"
     variation       742
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374088582"
     variation       744
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141426263"
     variation       751
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1166742592"
     variation       755
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1003158548"
     variation       757
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1356824594"
     variation       761
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768047832"
     variation       770
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:762126209"
     variation       771
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1020466986"
     variation       777
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774809636"
     variation       778
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:73619433"
     variation       785
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762607068"
     variation       787
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1227165658"
     variation       790
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775056079"
     variation       796
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:769359428"
     variation       799
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1229403566"
     exon            804..1007
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /inference="alignment:Splign:2.1.0"
     variation       805
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773021892"
     variation       809
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1368883049"
     variation       810
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189644637"
     variation       811
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1325604605"
     variation       813
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144517223"
     variation       820
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479065619"
     variation       821
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147680558"
     variation       822
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188499793"
     variation       824
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1463923285"
     variation       827
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1270489245"
     variation       831
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780465273"
     variation       832
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1322451938"
     variation       840
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756436404"
     variation       841
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746040402"
     variation       843
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213445099"
     variation       849
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013394886"
     variation       853
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781344716"
     variation       854
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140466399"
     variation       855
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145011101"
     variation       856
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1367234162"
     variation       857
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758808063"
     variation       858
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1469122932"
     variation       864
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1205973207"
     variation       871
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759720886"
     variation       872
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759204689"
     variation       873
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1416325075"
     variation       874
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150002888"
     variation       876
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1168030056"
     variation       888
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139322292"
     variation       891
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760092983"
     variation       892
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1189715420"
     variation       895
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773253511"
     variation       897
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1236034703"
     variation       899
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111907569"
     variation       900
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368509037"
     variation       901
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746106028"
     variation       902
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763156569"
     variation       905
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781265590"
     variation       906
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199964698"
     variation       911
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747034599"
     variation       912
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201225377"
     variation       913
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200678839"
     variation       915
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1304354265"
     variation       918
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765594071"
     variation       919
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1286568737"
     variation       920
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:914983296"
     variation       921
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141990164"
     variation       922
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753586762"
     variation       923
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201727637"
     variation       925
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760274039"
     variation       926
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772630163"
     variation       930
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762366673"
     variation       933
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201825488"
     variation       935
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1183933184"
     variation       936
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768639394"
     variation       937
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375744187"
     variation       941
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199886337"
     variation       944
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1187948759"
     variation       945
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1202541382"
     variation       946..952
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="aaggcca"
                     /replace="aaggccaaggcca"
                     /db_xref="dbSNP:776494916"
     variation       948
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762640862"
     variation       951
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1274656497"
     variation       953..955
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="ggc"
                     /db_xref="dbSNP:1164786006"
     variation       955
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:776959267"
     variation       956
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367599578"
     variation       957
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1314655845"
     variation       958
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61736534"
     variation       960
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777848514"
     variation       961
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748724493"
     variation       965
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765368134"
     variation       968
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1414104798"
     variation       970
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779383095"
     variation       971
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1399688711"
     variation       976
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776925397"
     variation       977
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346525169"
     variation       979
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754123866"
     variation       980
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1348625983"
     variation       981
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780427415"
     variation       983
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1568606103"
     variation       986
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755747347"
     variation       987
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:991659846"
     variation       988
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568606072"
     variation       992
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4801692"
     variation       993
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143076677"
     variation       999
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1473360888"
     variation       1000
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1251988547"
     variation       1001
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1208693820"
     variation       1003
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1487490655"
     variation       1004
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1329028809"
     exon            1008..1158
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /inference="alignment:Splign:2.1.0"
     variation       1008
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752618641"
     variation       1010
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764941691"
     variation       1013
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770631493"
     variation       1017
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277082812"
     variation       1019
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773477056"
     variation       1020
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761986359"
     variation       1022
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:527674624"
     variation       1025
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1319020766"
     variation       1027
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138391803"
     variation       1033
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1456998392"
     variation       1037
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143209101"
     variation       1038
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381699289"
     variation       1040
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746211159"
     variation       1041
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149533881"
     variation       1042
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1422920448"
     variation       1043
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757000446"
     variation       1044
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002851045"
     variation       1047
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376620359"
     variation       1048
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777158698"
     variation       1050
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1190390490"
     variation       1054
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757855433"
     variation       1055
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:923976422"
     variation       1058
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:977963990"
     variation       1059
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:576450386"
     variation       1060
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1343129395"
     variation       1061
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1257876094"
     variation       1063
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:971073966"
     variation       1069
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765201989"
     variation       1075
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373606524"
     variation       1076
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1316444550"
     variation       1079
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1231169189"
     variation       1083
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754811958"
     variation       1088
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149479488"
     variation       1090
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:766115556"
     variation       1091
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:959240087"
     variation       1094
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457842727"
     variation       1095
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1313061260"
     variation       1097
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1428578747"
     variation       1099
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1387716387"
     variation       1101
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:546332373"
     variation       1109
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:577513858"
     variation       1110
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1367744432"
     variation       1112
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764148776"
     variation       1115
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568603953"
     variation       1118
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1440957615"
     variation       1119
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:573687081"
     variation       1120
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763074148"
     variation       1124
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775908186"
     variation       1125
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:770303549"
     variation       1126
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1006010126"
     variation       1127
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1463840782"
     variation       1129
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1173157535"
     variation       1137
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:950351225"
     variation       1140
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1026009423"
     variation       1143
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1464708925"
     variation       1145
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:997211124"
     variation       1147
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370671539"
     variation       1148
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777154770"
     variation       1151
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771360506"
     variation       1152
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746661136"
     variation       1157
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138065226"
     exon            1159..2182
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /inference="alignment:Splign:2.1.0"
     variation       1162
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759681374"
     variation       1164
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754451246"
     variation       1166
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1343686122"
     variation       1167
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200579325"
     variation       1169
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1568603105"
     variation       1170
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761049322"
     variation       1171
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1371614696"
     variation       1173
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1319753986"
     variation       1174
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773652552"
     variation       1175
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1043111296"
     variation       1178
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:267605713"
     variation       1181
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1432676836"
     variation       1184
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1449167317"
     variation       1188
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772271198"
     variation       1189
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376227013"
     variation       1190..1195
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="ccccc"
                     /replace="cccccc"
                     /db_xref="dbSNP:1568602903"
     variation       1190
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:75630877"
     variation       1191
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:943302585"
     variation       1192
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141071964"
     variation       1194
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1170863184"
     variation       1195..1196
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="ag"
                     /replace="ca"
                     /db_xref="dbSNP:386811187"
     variation       1195
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:531717987"
     variation       1196
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:562997139"
     variation       1197
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188440623"
     variation       1199
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:769752546"
     variation       1200
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1298190151"
     variation       1201
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371706721"
     variation       1207
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1216130869"
     variation       1208
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781053046"
     variation       1209
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756931660"
     variation       1210
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753025630"
     variation       1212
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746812478"
     variation       1214
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1347924314"
     variation       1217
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1256436567"
     variation       1222
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779261455"
     variation       1231
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199734240"
     variation       1233
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369979986"
     variation       1234..1238
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="ct"
                     /replace="cttct"
                     /db_xref="dbSNP:781592643"
     variation       1236
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1367170573"
     variation       1237
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754005392"
     variation       1239
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766521204"
     variation       1241
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756662052"
     variation       1242
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750830064"
     variation       1243
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767992521"
     variation       1244
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1436693020"
     variation       1245
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762073087"
     variation       1251
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774040814"
     variation       1254
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763703447"
     variation       1256
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762551023"
     variation       1264
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146091512"
     variation       1265
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758759166"
     variation       1269
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745819251"
     variation       1271
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1212496803"
     variation       1274
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376507043"
     variation       1275
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770814502"
     variation       1279
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142298937"
     variation       1287
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373460555"
     variation       1289
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150978724"
     variation       1290
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142635871"
     variation       1292
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376644398"
     variation       1297
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541954467"
     variation       1299
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780289351"
     variation       1302
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1399171539"
     variation       1304
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:540546268"
     variation       1305
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369166936"
     variation       1309
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757681849"
     variation       1310
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:554150542"
     variation       1311
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1320023602"
     variation       1316
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:751950329"
     variation       1317
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423606016"
     variation       1321
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764392490"
     variation       1324
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762607046"
     variation       1325
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775056297"
     variation       1327
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:764864405"
     variation       1328
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145786370"
     variation       1331
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1031165831"
     variation       1332
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:150193964"
     variation       1336
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770740273"
     variation       1343
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746897980"
     variation       1347
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773158381"
     variation       1351
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:575289949"
     variation       1352
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780127351"
     variation       1354
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:957040506"
     variation       1359
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756269092"
     variation       1360
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745906838"
     variation       1362
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781291200"
     variation       1363
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757726095"
     variation       1368
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752005370"
     variation       1369
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:889057869"
     variation       1372
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375144691"
     variation       1374
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457835463"
     variation       1379
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1419087095"
     variation       1380
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1348572050"
     variation       1381
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112797581"
     variation       1385
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:140003734"
     variation       1388
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1461687779"
     variation       1390
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274868780"
     variation       1393
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146066402"
     variation       1394
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142326109"
     variation       1396
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764771843"
     variation       1399
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1302516361"
     variation       1401
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759123388"
     variation       1405
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1230111602"
     variation       1409
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1315890203"
     variation       1411
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1190599831"
     variation       1412
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:566696787"
     variation       1413
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1353068534"
     variation       1416
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1254701329"
     variation       1417
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1214068737"
     variation       1418
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1328165333"
     variation       1419
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765860208"
     variation       1423
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1447964428"
     variation       1425
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760696171"
     variation       1426
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372118564"
     variation       1427
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:773281724"
     variation       1428
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772051310"
     variation       1429
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:34187696"
     variation       1430
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150874997"
     variation       1432
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781144172"
     variation       1435..1436
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="ag"
                     /db_xref="dbSNP:1409321067"
     variation       1435
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770929966"
     variation       1436
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388275865"
     variation       1437
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369515811"
     variation       1438
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:917909045"
     variation       1439..1441
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="ccc"
                     /db_xref="dbSNP:1568601473"
     variation       1440
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1410021145"
     variation       1442
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778235623"
     variation       1443..1448
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="gtcagt"
                     /db_xref="dbSNP:1396834795"
     variation       1443
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1174707253"
     variation       1445
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758807941"
     variation       1451..1453
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1349591254"
     variation       1451
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200236800"
     variation       1452
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754602114"
     variation       1453..1454
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="ca"
                     /db_xref="dbSNP:1568601351"
     variation       1453
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141546124"
     variation       1454
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765875730"
     variation       1455..1456
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="ga"
                     /db_xref="dbSNP:1568601299"
     variation       1455
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:929236830"
     variation       1456
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:897634015"
     variation       1457
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1040182401"
     variation       1463
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376538628"
     variation       1464
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201043563"
     variation       1468
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:910267008"
     variation       1469
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:767531928"
     variation       1470
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306271519"
     variation       1473
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201814043"
     variation       1474
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774035887"
     variation       1475
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:531722937"
     variation       1476
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759680447"
     variation       1480
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61736533"
     variation       1483
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771052526"
     variation       1484
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:552619938"
     variation       1496
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144472423"
     variation       1497
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368749222"
     variation       1502
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:181999776"
     variation       1503
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748955875"
     variation       1505
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1029947326"
     variation       1508
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1428847488"
     variation       1514
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779831050"
     variation       1516
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1200016620"
     variation       1517
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755725806"
     variation       1519
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1282542978"
     variation       1525
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:267605712"
     variation       1530
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749986484"
     variation       1532
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769527556"
     variation       1534
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268836925"
     variation       1536
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1230100724"
     variation       1543
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764198709"
     variation       1547
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373715695"
     variation       1550
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:556354363"
     variation       1552
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002322602"
     variation       1554
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1412527430"
     variation       1556
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757272050"
     variation       1559
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:540386597"
     variation       1560
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1309243403"
     variation       1560
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142761513"
     variation       1565
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138632150"
     variation       1566
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:887596912"
     variation       1567
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766554094"
     variation       1569..1571
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:757629283"
     variation       1570
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198134919"
     variation       1571
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1244857477"
     variation       1572
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760843837"
     variation       1573
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1462311947"
     variation       1574
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773300751"
     variation       1579
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1199796859"
     variation       1583
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748673755"
     variation       1585
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774911834"
     variation       1586
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768951640"
     variation       1590
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1040699984"
     variation       1592
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1397352549"
     variation       1593
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141778812"
     variation       1594
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767840197"
     variation       1599
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1271541908"
     variation       1600
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:780526729"
     variation       1601
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1159063289"
     variation       1605
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755854941"
     variation       1606
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1405947331"
     variation       1607
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278029108"
     variation       1608
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1338892198"
     variation       1610
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1216451336"
     variation       1611
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1271546678"
     variation       1614
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371435309"
     variation       1616
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1208689694"
     variation       1618
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780851722"
     variation       1619
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756785643"
     variation       1624
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751509325"
     variation       1626
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:935777084"
     variation       1628
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:935576464"
     variation       1630
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1333412548"
     variation       1634
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202185472"
     variation       1638
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762646155"
     variation       1641
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1391880425"
     variation       1643
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752565451"
     variation       1650
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:979644056"
     variation       1653
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:764960786"
     variation       1656
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1420320327"
     variation       1657
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760894715"
     variation       1658
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543909314"
     variation       1663
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:767645679"
     variation       1664
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761935616"
     variation       1665
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151298410"
     variation       1672
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1312356736"
     variation       1676
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769241349"
     variation       1677
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1212239028"
     variation       1689
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749713033"
     variation       1697
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776012886"
     variation       1698
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:879111754"
     variation       1699
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1360973466"
     variation       1700
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770214112"
     variation       1703
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:926806437"
     variation       1706
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:986319839"
     variation       1708
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1347992536"
     variation       1709
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745578928"
     variation       1722
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:953131591"
     variation       1725
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760512080"
     variation       1726
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1206634336"
     variation       1727
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1262710280"
     variation       1739
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780974355"
     variation       1740
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373832268"
     variation       1742
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1207958029"
     variation       1747
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1245081507"
     variation       1749
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746496094"
     variation       1755
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777107193"
     variation       1756
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1378959092"
     variation       1757
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758381341"
     variation       1760
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752570364"
     variation       1772
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1400337385"
     variation       1774
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:997107282"
     variation       1775
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778748709"
     variation       1776..1780
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="gggag"
                     /db_xref="dbSNP:1311715337"
     variation       1777
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1401934021"
     variation       1778
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1470525817"
     variation       1781..1782
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="aaat"
                     /db_xref="dbSNP:1302215050"
     variation       1781
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754756520"
     variation       1782
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750694178"
     variation       1787
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1165279042"
     variation       1797
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1027751672"
     variation       1798
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767752949"
     variation       1799
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761905483"
     variation       1800
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:751685333"
     variation       1801
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370816406"
     variation       1808
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202145068"
     variation       1809
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770336761"
     variation       1810
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759953639"
     variation       1812
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776463840"
     variation       1817
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375794609"
     variation       1820
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746592895"
     variation       1821
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142259207"
     variation       1822
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1261161283"
     variation       1823
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771480317"
     variation       1825
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748143740"
     variation       1829
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1401366145"
     variation       1831
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778801688"
     variation       1835
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200882365"
     variation       1837
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1172385623"
     variation       1838
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754807953"
     variation       1839
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753667989"
     variation       1840
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779668524"
     variation       1851
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757517666"
     variation       1852
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1243518159"
     variation       1854
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751669053"
     variation       1856
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1441346322"
     variation       1858
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1387807684"
     variation       1859
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1277553411"
     variation       1871
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1568599422"
     variation       1872
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764297887"
     variation       1873
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763109321"
     variation       1874
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296720189"
     variation       1876
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1212621175"
     variation       1878
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1363734969"
     variation       1879
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1272163921"
     variation       1881
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1290075656"
     variation       1885
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1431740131"
     variation       1886
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753302376"
     variation       1891
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765803270"
     variation       1895
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1437172257"
     variation       1896
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1421460298"
     variation       1898
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138110009"
     variation       1899
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777075627"
     variation       1900
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199652968"
     variation       1904
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:772728170"
     variation       1905
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1186801962"
     variation       1907
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150349355"
     variation       1909
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747626844"
     variation       1915
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773810597"
     variation       1916
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1485690494"
     variation       1920
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761391841"
     variation       1921
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202216893"
     variation       1922
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371193579"
     variation       1923
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747310164"
     variation       1926
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777832426"
     variation       1927
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758587498"
     variation       1929
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752854954"
     variation       1930
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:377759902"
     variation       1931
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755554696"
     variation       1932
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1298118040"
     variation       1941..1949
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="aagaag"
                     /replace="aagaagaag"
                     /db_xref="dbSNP:781680429"
     variation       1942
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1056705456"
     variation       1943
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:939621457"
     variation       1948
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1249762511"
     variation       1949
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1481642813"
     variation       1953..1957
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="at"
                     /replace="atgat"
                     /db_xref="dbSNP:980905918"
     variation       1954
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754229834"
     variation       1955
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:536449963"
     variation       1956
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:777505765"
     variation       1956
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:368375280"
     variation       1958
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201961052"
     variation       1963
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:930804885"
     variation       1965
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142383251"
     variation       1966
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1388069954"
     variation       1969
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148798821"
     variation       1972
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1324294064"
     variation       1975
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1407225420"
     variation       1982
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1411933834"
     variation       1984
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298706929"
     variation       1989..1993
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="acaca"
                     /db_xref="dbSNP:1402883729"
     variation       1992
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1389838551"
     variation       1995
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1285025769"
     variation       1996
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1472518727"
     variation       2000
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1218298858"
     variation       2001
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367602756"
     variation       2002
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1019389882"
     variation       2003
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:535253175"
     variation       2005
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1265375719"
     variation       2014..2017
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="agag"
                     /db_xref="dbSNP:1270100402"
     variation       2015
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:987509992"
     variation       2017
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181267764"
     variation       2021
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867605732"
     variation       2027
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1186672715"
     variation       2029
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1488154797"
     variation       2037
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1185595889"
     variation       2039
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:62122488"
     variation       2040
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376608225"
     variation       2041
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:553702469"
     variation       2044
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1170460175"
     variation       2045
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1012057459"
     variation       2046
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:189379942"
     variation       2049
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1056585723"
     variation       2060
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184916518"
     variation       2063
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780033261"
     variation       2067
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1399112918"
     variation       2069
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1245662819"
     variation       2071
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1364269273"
     variation       2072
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1312182106"
     variation       2082
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:902547969"
     variation       2083
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1248862278"
     variation       2090
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192216899"
     variation       2098
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1293076219"
     variation       2100
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:113647041"
     variation       2101
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:946963745"
     variation       2103
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:544866397"
     variation       2104..2113
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="t"
                     /replace="ttgttttctt"
                     /db_xref="dbSNP:905409701"
     variation       2112
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:937035338"
     variation       2115
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1050362839"
     variation       2117
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1365102143"
     variation       2118
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1275466462"
     variation       2119..2121
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1438725359"
     variation       2123
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1348341080"
     variation       2131
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771969606"
     variation       2132
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77400154"
     variation       2141
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:930794695"
     variation       2143
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:920794931"
     variation       2149
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:972157870"
     variation       2151
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1156599428"
     variation       2154
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:975836451"
     variation       2155
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539826176"
     variation       2159
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1166500398"
     variation       2164
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907534199"
     variation       2165
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139078993"
     variation       2174
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:952068215"
     variation       2176
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1028864763"
     variation       2178
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376733066"
     variation       2179
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1023528590"
     variation       2180
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1286868075"
ORIGIN      
ggagattcgtgggaggaccgagcccggggatgggactggaggagtttccgtgaccttgcgggctgtttgtgctgagggacagctttatttaaataataatatgcgtgcaggcgccctgcatgattcctggccgcgtgctttctagtaagtgcgcagagacttttcgcaagaattgattcactcttttttccttccctcccgatttttgattggaaacccagacttcctttcacgcctgtcgccaggttaactaggtcactgtttgctctcaggagcaaccctgcctcccgcagttcgcttggtccttgattacaggggaggttccctgctcaagctctcttctcttgtctgctgccatgtgagacgtgcctttgaccttctgccatgattgtgaggcctccccagccacgtgaaactatatggctgcaaattgcacatcctcatggagtctaggagaatcctgcaacagacctgggttggagctgccacggtctatggcatcctcagaaactcaacttggaaatcacgacgtggaccctgagatttctcacgtgaacttcaggatgttcagctgcccgaaggagtcggaccccatccaggctctgaggaaactcactgagctgtgccatctgtggctgaggcccgacctccacaccaaagagcagatcctggacatgctggtgatggagcagttcatgatctccatgccccaggagctccaggtcttagtcatgatgaacggtgtgcagagctgcaaagacctggaggacctgctacgaaataacagaagacccaagaaatggtctgtggtcaccttccacggaaaggaatatattgtgcaggactcagatatcgagatggctgaagccccctccagtgtcagagatgatctgaaagacgtgtccagccaacgggcctcctcggtgaaccagatgcgtccaggggaaggccaggcccaccgagagctgcagatcctgcccagggtccctgcattgtccaggaggcagggagaggactttctgctacacaagagtattgacgtaacaggtgacccaaagtctctgagacccaagcagaccttggagaaggatctgaaggaaaacagggaagagaacccaggactgacatccccagagcctcagcttccaaagagtcccacagatctggtgagagcaaaggaggggaaggaccccccaaaaatagcctctgtggaaaatgtggatgctgacacaccttctgcctgcgttgtggagagagaagcttcgactcacagcgggaacagaggagacgctctgaatctgagcagtcccaaaagaagcaaaccagatgcctcctccatttcccaagaagagcctcaaggagaagccacacctgtgggcaacagagaatccccgggacaagctgggatgaattcaattcattccccaggccctgcgagcccagtcagtcacccggatggccaagaagccaaggcactgccgccctttgcatgtgacgtgtgcgagaagaggtttacgtgtaattccaagctagtcatccacaagagatcacacacaggcgagagactctttcaatgtaatctctgtgggaagcgcttcatgcagcttattagcctccaatttcaccagcgaacccacactggcgagaggccctacacgtgtgacgtctgccagaagcagttcacccagaagtcctacttgaagtgtcacaagagaagccacacaggggagaagcccttcgaatgtaaagactgcaagaaagttttcacctacagggggagcctgaaggagcaccagcgcatccactccggagagaaaccctacaaatgttccaagtgtccaagagccttcagtcggctgaaattgttaagacgccaccagaaaacacatccagaagctacttctcagtgattgcataatccggtctatgccttctgcaccaagaagaagtgaatgatatttttcatcaatgttatcagatgacatttgacacatgcaagggcgtctgacacacagagggagtgccctagatatgaattgccaggatgtttgagtaaatatgtgtcctccccactgagctttgttttctgtttcattatgtccattgttttcttataggtttattttggtttgtgttgctgttcttccaataaacgatcatcttattagttttcaatattgta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]