GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:30:03, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NM_001322067            2011 bp    mRNA    linear   PRI 05-DEC-2018
DEFINITION  Homo sapiens zinc finger and SCAN domain containing 5A (ZSCAN5A),
            transcript variant 7, mRNA.
ACCESSION   NM_001322067
VERSION     NM_001322067.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2011)
  AUTHORS   Kimura K, Wakamatsu A, Suzuki Y, Ota T, Nishikawa T, Yamashita R,
            Yamamoto J, Sekine M, Tsuritani K, Wakaguri H, Ishii S, Sugiyama T,
            Saito K, Isono Y, Irie R, Kushida N, Yoneyama T, Otsuka R, Kanda K,
            Yokoi T, Kondo H, Wagatsuma M, Murakawa K, Ishida S, Ishibashi T,
            Takahashi-Fujii A, Tanase T, Nagai K, Kikuchi H, Nakai K, Isogai T
            and Sugano S.
  TITLE     Diversification of transcriptional modulation: large-scale
            identification and characterization of putative alternative
            promoters of human genes
  JOURNAL   Genome Res. 16 (1), 55-65 (2006)
   PUBMED   16344560
REFERENCE   2  (bases 1 to 2011)
  AUTHORS   Gerhard DS, Wagner L, Feingold EA, Shenmen CM, Grouse LH, Schuler
            G, Klein SL, Old S, Rasooly R, Good P, Guyer M, Peck AM, Derge JG,
            Lipman D, Collins FS, Jang W, Sherry S, Feolo M, Misquitta L, Lee
            E, Rotmistrovsky K, Greenhut SF, Schaefer CF, Buetow K, Bonner TI,
            Haussler D, Kent J, Kiekhaus M, Furey T, Brent M, Prange C,
            Schreiber K, Shapiro N, Bhat NK, Hopkins RF, Hsie F, Driscoll T,
            Soares MB, Casavant TL, Scheetz TE, Brown-stein MJ, Usdin TB,
            Toshiyuki S, Carninci P, Piao Y, Dudekula DB, Ko MS, Kawakami K,
            Suzuki Y, Sugano S, Gruber CE, Smith MR, Simmons B, Moore T,
            Waterman R, Johnson SL, Ruan Y, Wei CL, Mathavan S, Gunaratne PH,
            Wu J, Garcia AM, Hulyk SW, Fuh E, Yuan Y, Sneed A, Kowis C, Hodgson
            A, Muzny DM, McPherson J, Gibbs RA, Fahey J, Helton E, Ketteman M,
            Madan A, Rodrigues S, Sanchez A, Whiting M, Madari A, Young AC,
            Wetherby KD, Granite SJ, Kwong PN, Brinkley CP, Pearson RL,
            Bouffard GG, Blakesly RW, Green ED, Dickson MC, Rodriguez AC,
            Grimwood J, Schmutz J, Myers RM, Butterfield YS, Griffith M,
            Griffith OL, Krzywinski MI, Liao N, Morin R, Palmquist D, Petrescu
            AS, Skalska U, Smailus DE, Stott JM, Schnerch A, Schein JE, Jones
            SJ, Holt RA, Baross A, Marra MA, Clifton S, Makowski KA, Bosak S
            and Malek J.
  CONSRTM   MGC Project Team
  TITLE     The status, quality, and expansion of the NIH full-length cDNA
            project: the Mammalian Gene Collection (MGC)
  JOURNAL   Genome Res. 14 (10B), 2121-2127 (2004)
   PUBMED   15489334
  REMARK    Erratum:[Genome Res. 2006 Jun;16(6):804. Morrin, Ryan [corrected to
            Morin, Ryan]]
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC006116.1 and AC011506.3.
            
            Transcript Variant: This variant (7), along with variants 3-6, 8,
            and 10-11, encodes isoform b.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR1803612.127904.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMEA2148093, SAMEA2158188
                                           [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-144               AC006116.1         38759-38902         c
            145-246             AC006116.1         37621-37722         c
            247-632             AC011506.3         42266-42651         c
            633-836             AC011506.3         41234-41437         c
            837-987             AC011506.3         40194-40344         c
            988-2011            AC011506.3         38906-39929         c
FEATURES             Location/Qualifiers
     source          1..2011
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="19"
                     /map="19q13.43"
     gene            1..2011
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="zinc finger and SCAN domain containing 5A"
                     /db_xref="GeneID:79149"
                     /db_xref="HGNC:HGNC:23710"
     exon            1..144
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436370726"
     variation       2
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1568744982"
     variation       6..7
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1165941836"
     variation       7
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1425713150"
     variation       8
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:926285036"
     variation       11..13
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1568744947"
     variation       14
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1361681884"
     variation       15
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1400116513"
     variation       17
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:980511780"
     variation       18
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:930381427"
     variation       19
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764155213"
     variation       20
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1055278314"
     variation       21
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756327855"
     variation       23..25
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1016268546"
     variation       24
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1210258104"
     variation       27
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1484390864"
     variation       28
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:987044286"
     variation       29
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752809911"
     variation       30
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1028311508"
     variation       39
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12973009"
     variation       43
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1257795290"
     variation       47
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:945816203"
     variation       51
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1484439682"
     variation       52
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1254686005"
     variation       59
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866198795"
     variation       60
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:912933595"
     variation       61
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1054220081"
     variation       65
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:935637530"
     variation       75
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1354342302"
     variation       79
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:921616583"
     variation       82
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:8107755"
     variation       83
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1276668648"
     variation       96..98
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="ata"
                     /db_xref="dbSNP:143531834"
     variation       100
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1568744657"
     variation       101
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184573688"
     variation       104
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1056803532"
     variation       105
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1456561897"
     variation       107
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1398080251"
     variation       112
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:867109867"
     variation       113
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1239163029"
     variation       114
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454274612"
     variation       116
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1189953392"
     variation       118
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:911724599"
     variation       126
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1415707144"
     variation       143
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:983648942"
     exon            145..246
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /inference="alignment:Splign:2.1.0"
     variation       145
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:894060388"
     variation       149
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1280543171"
     variation       158
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:549655200"
     variation       160
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:537463526"
     variation       164..169
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="ctct"
                     /replace="ctctct"
                     /db_xref="dbSNP:1279494527"
     variation       164
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1053081928"
     variation       165..175
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="tctctt"
                     /replace="tctcttctctt"
                     /db_xref="dbSNP:1219194721"
     variation       182
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34709084"
     variation       184
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149410489"
     variation       186
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1233972453"
     variation       187
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:927932605"
     variation       188
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1449944817"
     variation       189
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1361174474"
     variation       192
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1335074004"
     variation       194
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1409501624"
     variation       195
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1398245132"
     variation       206
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481238456"
     variation       217
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:528542040"
     variation       218
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1242758416"
     variation       219
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:566162679"
     variation       220
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1176676470"
     variation       224
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1568742796"
     variation       225
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:549625573"
     variation       227
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172849421"
     variation       229
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1478444016"
     variation       230
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766795772"
     variation       234
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186336270"
     variation       238
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763437142"
     variation       239
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237745021"
     misc_feature    240..242
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="upstream in-frame stop codon"
     variation       246
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1355050694"
     variation       246
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278199706"
     exon            247..632
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /inference="alignment:Splign:2.1.0"
     variation       247
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759416767"
     CDS             249..1739
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="isoform b is encoded by transcript variant 7; zinc
                     finger protein 495; zinc finger and SCAN domain containing
                     5; zinc finger and SCAN domain-containing protein 5A"
                     /codon_start=1
                     /product="zinc finger and SCAN domain-containing protein
                     5A isoform b"
                     /protein_id="NP_001308996.1"
                     /db_xref="CCDS:CCDS12941.1"
                     /db_xref="GeneID:79149"
                     /db_xref="HGNC:HGNC:23710"
                     /translation="
MAANCTSSWSLGESCNRPGLELPRSMASSETQLGNHDVDPEISHVNFRMFSCPKESDPIQALRKLTELCHLWLRPDLHTKEQILDMLVMEQFMISMPQELQVLVMMNGVQSCKDLEDLLRNNRRPKKWSVVTFHGKEYIVQDSDIEMAEAPSSVRDDLKDVSSQRASSVNQMRPGEGQAHRELQILPRVPALSRRQGEDFLLHKSIDVTGDPKSLRPKQTLEKDLKENREENPGLTSPEPQLPKSPTDLVRAKEGKDPPKIASVENVDADTPSACVVEREASTHSGNRGDALNLSSPKRSKPDASSISQEEPQGEATPVGNRESPGQAGMNSIHSPGPASPVSHPDGQEAKALPPFACDVCEKRFTCNSKLVIHKRSHTGERLFQCNLCGKRFMQLISLQFHQRTHTGERPYTCDVCQKQFTQKSYLKCHKRSHTGEKPFECKDCKKVFTYRGSLKEHQRIHSGEKPYKCSKCPRAFSRLKLLRRHQKTHPEATSQ"
     misc_feature    366..620
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="SCAN oligomerization domain; Region: SCAN; cd07936"
                     /db_xref="CDD:153421"
     misc_feature    order(387..392,396..404,417..425,429..434,441..446,
                     453..458,462..473,483..488,495..500,507..515,519..524,
                     528..539,594..596,603..608,612..620)
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:153421"
     misc_feature    <885..>1313
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="Treacher Collins syndrome protein Treacle; Region:
                     Treacle; pfam03546"
                     /db_xref="CDD:308903"
     misc_feature    <1263..1724
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="FOG: Zn-finger [General function prediction only];
                     Region: COG5048"
                     /db_xref="CDD:227381"
     misc_feature    1320..1382
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn
                     finger"
                     /db_xref="CDD:275368"
     misc_feature    order(1320..1322,1329..1331,1368..1370,1380..1382)
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:275368"
     misc_feature    1404..1466
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn
                     finger"
                     /db_xref="CDD:275368"
     misc_feature    order(1404..1406,1413..1415,1452..1454,1464..1466)
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:275368"
     misc_feature    1440..1517
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="Zinc-finger double domain; Region: zf-H2C2_2;
                     pfam13465"
                     /db_xref="CDD:316026"
     misc_feature    1488..1550
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn
                     finger"
                     /db_xref="CDD:275368"
     misc_feature    order(1488..1490,1497..1499,1536..1538,1548..1550)
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:275368"
     misc_feature    order(1503..1505,1509..1511,1515..1517,1521..1526,
                     1533..1538,1545..1547,1587..1589,1593..1595,1605..1610,
                     1617..1622,1629..1631,1671..1673,1677..1679,1683..1685,
                     1689..1694,1701..1706,1713..1715)
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="putative nucleic acid binding site [nucleotide
                     binding]; other site"
                     /db_xref="CDD:275368"
     misc_feature    1572..1634
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn
                     finger"
                     /db_xref="CDD:275368"
     misc_feature    order(1572..1574,1581..1583,1620..1622,1632..1634)
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:275368"
     misc_feature    1608..1685
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="Zinc-finger double domain; Region: zf-H2C2_2;
                     pfam13465"
                     /db_xref="CDD:316026"
     misc_feature    1656..1718
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn
                     finger"
                     /db_xref="CDD:275368"
     misc_feature    order(1656..1658,1665..1667,1704..1706,1716..1718)
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:275368"
     variation       249
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:765269516"
     variation       254
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200884320"
     variation       256
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766094247"
     variation       260
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760459681"
     variation       261
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774614802"
     variation       262
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775624525"
     variation       263
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1363805885"
     variation       272
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373938329"
     variation       274
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1242687972"
     variation       276
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1015349106"
     variation       279
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368670022"
     variation       281
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363696128"
     variation       283
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142822213"
     variation       288
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775462486"
     variation       290
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1473788109"
     variation       291
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201140936"
     variation       292
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198240932"
     variation       296
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1330585976"
     variation       298
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1302156262"
     variation       299
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746372429"
     variation       300
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112550672"
     variation       304
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1268909867"
     variation       307
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781673650"
     variation       312
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771485540"
     variation       317
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1012832889"
     variation       318
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149425471"
     variation       319
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777612921"
     variation       320
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758159159"
     variation       323
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752348974"
     variation       324
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1223191449"
     variation       327
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778303494"
     variation       328
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:754446242"
     variation       329
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:753787290"
     variation       333
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766292035"
     variation       334
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1287660582"
     variation       337
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:755953393"
     variation       346
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1389854732"
     variation       353
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536245284"
     variation       356
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139035140"
     variation       357
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:543522736"
     variation       359
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777058512"
     variation       360
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:550648749"
     variation       361
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:531042856"
     variation       366
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:945144346"
     variation       368
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138415436"
     variation       373
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747763578"
     variation       376
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376633535"
     variation       380
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150105146"
     variation       381
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748809925"
     variation       386
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1258004722"
     variation       395
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200848409"
     variation       401
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140787974"
     variation       406
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756076357"
     variation       407
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750310913"
     variation       408
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201874615"
     variation       409
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:757008317"
     variation       410
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1413148211"
     variation       415
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150925266"
     variation       416
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765481925"
     variation       417
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:974056867"
     variation       420
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1461123353"
     variation       426
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867974029"
     variation       428
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759580162"
     variation       429
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776817209"
     variation       440
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766522832"
     variation       444
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761280855"
     variation       457
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436150555"
     variation       459
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773792328"
     variation       461
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1568609131"
     variation       473
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373202448"
     variation       474
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371935466"
     variation       482
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376204582"
     variation       484
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:982577386"
     variation       491
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367880708"
     variation       492
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1409286401"
     variation       493
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1395888384"
     variation       500
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773925891"
     variation       501
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768324013"
     variation       506
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:528793290"
     variation       513
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1392357412"
     variation       515
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1300974044"
     variation       518
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1342904429"
     variation       519
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1315010377"
     variation       531
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779562174"
     variation       532
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1302878387"
     variation       534
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755562475"
     variation       537
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1348062471"
     variation       540
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1203771251"
     variation       543
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745808092"
     variation       551
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1390530216"
     variation       557
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:781100410"
     variation       562
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201600248"
     variation       564
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200493184"
     variation       567
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779039539"
     variation       569
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755255762"
     variation       570
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143462624"
     variation       571
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374088582"
     variation       573
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141426263"
     variation       580
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1166742592"
     variation       584
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1003158548"
     variation       586
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1356824594"
     variation       590
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768047832"
     variation       599
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:762126209"
     variation       600
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1020466986"
     variation       606
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774809636"
     variation       607
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:73619433"
     variation       614
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762607068"
     variation       616
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1227165658"
     variation       619
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775056079"
     variation       625
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:769359428"
     variation       628
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1229403566"
     exon            633..836
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /inference="alignment:Splign:2.1.0"
     variation       634
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773021892"
     variation       638
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1368883049"
     variation       639
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189644637"
     variation       640
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1325604605"
     variation       642
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144517223"
     variation       649
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479065619"
     variation       650
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147680558"
     variation       651
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188499793"
     variation       653
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1463923285"
     variation       656
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1270489245"
     variation       660
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780465273"
     variation       661
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1322451938"
     variation       669
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756436404"
     variation       670
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746040402"
     variation       672
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213445099"
     variation       678
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013394886"
     variation       682
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781344716"
     variation       683
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140466399"
     variation       684
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145011101"
     variation       685
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1367234162"
     variation       686
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758808063"
     variation       687
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1469122932"
     variation       693
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1205973207"
     variation       700
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759720886"
     variation       701
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759204689"
     variation       702
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1416325075"
     variation       703
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150002888"
     variation       705
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1168030056"
     variation       717
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139322292"
     variation       720
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760092983"
     variation       721
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1189715420"
     variation       724
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773253511"
     variation       726
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1236034703"
     variation       728
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111907569"
     variation       729
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368509037"
     variation       730
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746106028"
     variation       731
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763156569"
     variation       734
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781265590"
     variation       735
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199964698"
     variation       740
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747034599"
     variation       741
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201225377"
     variation       742
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200678839"
     variation       744
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1304354265"
     variation       747
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765594071"
     variation       748
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1286568737"
     variation       749
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:914983296"
     variation       750
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141990164"
     variation       751
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753586762"
     variation       752
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201727637"
     variation       754
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760274039"
     variation       755
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772630163"
     variation       759
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762366673"
     variation       762
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201825488"
     variation       764
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1183933184"
     variation       765
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768639394"
     variation       766
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375744187"
     variation       770
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199886337"
     variation       773
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1187948759"
     variation       774
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1202541382"
     variation       775..781
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="aaggcca"
                     /replace="aaggccaaggcca"
                     /db_xref="dbSNP:776494916"
     variation       777
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762640862"
     variation       780
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1274656497"
     variation       782..784
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="ggc"
                     /db_xref="dbSNP:1164786006"
     variation       784
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:776959267"
     variation       785
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367599578"
     variation       786
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1314655845"
     variation       787
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61736534"
     variation       789
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777848514"
     variation       790
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748724493"
     variation       794
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765368134"
     variation       797
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1414104798"
     variation       799
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779383095"
     variation       800
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1399688711"
     variation       805
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776925397"
     variation       806
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346525169"
     variation       808
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754123866"
     variation       809
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1348625983"
     variation       810
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780427415"
     variation       812
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1568606103"
     variation       815
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755747347"
     variation       816
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:991659846"
     variation       817
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568606072"
     variation       821
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4801692"
     variation       822
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143076677"
     variation       828
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1473360888"
     variation       829
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1251988547"
     variation       830
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1208693820"
     variation       832
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1487490655"
     variation       833
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1329028809"
     exon            837..987
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /inference="alignment:Splign:2.1.0"
     variation       837
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752618641"
     variation       839
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764941691"
     variation       842
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770631493"
     variation       846
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277082812"
     variation       848
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773477056"
     variation       849
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761986359"
     variation       851
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:527674624"
     variation       854
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1319020766"
     variation       856
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138391803"
     variation       862
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1456998392"
     variation       866
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143209101"
     variation       867
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381699289"
     variation       869
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746211159"
     variation       870
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149533881"
     variation       871
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1422920448"
     variation       872
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757000446"
     variation       873
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002851045"
     variation       876
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376620359"
     variation       877
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777158698"
     variation       879
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1190390490"
     variation       883
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757855433"
     variation       884
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:923976422"
     variation       887
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:977963990"
     variation       888
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:576450386"
     variation       889
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1343129395"
     variation       890
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1257876094"
     variation       892
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:971073966"
     variation       898
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765201989"
     variation       904
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373606524"
     variation       905
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1316444550"
     variation       908
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1231169189"
     variation       912
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754811958"
     variation       917
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149479488"
     variation       919
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:766115556"
     variation       920
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:959240087"
     variation       923
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457842727"
     variation       924
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1313061260"
     variation       926
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1428578747"
     variation       928
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1387716387"
     variation       930
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:546332373"
     variation       938
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:577513858"
     variation       939
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1367744432"
     variation       941
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764148776"
     variation       944
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568603953"
     variation       947
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1440957615"
     variation       948
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:573687081"
     variation       949
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763074148"
     variation       953
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775908186"
     variation       954
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:770303549"
     variation       955
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1006010126"
     variation       956
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1463840782"
     variation       958
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1173157535"
     variation       966
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:950351225"
     variation       969
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1026009423"
     variation       972
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1464708925"
     variation       974
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:997211124"
     variation       976
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370671539"
     variation       977
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777154770"
     variation       980
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771360506"
     variation       981
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746661136"
     variation       986
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138065226"
     exon            988..2011
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /inference="alignment:Splign:2.1.0"
     variation       991
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759681374"
     variation       993
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754451246"
     variation       995
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1343686122"
     variation       996
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200579325"
     variation       998
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1568603105"
     variation       999
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761049322"
     variation       1000
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1371614696"
     variation       1002
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1319753986"
     variation       1003
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773652552"
     variation       1004
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1043111296"
     variation       1007
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:267605713"
     variation       1010
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1432676836"
     variation       1013
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1449167317"
     variation       1017
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772271198"
     variation       1018
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376227013"
     variation       1019..1024
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="ccccc"
                     /replace="cccccc"
                     /db_xref="dbSNP:1568602903"
     variation       1019
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:75630877"
     variation       1020
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:943302585"
     variation       1021
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141071964"
     variation       1023
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1170863184"
     variation       1024..1025
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="ag"
                     /replace="ca"
                     /db_xref="dbSNP:386811187"
     variation       1024
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:531717987"
     variation       1025
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:562997139"
     variation       1026
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188440623"
     variation       1028
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:769752546"
     variation       1029
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1298190151"
     variation       1030
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371706721"
     variation       1036
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1216130869"
     variation       1037
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781053046"
     variation       1038
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756931660"
     variation       1039
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753025630"
     variation       1041
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746812478"
     variation       1043
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1347924314"
     variation       1046
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1256436567"
     variation       1051
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779261455"
     variation       1060
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199734240"
     variation       1062
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369979986"
     variation       1063..1067
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="ct"
                     /replace="cttct"
                     /db_xref="dbSNP:781592643"
     variation       1065
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1367170573"
     variation       1066
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754005392"
     variation       1068
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766521204"
     variation       1070
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756662052"
     variation       1071
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750830064"
     variation       1072
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767992521"
     variation       1073
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1436693020"
     variation       1074
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762073087"
     variation       1080
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774040814"
     variation       1083
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763703447"
     variation       1085
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762551023"
     variation       1093
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146091512"
     variation       1094
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758759166"
     variation       1098
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745819251"
     variation       1100
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1212496803"
     variation       1103
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376507043"
     variation       1104
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770814502"
     variation       1108
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142298937"
     variation       1116
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373460555"
     variation       1118
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150978724"
     variation       1119
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142635871"
     variation       1121
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376644398"
     variation       1126
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541954467"
     variation       1128
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780289351"
     variation       1131
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1399171539"
     variation       1133
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:540546268"
     variation       1134
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369166936"
     variation       1138
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757681849"
     variation       1139
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:554150542"
     variation       1140
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1320023602"
     variation       1145
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:751950329"
     variation       1146
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423606016"
     variation       1150
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764392490"
     variation       1153
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762607046"
     variation       1154
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775056297"
     variation       1156
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:764864405"
     variation       1157
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145786370"
     variation       1160
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1031165831"
     variation       1161
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:150193964"
     variation       1165
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770740273"
     variation       1172
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746897980"
     variation       1176
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773158381"
     variation       1180
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:575289949"
     variation       1181
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780127351"
     variation       1183
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:957040506"
     variation       1188
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756269092"
     variation       1189
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745906838"
     variation       1191
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781291200"
     variation       1192
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757726095"
     variation       1197
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752005370"
     variation       1198
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:889057869"
     variation       1201
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375144691"
     variation       1203
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457835463"
     variation       1208
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1419087095"
     variation       1209
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1348572050"
     variation       1210
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112797581"
     variation       1214
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:140003734"
     variation       1217
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1461687779"
     variation       1219
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274868780"
     variation       1222
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146066402"
     variation       1223
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142326109"
     variation       1225
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764771843"
     variation       1228
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1302516361"
     variation       1230
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759123388"
     variation       1234
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1230111602"
     variation       1238
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1315890203"
     variation       1240
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1190599831"
     variation       1241
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:566696787"
     variation       1242
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1353068534"
     variation       1245
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1254701329"
     variation       1246
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1214068737"
     variation       1247
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1328165333"
     variation       1248
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765860208"
     variation       1252
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1447964428"
     variation       1254
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760696171"
     variation       1255
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372118564"
     variation       1256
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:773281724"
     variation       1257
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772051310"
     variation       1258
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:34187696"
     variation       1259
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150874997"
     variation       1261
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781144172"
     variation       1264..1265
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="ag"
                     /db_xref="dbSNP:1409321067"
     variation       1264
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770929966"
     variation       1265
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388275865"
     variation       1266
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369515811"
     variation       1267
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:917909045"
     variation       1268..1270
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="ccc"
                     /db_xref="dbSNP:1568601473"
     variation       1269
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1410021145"
     variation       1271
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778235623"
     variation       1272..1277
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="gtcagt"
                     /db_xref="dbSNP:1396834795"
     variation       1272
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1174707253"
     variation       1274
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758807941"
     variation       1280..1282
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1349591254"
     variation       1280
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200236800"
     variation       1281
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754602114"
     variation       1282..1283
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="ca"
                     /db_xref="dbSNP:1568601351"
     variation       1282
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141546124"
     variation       1283
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765875730"
     variation       1284..1285
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="ga"
                     /db_xref="dbSNP:1568601299"
     variation       1284
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:929236830"
     variation       1285
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:897634015"
     variation       1286
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1040182401"
     variation       1292
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376538628"
     variation       1293
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201043563"
     variation       1297
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:910267008"
     variation       1298
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:767531928"
     variation       1299
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306271519"
     variation       1302
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201814043"
     variation       1303
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774035887"
     variation       1304
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:531722937"
     variation       1305
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759680447"
     variation       1309
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61736533"
     variation       1312
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771052526"
     variation       1313
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:552619938"
     variation       1325
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144472423"
     variation       1326
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368749222"
     variation       1331
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:181999776"
     variation       1332
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748955875"
     variation       1334
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1029947326"
     variation       1337
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1428847488"
     variation       1343
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779831050"
     variation       1345
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1200016620"
     variation       1346
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755725806"
     variation       1348
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1282542978"
     variation       1354
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:267605712"
     variation       1359
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749986484"
     variation       1361
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769527556"
     variation       1363
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268836925"
     variation       1365
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1230100724"
     variation       1372
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764198709"
     variation       1376
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373715695"
     variation       1379
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:556354363"
     variation       1381
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002322602"
     variation       1383
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1412527430"
     variation       1385
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757272050"
     variation       1388
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:540386597"
     variation       1389
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1309243403"
     variation       1389
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142761513"
     variation       1394
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138632150"
     variation       1395
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:887596912"
     variation       1396
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766554094"
     variation       1398..1400
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:757629283"
     variation       1399
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198134919"
     variation       1400
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1244857477"
     variation       1401
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760843837"
     variation       1402
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1462311947"
     variation       1403
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773300751"
     variation       1408
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1199796859"
     variation       1412
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748673755"
     variation       1414
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774911834"
     variation       1415
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768951640"
     variation       1419
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1040699984"
     variation       1421
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1397352549"
     variation       1422
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141778812"
     variation       1423
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767840197"
     variation       1428
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1271541908"
     variation       1429
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:780526729"
     variation       1430
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1159063289"
     variation       1434
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755854941"
     variation       1435
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1405947331"
     variation       1436
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278029108"
     variation       1437
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1338892198"
     variation       1439
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1216451336"
     variation       1440
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1271546678"
     variation       1443
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371435309"
     variation       1445
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1208689694"
     variation       1447
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780851722"
     variation       1448
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756785643"
     variation       1453
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751509325"
     variation       1455
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:935777084"
     variation       1457
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:935576464"
     variation       1459
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1333412548"
     variation       1463
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202185472"
     variation       1467
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762646155"
     variation       1470
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1391880425"
     variation       1472
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752565451"
     variation       1479
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:979644056"
     variation       1482
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:764960786"
     variation       1485
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1420320327"
     variation       1486
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760894715"
     variation       1487
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543909314"
     variation       1492
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:767645679"
     variation       1493
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761935616"
     variation       1494
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151298410"
     variation       1501
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1312356736"
     variation       1505
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769241349"
     variation       1506
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1212239028"
     variation       1518
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749713033"
     variation       1526
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776012886"
     variation       1527
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:879111754"
     variation       1528
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1360973466"
     variation       1529
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770214112"
     variation       1532
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:926806437"
     variation       1535
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:986319839"
     variation       1537
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1347992536"
     variation       1538
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745578928"
     variation       1551
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:953131591"
     variation       1554
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760512080"
     variation       1555
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1206634336"
     variation       1556
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1262710280"
     variation       1568
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780974355"
     variation       1569
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373832268"
     variation       1571
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1207958029"
     variation       1576
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1245081507"
     variation       1578
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746496094"
     variation       1584
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777107193"
     variation       1585
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1378959092"
     variation       1586
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758381341"
     variation       1589
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752570364"
     variation       1601
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1400337385"
     variation       1603
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:997107282"
     variation       1604
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778748709"
     variation       1605..1609
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="gggag"
                     /db_xref="dbSNP:1311715337"
     variation       1606
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1401934021"
     variation       1607
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1470525817"
     variation       1610..1611
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="aaat"
                     /db_xref="dbSNP:1302215050"
     variation       1610
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754756520"
     variation       1611
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750694178"
     variation       1616
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1165279042"
     variation       1626
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1027751672"
     variation       1627
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767752949"
     variation       1628
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761905483"
     variation       1629
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:751685333"
     variation       1630
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370816406"
     variation       1637
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202145068"
     variation       1638
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770336761"
     variation       1639
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759953639"
     variation       1641
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776463840"
     variation       1646
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375794609"
     variation       1649
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746592895"
     variation       1650
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142259207"
     variation       1651
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1261161283"
     variation       1652
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771480317"
     variation       1654
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748143740"
     variation       1658
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1401366145"
     variation       1660
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778801688"
     variation       1664
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200882365"
     variation       1666
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1172385623"
     variation       1667
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754807953"
     variation       1668
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753667989"
     variation       1669
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779668524"
     variation       1680
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757517666"
     variation       1681
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1243518159"
     variation       1683
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751669053"
     variation       1685
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1441346322"
     variation       1687
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1387807684"
     variation       1688
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1277553411"
     variation       1700
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1568599422"
     variation       1701
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764297887"
     variation       1702
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763109321"
     variation       1703
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296720189"
     variation       1705
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1212621175"
     variation       1707
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1363734969"
     variation       1708
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1272163921"
     variation       1710
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1290075656"
     variation       1714
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1431740131"
     variation       1715
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753302376"
     variation       1720
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765803270"
     variation       1724
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1437172257"
     variation       1725
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1421460298"
     variation       1727
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138110009"
     variation       1728
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777075627"
     variation       1729
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199652968"
     variation       1733
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:772728170"
     variation       1734
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1186801962"
     variation       1736
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150349355"
     variation       1738
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747626844"
     variation       1744
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773810597"
     variation       1745
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1485690494"
     variation       1749
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761391841"
     variation       1750
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202216893"
     variation       1751
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371193579"
     variation       1752
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747310164"
     variation       1755
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777832426"
     variation       1756
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758587498"
     variation       1758
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752854954"
     variation       1759
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:377759902"
     variation       1760
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755554696"
     variation       1761
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1298118040"
     variation       1770..1778
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="aagaag"
                     /replace="aagaagaag"
                     /db_xref="dbSNP:781680429"
     variation       1771
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1056705456"
     variation       1772
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:939621457"
     variation       1777
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1249762511"
     variation       1778
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1481642813"
     variation       1782..1786
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="at"
                     /replace="atgat"
                     /db_xref="dbSNP:980905918"
     variation       1783
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754229834"
     variation       1784
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:536449963"
     variation       1785
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:777505765"
     variation       1785
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:368375280"
     variation       1787
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201961052"
     variation       1792
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:930804885"
     variation       1794
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142383251"
     variation       1795
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1388069954"
     variation       1798
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148798821"
     variation       1801
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1324294064"
     variation       1804
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1407225420"
     variation       1811
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1411933834"
     variation       1813
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298706929"
     variation       1818..1822
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="acaca"
                     /db_xref="dbSNP:1402883729"
     variation       1821
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1389838551"
     variation       1824
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1285025769"
     variation       1825
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1472518727"
     variation       1829
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1218298858"
     variation       1830
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367602756"
     variation       1831
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1019389882"
     variation       1832
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:535253175"
     variation       1834
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1265375719"
     variation       1843..1846
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace=""
                     /replace="agag"
                     /db_xref="dbSNP:1270100402"
     variation       1844
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:987509992"
     variation       1846
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181267764"
     variation       1850
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867605732"
     variation       1856
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1186672715"
     variation       1858
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1488154797"
     variation       1866
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1185595889"
     variation       1868
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:62122488"
     variation       1869
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376608225"
     variation       1870
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:553702469"
     variation       1873
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1170460175"
     variation       1874
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1012057459"
     variation       1875
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:189379942"
     variation       1878
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1056585723"
     variation       1889
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184916518"
     variation       1892
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780033261"
     variation       1896
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1399112918"
     variation       1898
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1245662819"
     variation       1900
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1364269273"
     variation       1901
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1312182106"
     variation       1911
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:902547969"
     variation       1912
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1248862278"
     variation       1919
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192216899"
     variation       1927
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1293076219"
     variation       1929
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:113647041"
     variation       1930
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:946963745"
     variation       1932
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:544866397"
     variation       1933..1942
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="t"
                     /replace="ttgttttctt"
                     /db_xref="dbSNP:905409701"
     variation       1941
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:937035338"
     variation       1944
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1050362839"
     variation       1946
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1365102143"
     variation       1947
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1275466462"
     variation       1948..1950
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1438725359"
     variation       1952
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1348341080"
     variation       1960
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771969606"
     variation       1961
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77400154"
     variation       1970
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:930794695"
     variation       1972
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:920794931"
     variation       1978
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:972157870"
     variation       1980
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1156599428"
     variation       1983
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:975836451"
     variation       1984
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539826176"
     variation       1988
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1166500398"
     variation       1993
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907534199"
     variation       1994
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139078993"
     variation       2003
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:952068215"
     variation       2005
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1028864763"
     variation       2007
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376733066"
     variation       2008
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1023528590"
     variation       2009
                     /gene="ZSCAN5A"
                     /gene_synonym="ZNF495; ZSCAN5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1286868075"
ORIGIN      
ggagattcgtgggaggaccgagcccggggatgggactggaggagtttccgtgaccttgcgggctgtttgtgctgagggacagctttatttaaataataatatgcgtgcaggcgccctgcatgattcctggccgcgtgctttctagggaggttccctgctcaagctctcttctcttgtctgctgccatgtgagacgtgcctttgaccttctgccatgattgtgaggcctccccagccacgtgaaactatatggctgcaaattgcacatcctcatggagtctaggagaatcctgcaacagacctgggttggagctgccacggtctatggcatcctcagaaactcaacttggaaatcacgacgtggaccctgagatttctcacgtgaacttcaggatgttcagctgcccgaaggagtcggaccccatccaggctctgaggaaactcactgagctgtgccatctgtggctgaggcccgacctccacaccaaagagcagatcctggacatgctggtgatggagcagttcatgatctccatgccccaggagctccaggtcttagtcatgatgaacggtgtgcagagctgcaaagacctggaggacctgctacgaaataacagaagacccaagaaatggtctgtggtcaccttccacggaaaggaatatattgtgcaggactcagatatcgagatggctgaagccccctccagtgtcagagatgatctgaaagacgtgtccagccaacgggcctcctcggtgaaccagatgcgtccaggggaaggccaggcccaccgagagctgcagatcctgcccagggtccctgcattgtccaggaggcagggagaggactttctgctacacaagagtattgacgtaacaggtgacccaaagtctctgagacccaagcagaccttggagaaggatctgaaggaaaacagggaagagaacccaggactgacatccccagagcctcagcttccaaagagtcccacagatctggtgagagcaaaggaggggaaggaccccccaaaaatagcctctgtggaaaatgtggatgctgacacaccttctgcctgcgttgtggagagagaagcttcgactcacagcgggaacagaggagacgctctgaatctgagcagtcccaaaagaagcaaaccagatgcctcctccatttcccaagaagagcctcaaggagaagccacacctgtgggcaacagagaatccccgggacaagctgggatgaattcaattcattccccaggccctgcgagcccagtcagtcacccggatggccaagaagccaaggcactgccgccctttgcatgtgacgtgtgcgagaagaggtttacgtgtaattccaagctagtcatccacaagagatcacacacaggcgagagactctttcaatgtaatctctgtgggaagcgcttcatgcagcttattagcctccaatttcaccagcgaacccacactggcgagaggccctacacgtgtgacgtctgccagaagcagttcacccagaagtcctacttgaagtgtcacaagagaagccacacaggggagaagcccttcgaatgtaaagactgcaagaaagttttcacctacagggggagcctgaaggagcaccagcgcatccactccggagagaaaccctacaaatgttccaagtgtccaagagccttcagtcggctgaaattgttaagacgccaccagaaaacacatccagaagctacttctcagtgattgcataatccggtctatgccttctgcaccaagaagaagtgaatgatatttttcatcaatgttatcagatgacatttgacacatgcaagggcgtctgacacacagagggagtgccctagatatgaattgccaggatgtttgagtaaatatgtgtcctccccactgagctttgttttctgtttcattatgtccattgttttcttataggtttattttggtttgtgttgctgttcttccaataaacgatcatcttattagttttcaatattgta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]