GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 03:40:05, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NM_001319848            2132 bp    mRNA    linear   PRI 26-NOV-2019
DEFINITION  Homo sapiens ubiquitin specific peptidase 21 (USP21), transcript
            variant 5, mRNA.
ACCESSION   NM_001319848
VERSION     NM_001319848.2
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2132)
  AUTHORS   Hou P, Ma X, Zhang Q, Wu CJ, Liao W, Li J, Wang H, Zhao J, Zhou X,
            Guan C, Ackroyd J, Jiang S, Zhang J, Spring DJ, Wang YA and DePinho
            RA.
  TITLE     USP21 deubiquitinase promotes pancreas cancer cell stemness via Wnt
            pathway activation
  JOURNAL   Genes Dev. 33 (19-20), 1361-1366 (2019)
   PUBMED   31488580
  REMARK    GeneRIF: work identifies and validates USP21 as a PDAC oncogene
REFERENCE   2  (bases 1 to 2132)
  AUTHORS   Liu J, Kruswick A, Dang H, Tran AD, Kwon SM, Wang XW and
            Oberdoerffer P.
  TITLE     Ubiquitin-specific protease 21 stabilizes BRCA2 to control DNA
            repair and tumor growth
  JOURNAL   Nat Commun 8 (1), 137 (2017)
   PUBMED   28743957
  REMARK    GeneRIF: USP21 interacts with, deubiquitinates and stabilizes BRCA2
            to promote efficient RAD51 loading at DNA double-strand breaks.
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 2132)
  AUTHORS   Chen Y, Wang L, Jin J, Luan Y, Chen C, Li Y, Chu H, Wang X, Liao G,
            Yu Y, Teng H, Wang Y, Pan W, Fang L, Liao L, Jiang Z, Ge X, Li B
            and Wang P.
  TITLE     p38 inhibition provides anti-DNA virus immunity by regulation of
            USP21 phosphorylation and STING activation
  JOURNAL   J. Exp. Med. 214 (4), 991-1010 (2017)
   PUBMED   28254948
  REMARK    GeneRIF: a critical role of p38-mediated USP21 phosphorylation in
            regulating STING-mediated antiviral functions and identifies
            p38-USP21 axis as an important pathway that DNA virus adopts to
            avoid innate immunity responses.
REFERENCE   4  (bases 1 to 2132)
  AUTHORS   Kwon SK, Lee DH, Kim SY, Park JH, Choi J and Baek KH.
  TITLE     Ubiquitin-specific protease 21 regulating the K48-linked
            polyubiquitination of NANOG
  JOURNAL   Biochem. Biophys. Res. Commun. 482 (4), 1443-1448 (2017)
   PUBMED   27956178
  REMARK    GeneRIF: USP21 specifically regulates the Lys48-linked
            polyubiquitination and stability of NANOG
REFERENCE   5  (bases 1 to 2132)
  AUTHORS   Heride C, Rigden DJ, Bertsoulaki E, Cucchi D, De Smaele E, Clague
            MJ and Urbe S.
  TITLE     The centrosomal deubiquitylase USP21 regulates Gli1 transcriptional
            activity and stability
  JOURNAL   J. Cell. Sci. 129 (21), 4001-4013 (2016)
   PUBMED   27621083
  REMARK    GeneRIF: USP21 recruits and stabilises Gli1 at the centrosome.
REFERENCE   6  (bases 1 to 2132)
  AUTHORS   Urbe S, Liu H, Hayes SD, Heride C, Rigden DJ and Clague MJ.
  TITLE     Systematic survey of deubiquitinase localization identifies USP21
            as a regulator of centrosome- and microtubule-associated functions
  JOURNAL   Mol. Biol. Cell 23 (6), 1095-1103 (2012)
   PUBMED   22298430
  REMARK    GeneRIF: Study observed a reduction in the number of A549 cells
            developing a primary cilium upon serum starvation when USP21 was
            depleted with two independent siRNA oligos.
REFERENCE   7  (bases 1 to 2132)
  AUTHORS   Ye Y, Akutsu M, Reyes-Turcu F, Enchev RI, Wilkinson KD and Komander
            D.
  TITLE     Polyubiquitin binding and cross-reactivity in the USP domain
            deubiquitinase USP21
  JOURNAL   EMBO Rep. 12 (4), 350-357 (2011)
   PUBMED   21399617
  REMARK    GeneRIF: Study report that USP21 cleaves Ub polymers, and with
            reduced activity also targets ISG15, but is inactive against NEDD8.
REFERENCE   8  (bases 1 to 2132)
  AUTHORS   Xu G, Tan X, Wang H, Sun W, Shi Y, Burlingame S, Gu X, Cao G, Zhang
            T, Qin J and Yang J.
  TITLE     Ubiquitin-specific peptidase 21 inhibits tumor necrosis factor
            alpha-induced nuclear factor kappaB activation via binding to and
            deubiquitinating receptor-interacting protein 1
  JOURNAL   J. Biol. Chem. 285 (2), 969-978 (2010)
   PUBMED   19910467
  REMARK    GeneRIF: USP21 plays an important role in the down-regulation of
            TNFalpha-induced NF-kappaB activation through deubiquitinating
            RIP1.
REFERENCE   9  (bases 1 to 2132)
  AUTHORS   Gong L, Kamitani T, Millas S and Yeh ET.
  TITLE     Identification of a novel isopeptidase with dual specificity for
            ubiquitin- and NEDD8-conjugated proteins
  JOURNAL   J. Biol. Chem. 275 (19), 14212-14216 (2000)
   PUBMED   10799498
REFERENCE   10 (bases 1 to 2132)
  AUTHORS   Smith TS and Southan C.
  TITLE     Sequencing, tissue distribution and chromosomal assignment of a
            novel ubiquitin-specific protease USP23
  JOURNAL   Biochim. Biophys. Acta 1490 (1-2), 184-188 (2000)
   PUBMED   10786635
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DA000829.1, AF217979.1,
            AF233442.1 and AI038040.1.
            On May 31, 2019 this sequence version replaced NM_001319848.1.
            
            Summary: This gene encodes a member of the C19 peptidase family,
            also known as family 2 of ubiquitin carboxy-terminal hydrolases.
            The encoded protein cleaves ubiquitin from ubiquitinated proteins
            for recycling in intracellular protein degradation. The encoded
            protein is also able to release NEDD8, a ubiquitin-like protein,
            from NEDD8-conjugated proteins. This gene has been referred to as
            USP16 and USP23 but is now known as USP21. Alternatively spliced
            transcript variants encoding different isoforms have been found for
            this gene. [provided by RefSeq, Feb 2016].
            
            Transcript Variant: This variant (5) differs in the 5' UTR and
            coding sequence and uses an alternate in-frame splice junction in
            the 3' end compared to variant 4. The resulting isoform (b) is
            shorter at the N-terminus and lacks an alternate internal segment
            compared to isoform a.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF217979.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA1965299, SAMEA1968540
                                           [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-37                DA000829.1         43-79
            38-764              AF217979.1         1-727
            765-1014            AF233442.1         739-988
            1015-1807           AF217979.1         975-1767
            1808-2125           AF233442.1         1824-2141
            2126-2132           AI038040.1         8-14                c
FEATURES             Location/Qualifiers
     source          1..2132
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1q23.3"
     gene            1..2132
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /note="ubiquitin specific peptidase 21"
                     /db_xref="GeneID:27005"
                     /db_xref="HGNC:HGNC:12620"
                     /db_xref="MIM:604729"
     exon            1..179
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="gccg"
                     /replace="gccggtggccg"
                     /replace="gccggtggccggtggccg"
                     /db_xref="dbSNP:3841331"
     variation       7
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366304902"
     variation       9
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1377400748"
     variation       10
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1310181850"
     variation       11
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1444658382"
     variation       15
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1352828505"
     variation       20
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978508891"
     variation       21..23
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1486278284"
     variation       22
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1406430390"
     variation       23
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1368060770"
     variation       27..35
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="ggcggc"
                     /replace="ggcggcggc"
                     /db_xref="dbSNP:1162249922"
     variation       28
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1557999285"
     variation       29
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199955506"
     variation       30
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:574535198"
     variation       32
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1178561456"
     variation       33
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1468340643"
     variation       34
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:925262965"
     variation       36
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1221721570"
     variation       37
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1490702404"
     variation       38
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1426903854"
     variation       39
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1289451839"
     variation       40
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:936759820"
     variation       44
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1185325919"
     variation       46
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225683381"
     variation       49
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1371506111"
     variation       50
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1279011326"
     variation       51
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1437223096"
     variation       59
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1243629515"
     variation       62
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:944619354"
     variation       63
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1438890927"
     variation       67
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1156588596"
     variation       68
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1038920475"
     variation       69
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1161783645"
     variation       74
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1365200626"
     variation       76
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:947814268"
     variation       77
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:900304631"
     variation       78
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:895352220"
     variation       80
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112604935"
     variation       83
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1266171865"
     variation       88
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1403220877"
     variation       89
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198586585"
     variation       91
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:886119324"
     variation       93..99
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="gggggg"
                     /replace="ggggggg"
                     /replace="gggggggg"
                     /db_xref="dbSNP:1262243998"
     variation       93
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1004583454"
     variation       94
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1046673372"
     variation       95
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:886704992"
     variation       98
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:537144107"
     variation       105
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1031113402"
     variation       105
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1232767863"
     variation       113
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1557999516"
     misc_feature    114..116
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /note="upstream in-frame stop codon"
     variation       114
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750709377"
     variation       116..136
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="gggggtggccctgaactgggg"
                     /replace="gggggtggccctgaactggggggtggccctgaactgggg"
                     /db_xref="dbSNP:1176257500"
     variation       116
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1325786979"
     variation       117
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1426589101"
     variation       120
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1204345281"
     variation       133
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:956987927"
     variation       134
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1015679303"
     variation       137
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:986858621"
     variation       140
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757153392"
     variation       144
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1263687993"
     variation       151
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368750833"
     variation       157
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:995292059"
     variation       159
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1485385009"
     variation       161
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:556790397"
     variation       163
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:953881564"
     variation       170
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1462855011"
     variation       177
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1261310605"
     exon            180..800
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       184
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1379858238"
     variation       186
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373250780"
     variation       191
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745980122"
     variation       192
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1376418783"
     variation       198
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758436746"
     CDS             201..1856
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /EC_number="3.4.19.12"
                     /note="isoform b is encoded by transcript variant 5;
                     ubiquitin specific protease 21; ubiquitin thiolesterase
                     21; ubiquitin-specific processing protease 21;
                     deubiquitinating enzyme 21; ubiquitin carboxyl-terminal
                     hydrolase 21; ubiquitin-specific protease 16;
                     NEDD8-specific protease; ubiquitin thioesterase 21"
                     /codon_start=1
                     /product="ubiquitin carboxyl-terminal hydrolase 21 isoform
                     b"
                     /protein_id="NP_001306777.1"
                     /db_xref="CCDS:CCDS81392.1"
                     /db_xref="GeneID:27005"
                     /db_xref="HGNC:HGNC:12620"
                     /db_xref="MIM:604729"
                     /translation="
MPQASEHRLGRTREPPVNIQPRVGSKLPFAPRARSKERRNPASGPNPMLRPLPPRPGLPDERLKKLELGRGRTSGPRPRGPLRADHGVPLPGSPPPTVALPLPSRTNLARSKSVSSGDLRPMGIALGGHRGTGELGAALSRLALRPEPPTLRRSTSLRRLGGFPGPPTLFSIRTEPPASHGSFHMISARSSEPFYSDDKMAHHTLLLGSGHVGLRNLGNTCFLNAVLQCLSSTRPLRDFCLRRDFRQEVPGGGRAQELTEAFADVIGALWHPDSCEAVNPTRFRAVFQKYVPSFSGYSQQDAQEFLKLLMERLHLEINRRGRRAPPILANGPVPSPPRRGGALLEEPELSDDDRANLMWKRYLEREDSKIVDLFVGQLKSCLKCQACGYRSTTFEVFCDLSLPIPKKGFAGGKVSLRDCFNLFTKEEELESENAPVCDRCRQKTRSTKKLTVQRFPRILVLHLNRFSASRGSIKKSSVGVDFPLQRLSLGDFASDKAGSVHYGHYTALCRCQTGWHVYNDSRVSPVSENQVASSEGYVLFYQLMQEPPRCL"
     misc_feature    834..1823
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /note="Ubiquitin carboxyl-terminal hydrolase; Region: UCH;
                     pfam00443"
                     /db_xref="CDD:278850"
     misc_feature    834..>1238
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /note="Peptidase C19 contains ubiquitinyl hydrolases. They
                     are intracellular peptidases that remove ubiquitin
                     molecules from polyubiquinated peptides by cleavage of
                     isopeptide bonds. They hydrolyse bonds involving the
                     carboxyl group of the C-terminal Gly...; Region:
                     Peptidase_C19; cl02553"
                     /db_xref="CDD:271592"
     misc_feature    837..1826
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /note="A subfamily of peptidase C19. Peptidase C19
                     contains ubiquitinyl hydrolases. They are intracellular
                     peptidases that remove ubiquitin molecules from
                     polyubiquinated peptides by cleavage of isopeptide bonds.
                     They hydrolyze bonds involving the carboxyl...; Region:
                     Peptidase_C19R; cd02674"
                     /db_xref="CDD:239139"
     misc_feature    order(846..848,861..863,1710..1712,1758..1760)
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /note="active site"
                     /db_xref="CDD:239139"
     variation       202
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780262251"
     variation       216
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747180723"
     variation       218
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140487526"
     variation       222
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780961535"
     variation       223
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199737344"
     variation       224
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772975124"
     variation       225
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147848740"
     variation       230
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770506309"
     variation       231
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149985789"
     variation       232
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780111343"
     variation       233
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1355773989"
     variation       237
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764589289"
     variation       238
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116557343"
     variation       240
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762032221"
     variation       241
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1027833821"
     variation       247
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747118690"
     variation       248
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765801629"
     variation       249
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1376338644"
     variation       252
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1294349075"
     variation       254
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:953519657"
     variation       255
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1396716119"
     variation       256
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1433024995"
     variation       265
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750832234"
     variation       267
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780099574"
     variation       274..299
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="cc"
                     /replace="ccaagctaccatttgcccccagggcc"
                     /db_xref="dbSNP:1215143851"
     variation       278
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751846238"
     variation       283
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755162566"
     variation       286
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1319707254"
     variation       288
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780900838"
     variation       289
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748000177"
     variation       290
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1469387885"
     variation       291
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1206250200"
     variation       292
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769407463"
     variation       294
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:575048074"
     variation       297
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188873901"
     variation       299
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749224489"
     variation       300
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770632791"
     variation       301
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369560591"
     variation       303
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759307340"
     variation       311
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149171020"
     variation       312
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:544093165"
     variation       313
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372804422"
     variation       319
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:765465616"
     variation       321
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1048478827"
     variation       325
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751000774"
     variation       326
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773739033"
     variation       327
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:554785282"
     variation       330
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755003081"
     variation       338
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:781510108"
     variation       340
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752802166"
     variation       341
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777424873"
     variation       343
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:976462968"
     variation       348
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749277844"
     variation       349
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:115968198"
     variation       351
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745399364"
     variation       352
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771414801"
     variation       355
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:935089193"
     variation       359
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1391427229"
     variation       360
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775224335"
     variation       361
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1158710471"
     variation       363
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746631922"
     variation       364
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377369830"
     variation       365
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202128032"
     variation       370
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558001075"
     variation       371
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773418847"
     variation       376
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456218383"
     variation       385..386
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1366896376"
     variation       385
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:947870525"
     variation       388
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313249351"
     variation       389
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1357211200"
     variation       392
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:560488704"
     variation       395
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138981004"
     variation       397
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252824621"
     variation       398
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373370594"
     variation       408
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201630346"
     variation       409
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759623543"
     variation       411
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767479799"
     variation       414
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753029463"
     variation       415
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1282831113"
     variation       418
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145921869"
     variation       419
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370790417"
     variation       421
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757075486"
     variation       423
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778995626"
     variation       427
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745744328"
     variation       429
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757988113"
     variation       430
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779429015"
     variation       432
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1174194982"
     variation       434
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746718961"
     variation       438
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1427606378"
     variation       441
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1014931023"
     variation       448
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373004398"
     variation       455
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1396133231"
     variation       460
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776218601"
     variation       461
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1443996437"
     variation       462
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1272565073"
     variation       464
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1346015833"
     variation       469
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749685785"
     variation       470
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:137880709"
     variation       471
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:34779722"
     variation       472
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1422204303"
     variation       473
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147394083"
     variation       475
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775409507"
     variation       477
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:994956917"
     variation       478
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760755383"
     variation       479
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370862481"
     variation       480
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:186717254"
     variation       483
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754044354"
     variation       485
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454777466"
     variation       486
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765114499"
     variation       487
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:976976354"
     variation       489
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1396849490"
     variation       493
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1430565611"
     variation       495
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1027738645"
     variation       497
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1447632624"
     variation       504
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750456510"
     variation       506
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769907409"
     variation       509
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1420043006"
     variation       513
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758241325"
     variation       514
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1321190857"
     variation       517
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1558001478"
     variation       521
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367894011"
     variation       525
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372425350"
     variation       526
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751053740"
     variation       527
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375476473"
     variation       529
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763201934"
     variation       533
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1228387345"
     variation       539
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372271090"
     variation       540
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1442728637"
     variation       547
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1341917803"
     variation       558
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:191180673"
     variation       559
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779217194"
     variation       563
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1468938610"
     variation       564
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1215606462"
     variation       565
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746436438"
     variation       566..569
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1558001601"
     variation       567
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772474679"
     variation       577
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776021910"
     variation       578
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760671742"
     variation       582
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200067760"
     variation       588
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768795185"
     variation       589
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3813616"
     variation       590
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1230716480"
     variation       592
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762124989"
     variation       596
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375923326"
     variation       597
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750167338"
     variation       604
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1456713893"
     variation       608
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762760965"
     variation       609
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1013474720"
     variation       610
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766259751"
     variation       613
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1328520627"
     variation       617
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369057043"
     variation       619
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751449721"
     variation       621
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754462761"
     variation       622
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148485578"
     variation       623
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755738229"
     variation       628
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1266239809"
     variation       629
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1245748978"
     variation       630
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777352567"
     variation       631
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:529747030"
     variation       633..658
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="cggcctgagccacccactttgagacg"
                     /replace="cggcctgagccacccactttgagacggcctgagccacccactttgaga
                     cg"
                     /db_xref="dbSNP:1284907469"
     variation       633
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371692736"
     variation       634
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151044234"
     variation       637
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:566090442"
     variation       638
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143739061"
     variation       646
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762176011"
     variation       649
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1409055622"
     variation       651
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375288621"
     variation       657
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1229292579"
     variation       658
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773447985"
     variation       659
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149047051"
     variation       660
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766142083"
     variation       663
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1312644544"
     variation       664
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751515613"
     variation       665
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369085261"
     variation       669
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752222593"
     variation       671
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:897868457"
     variation       672
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:994821674"
     variation       673
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373262739"
     variation       675
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763740106"
     variation       676
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753471183"
     variation       682
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1352734116"
     variation       684
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1412853864"
     variation       687
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376196870"
     variation       688
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1279258107"
     variation       695
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1485885239"
     variation       700
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140569144"
     variation       701
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369956021"
     variation       703
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1008016886"
     variation       704
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1418193867"
     variation       705
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1431952162"
     variation       707
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747512665"
     variation       709
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1181881199"
     variation       712
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752768895"
     variation       717
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755520314"
     variation       718
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1173574908"
     variation       721
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1187533955"
     variation       723
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1376390838"
     variation       726
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1019119107"
     variation       727
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1306606470"
     variation       728
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:966602309"
     variation       729
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373371747"
     variation       734
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748273705"
     variation       739
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1309233875"
     variation       740
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1329422898"
     variation       752
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1231920757"
     variation       754
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1302612528"
     variation       759
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1348279732"
     variation       761
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538169930"
     variation       762
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1272278343"
     variation       765
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760197993"
     variation       766
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749514583"
     variation       769
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377456378"
     variation       771
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759274012"
     variation       776
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777112723"
     variation       777
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1193513330"
     variation       779
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767469808"
     variation       781
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1339794100"
     variation       786
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775338931"
     variation       788
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456002905"
     variation       792
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554465394"
     variation       794
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149224884"
     variation       795
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868304743"
     variation       796
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753499138"
     variation       798
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756904192"
     exon            801..860
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       801
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1396873393"
     variation       802
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1442934691"
     variation       810
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143385078"
     variation       812
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1472977202"
     variation       816..820
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="ct"
                     /replace="cttct"
                     /db_xref="dbSNP:747526943"
     variation       821
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1382540549"
     variation       828
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:927307916"
     variation       833
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768093328"
     variation       839
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1472461967"
     variation       840
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1353163687"
     variation       843
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268579487"
     variation       844
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776184092"
     variation       854
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1273193261"
     variation       858
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:769200434"
     variation       859
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763336520"
     variation       860
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761180075"
     exon            861..981
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       862
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1408890590"
     variation       875
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769131942"
     variation       876
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1161217307"
     variation       879
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1394922866"
     variation       882
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1373339540"
     variation       894
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168804171"
     variation       901
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773060192"
     variation       902
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762692645"
     variation       903
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768041063"
     variation       906
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1245839165"
     variation       909
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:753130907"
     variation       910
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1297104547"
     variation       917
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760903800"
     variation       919
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764663340"
     variation       921
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1301919209"
     variation       923
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754240232"
     variation       932
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757415336"
     variation       935
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1258110666"
     variation       937
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1282983608"
     variation       941
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198718838"
     variation       945
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778958998"
     variation       957
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750682009"
     variation       960
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758599365"
     variation       961
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780201653"
     variation       963
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1180391261"
     variation       965
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1393162113"
     variation       971
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746853481"
     variation       974
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768269159"
     exon            982..1093
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       982
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:896779149"
     variation       986
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780848147"
     variation       1001
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748159936"
     variation       1004
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:938964861"
     variation       1007
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756140031"
     variation       1012
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777811005"
     variation       1013
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1271190505"
     variation       1018
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111293389"
     variation       1019
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748807359"
     variation       1020
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1231763107"
     variation       1025
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770504318"
     variation       1028
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774111165"
     variation       1034
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:896162583"
     variation       1036
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1291892207"
     variation       1045
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1279396976"
     variation       1051
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145716263"
     variation       1052
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1332394066"
     variation       1055
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115167858"
     variation       1059
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1192180828"
     variation       1067
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769102661"
     variation       1078
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776837325"
     variation       1080
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765765976"
     variation       1082
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1416462575"
     variation       1088
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1461537240"
     exon            1094..1249
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       1097
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377383966"
     variation       1098
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779718932"
     variation       1100
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361631774"
     variation       1106
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748518200"
     variation       1109
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770085988"
     variation       1116
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1248893750"
     variation       1127
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:988786204"
     variation       1130
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773767393"
     variation       1133
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750344599"
     variation       1134
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1393725038"
     variation       1135
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:546385110"
     variation       1137..1142
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="ctacac"
                     /db_xref="dbSNP:773953398"
     variation       1137
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376234730"
     variation       1140
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:771042561"
     variation       1142
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370766364"
     variation       1149
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759618282"
     variation       1150
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:968776738"
     variation       1151
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767635139"
     variation       1153
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200765643"
     variation       1155
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760601517"
     variation       1159
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763976152"
     variation       1162
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17356051"
     variation       1164..1169
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace=""
                     /replace="cgccgg"
                     /db_xref="dbSNP:1279356912"
     variation       1164
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200512435"
     variation       1165
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749934766"
     variation       1166
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757859694"
     variation       1167
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114213404"
     variation       1168
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199718002"
     variation       1175
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:778084340"
     variation       1177
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1239657969"
     variation       1178
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1240523510"
     variation       1182
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147410329"
     variation       1183
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771367592"
     variation       1189
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774852233"
     variation       1191
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759545435"
     variation       1197
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772175471"
     variation       1200
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1057511684"
     variation       1206
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1127525"
     variation       1207
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357198951"
     variation       1209
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760947213"
     variation       1210
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1311982602"
     variation       1211
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1333471250"
     variation       1212
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148729808"
     variation       1213
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753705815"
     variation       1215
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:976062697"
     variation       1216
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761658917"
     variation       1218
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765093090"
     variation       1219
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1234929296"
     variation       1221
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199576715"
     variation       1225
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:192656343"
     variation       1232
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750318425"
     variation       1233
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757904173"
     variation       1238
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558004714"
     variation       1239
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1006419712"
     variation       1241
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1238217392"
     exon            1250..1314
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       1254
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773091334"
     variation       1255
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:762919205"
     variation       1261
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765859146"
     variation       1268
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1382221445"
     variation       1269
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1203698456"
     variation       1278
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146775306"
     variation       1279
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:754447783"
     variation       1280
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767167238"
     variation       1281
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752329005"
     variation       1282
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1374428530"
     variation       1287
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1474942459"
     variation       1293
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1165785436"
     variation       1294
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757626220"
     exon            1315..1418
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       1316
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1196376610"
     variation       1322
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1254432738"
     variation       1340
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144266041"
     variation       1346
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755177810"
     variation       1356
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781391210"
     variation       1357
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306960209"
     variation       1368
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1355081464"
     variation       1369
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748371306"
     variation       1376
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1278647056"
     variation       1378
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770080450"
     variation       1382
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777822343"
     variation       1383
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749117248"
     variation       1385
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770696712"
     variation       1400
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774335235"
     variation       1407
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759435509"
     variation       1409
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1237443922"
     variation       1412
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1440253856"
     variation       1415
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771616544"
     exon            1419..1505
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       1419
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752855778"
     variation       1421
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116296675"
     variation       1423
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778073280"
     variation       1430
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150282425"
     variation       1433
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1211991428"
     variation       1435
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778654529"
     variation       1440
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1005739854"
     variation       1441
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220488162"
     variation       1442
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745611981"
     variation       1449
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866698810"
     variation       1450
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772025737"
     variation       1462
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775224656"
     variation       1464
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1558006266"
     variation       1469
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200752473"
     variation       1487
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760245330"
     variation       1490
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:947661179"
     variation       1491
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1017092745"
     variation       1492
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778075451"
     variation       1493
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776411574"
     variation       1495
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:766900223"
     variation       1502
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1361137900"
     exon            1506..1584
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       1506
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145866434"
     variation       1515
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759996638"
     variation       1516
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1263519908"
     variation       1521
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767763815"
     variation       1522
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776101713"
     variation       1527
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1486685028"
     variation       1534
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761061289"
     variation       1535
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1362626583"
     variation       1552
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764610442"
     variation       1553
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543394546"
     variation       1556
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1333581784"
     variation       1557
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374407631"
     variation       1568
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1448635786"
     variation       1569
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765458506"
     variation       1570
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377194833"
     variation       1577
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184941830"
     variation       1578
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1014252597"
     variation       1581
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1477554614"
     exon            1585..1692
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       1593
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868728667"
     variation       1594
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1378901679"
     variation       1602
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1231585601"
     variation       1604
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764510874"
     variation       1609
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:111461715"
     variation       1610
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773005306"
     variation       1613
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:761937444"
     variation       1617
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765296944"
     variation       1618
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:762764076"
     variation       1621
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1179877735"
     variation       1630
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536466461"
     variation       1633
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763064946"
     variation       1636
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:978470909"
     variation       1643
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1371245954"
     variation       1646
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1378369259"
     variation       1649
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1467782864"
     variation       1652
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1166227643"
     variation       1656
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766575729"
     variation       1657
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1192907648"
     variation       1658
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1475411289"
     variation       1659
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751343904"
     variation       1665
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:987643303"
     variation       1666
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1332006216"
     variation       1668
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1402409139"
     variation       1678
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866838339"
     variation       1686..1688
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:757073748"
     variation       1688
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771536058"
     variation       1692
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:865938309"
     exon            1693..1765
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       1695
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:557777574"
     variation       1697
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1368794125"
     variation       1703
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778485772"
     variation       1705
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1156631087"
     variation       1709
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1359430515"
     variation       1717
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745529060"
     variation       1721
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577574792"
     variation       1727
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1469273472"
     variation       1729
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781514698"
     variation       1742
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395928110"
     variation       1747
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314015452"
     variation       1758
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748464692"
     variation       1760
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1002706050"
     variation       1763
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200656986"
     variation       1764
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770318696"
     exon            1766..2132
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       1766
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373928254"
     variation       1770
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756415420"
     variation       1771
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778205345"
     variation       1775
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749801465"
     variation       1787
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1432237905"
     variation       1791
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3203747"
     variation       1802
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770960871"
     variation       1808
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:908584792"
     variation       1811
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745899561"
     variation       1812
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772424636"
     variation       1816
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:775794234"
     variation       1820
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760603430"
     variation       1824
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1349401801"
     variation       1825
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:938612558"
     variation       1827
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35194262"
     variation       1830
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:763944802"
     variation       1832
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1367169046"
     variation       1833
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776471937"
     variation       1834
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377308026"
     variation       1839
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1316186999"
     variation       1842
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749981017"
     variation       1843
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1257292777"
     variation       1844
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371171675"
     variation       1845
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766035942"
     variation       1846
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751201926"
     variation       1847
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142766324"
     variation       1851
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1297811532"
     variation       1860
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1191457758"
     variation       1862
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1127539"
     variation       1864..1865
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1430746167"
     variation       1866
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1476530479"
     variation       1867
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749813212"
     variation       1869
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1424886998"
     variation       1876
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1418472127"
     variation       1882
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:757810362"
     variation       1884
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779217831"
     variation       1887
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:745955405"
     variation       1893
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772263944"
     variation       1895
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775919041"
     variation       1896
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747202481"
     variation       1897
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1359248786"
     variation       1898
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1218030997"
     variation       1902
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:551498235"
     variation       1903
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1486409248"
     variation       1905
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1318507132"
     variation       1906
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776507876"
     variation       1909
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:904309207"
     variation       1913
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1197999850"
     variation       1916
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1265956574"
     variation       1926
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565240420"
     variation       1930
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1051709484"
     variation       1931
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1307614006"
     variation       1943
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539715797"
     variation       1945
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:530812049"
     variation       1952
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:891283550"
     variation       1960
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1009811926"
     variation       1961
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:998572897"
     variation       1962
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1021142323"
     variation       1965
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:551225479"
     variation       1966
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1301362286"
     variation       1967
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1127571"
     variation       1971
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769313034"
     variation       1981
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:890104582"
     variation       1982
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:567878891"
     variation       1983
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1428166121"
     variation       1988
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1170719953"
     variation       1989..1996
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="ttttttt"
                     /replace="tttttttt"
                     /replace="ttttttttt"
                     /db_xref="dbSNP:1166046856"
     variation       1990
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1476420184"
     variation       1991
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1008552176"
     variation       1996
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1371335057"
     variation       2000..2005
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="aa"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /db_xref="dbSNP:1017885701"
     variation       2005
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:556512200"
     variation       2006
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1196215402"
     variation       2007
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233155550"
     variation       2008
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:958705021"
     variation       2010
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1028199685"
     variation       2013
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:991222856"
     variation       2022
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547193686"
     variation       2024
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1388419772"
     variation       2027
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:983470591"
     variation       2040
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3402"
     variation       2043
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1228019988"
     variation       2051
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:939377771"
     variation       2063
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:971217557"
     variation       2065
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1311466730"
     variation       2069..2071
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1444693359"
     variation       2073
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1364227809"
     variation       2074
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225821605"
     variation       2076
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1327213476"
     variation       2089
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368385818"
     variation       2091
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1459765488"
     variation       2099
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749364714"
     variation       2107
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1164539783"
     variation       2111
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:915862475"
     variation       2119..2124
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="tta"
                     /replace="ttatta"
                     /db_xref="dbSNP:1409753548"
ORIGIN      
ggtggccgggcgggaccaacaaagatggcggcggcccctgcggcgggagcgatctgggcaacggctgcggctaaagctgcagccgggcccacgggggggctgcacgggggtagtagggggtggccctgaactggggcctggccctggctggcctctcccgccgcctcactgggggacaggtccagcctgtggtgtccacaatgccccaggcctctgagcaccgcctgggccgtacccgagagccacctgttaatatccagccccgagtgggatccaagctaccatttgcccccagggcccgcagcaaggagcgcagaaacccagcctctgggccaaaccccatgttacgacctctgcctccccggccaggtctgcctgatgaacggctcaagaaactggagctgggacggggacggacctcaggccctcgtcccagaggcccccttcgagcagatcatggggttcccctgcctggctcaccacccccaacagtggctttgcctctcccatctcggaccaacttagcccgttccaagtctgtgagcagtggggacttgcgtccaatggggattgccttgggagggcaccgtggcaccggagagcttggggctgcactgagccgcttggccctccggcctgagccacccactttgagacgtagcacttctctccgccgcctagggggctttcctggaccccctaccctgttcagcatacggacagagccccctgcttcccatggctccttccacatgatatccgcccggtcctctgagcctttctactctgatgacaagatggctcatcacacactccttctgggctctggtcatgttggccttcgaaacctgggaaacacgtgcttcctgaatgctgtgctgcagtgtctgagcagcactcgacctcttcgggacttctgtctgagaagggacttccggcaagaggtgcctggaggaggccgagcccaagagctcactgaagcctttgcagatgtgattggtgccctctggcaccctgactcctgcgaagctgtgaatcctactcgattccgagctgtcttccagaaatatgttccctccttctctggatacagccagcaggatgcccaagagttcctgaagctcctcatggagcggctacaccttgaaatcaaccgccgaggccgccgggctccaccgatacttgccaatggtccagttccctctccaccccgccgaggaggggctctgctagaagaacctgagttaagtgatgatgaccgagccaacctaatgtggaaacgttacctggagcgagaggacagcaagattgtggacctgtttgtgggccagttgaaaagttgtctcaagtgccaggcctgtgggtatcgctccacgaccttcgaggttttttgtgacctgtccctgcccatccccaagaaaggatttgctgggggcaaggtgtctctgcgggattgtttcaaccttttcactaaggaagaagagctagagtcggagaatgccccagtgtgtgaccgatgtcggcagaaaactcgaagtaccaaaaagttgacagtacaaagattccctcgaatcctcgtgctccatctgaatcgattttctgcctcccgaggctccatcaaaaaaagttcagtaggtgtagactttccactgcagcgactgagcctaggggactttgccagtgacaaagccggcagcgtccactatggccactacacagccctgtgccggtgccagactggttggcatgtctacaatgactctcgtgtctcccctgtcagtgaaaaccaggtggcatccagcgagggctacgtgctgttctaccaactgatgcaggagccaccccggtgcctgtgacacctctaagctctggcacctgtgaagccctttaaacacccttaagccccaggctccccgtttacctcagagacgtctatttttgtgtctttttaatcggggaggggggagggggtggttgtagctccattattttttttattaaaaaatacccttccacctggaggctcccttgtctcccagccccatgtacaaagctcaccaagcccctgcccatgtacagcccccagaccctctgcaatatcactttttgtgaataaatttattaagaaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]