GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 12:26:34, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NM_001319847            2262 bp    mRNA    linear   PRI 26-NOV-2019
DEFINITION  Homo sapiens ubiquitin specific peptidase 21 (USP21), transcript
            variant 4, mRNA.
ACCESSION   NM_001319847 XM_011509412
VERSION     NM_001319847.2
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2262)
  AUTHORS   Hou P, Ma X, Zhang Q, Wu CJ, Liao W, Li J, Wang H, Zhao J, Zhou X,
            Guan C, Ackroyd J, Jiang S, Zhang J, Spring DJ, Wang YA and DePinho
            RA.
  TITLE     USP21 deubiquitinase promotes pancreas cancer cell stemness via Wnt
            pathway activation
  JOURNAL   Genes Dev. 33 (19-20), 1361-1366 (2019)
   PUBMED   31488580
  REMARK    GeneRIF: work identifies and validates USP21 as a PDAC oncogene
REFERENCE   2  (bases 1 to 2262)
  AUTHORS   Liu J, Kruswick A, Dang H, Tran AD, Kwon SM, Wang XW and
            Oberdoerffer P.
  TITLE     Ubiquitin-specific protease 21 stabilizes BRCA2 to control DNA
            repair and tumor growth
  JOURNAL   Nat Commun 8 (1), 137 (2017)
   PUBMED   28743957
  REMARK    GeneRIF: USP21 interacts with, deubiquitinates and stabilizes BRCA2
            to promote efficient RAD51 loading at DNA double-strand breaks.
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 2262)
  AUTHORS   Chen Y, Wang L, Jin J, Luan Y, Chen C, Li Y, Chu H, Wang X, Liao G,
            Yu Y, Teng H, Wang Y, Pan W, Fang L, Liao L, Jiang Z, Ge X, Li B
            and Wang P.
  TITLE     p38 inhibition provides anti-DNA virus immunity by regulation of
            USP21 phosphorylation and STING activation
  JOURNAL   J. Exp. Med. 214 (4), 991-1010 (2017)
   PUBMED   28254948
  REMARK    GeneRIF: a critical role of p38-mediated USP21 phosphorylation in
            regulating STING-mediated antiviral functions and identifies
            p38-USP21 axis as an important pathway that DNA virus adopts to
            avoid innate immunity responses.
REFERENCE   4  (bases 1 to 2262)
  AUTHORS   Kwon SK, Lee DH, Kim SY, Park JH, Choi J and Baek KH.
  TITLE     Ubiquitin-specific protease 21 regulating the K48-linked
            polyubiquitination of NANOG
  JOURNAL   Biochem. Biophys. Res. Commun. 482 (4), 1443-1448 (2017)
   PUBMED   27956178
  REMARK    GeneRIF: USP21 specifically regulates the Lys48-linked
            polyubiquitination and stability of NANOG
REFERENCE   5  (bases 1 to 2262)
  AUTHORS   Heride C, Rigden DJ, Bertsoulaki E, Cucchi D, De Smaele E, Clague
            MJ and Urbe S.
  TITLE     The centrosomal deubiquitylase USP21 regulates Gli1 transcriptional
            activity and stability
  JOURNAL   J. Cell. Sci. 129 (21), 4001-4013 (2016)
   PUBMED   27621083
  REMARK    GeneRIF: USP21 recruits and stabilises Gli1 at the centrosome.
REFERENCE   6  (bases 1 to 2262)
  AUTHORS   Urbe S, Liu H, Hayes SD, Heride C, Rigden DJ and Clague MJ.
  TITLE     Systematic survey of deubiquitinase localization identifies USP21
            as a regulator of centrosome- and microtubule-associated functions
  JOURNAL   Mol. Biol. Cell 23 (6), 1095-1103 (2012)
   PUBMED   22298430
  REMARK    GeneRIF: Study observed a reduction in the number of A549 cells
            developing a primary cilium upon serum starvation when USP21 was
            depleted with two independent siRNA oligos.
REFERENCE   7  (bases 1 to 2262)
  AUTHORS   Ye Y, Akutsu M, Reyes-Turcu F, Enchev RI, Wilkinson KD and Komander
            D.
  TITLE     Polyubiquitin binding and cross-reactivity in the USP domain
            deubiquitinase USP21
  JOURNAL   EMBO Rep. 12 (4), 350-357 (2011)
   PUBMED   21399617
  REMARK    GeneRIF: Study report that USP21 cleaves Ub polymers, and with
            reduced activity also targets ISG15, but is inactive against NEDD8.
REFERENCE   8  (bases 1 to 2262)
  AUTHORS   Xu G, Tan X, Wang H, Sun W, Shi Y, Burlingame S, Gu X, Cao G, Zhang
            T, Qin J and Yang J.
  TITLE     Ubiquitin-specific peptidase 21 inhibits tumor necrosis factor
            alpha-induced nuclear factor kappaB activation via binding to and
            deubiquitinating receptor-interacting protein 1
  JOURNAL   J. Biol. Chem. 285 (2), 969-978 (2010)
   PUBMED   19910467
  REMARK    GeneRIF: USP21 plays an important role in the down-regulation of
            TNFalpha-induced NF-kappaB activation through deubiquitinating
            RIP1.
REFERENCE   9  (bases 1 to 2262)
  AUTHORS   Gong L, Kamitani T, Millas S and Yeh ET.
  TITLE     Identification of a novel isopeptidase with dual specificity for
            ubiquitin- and NEDD8-conjugated proteins
  JOURNAL   J. Biol. Chem. 275 (19), 14212-14216 (2000)
   PUBMED   10799498
REFERENCE   10 (bases 1 to 2262)
  AUTHORS   Smith TS and Southan C.
  TITLE     Sequencing, tissue distribution and chromosomal assignment of a
            novel ubiquitin-specific protease USP23
  JOURNAL   Biochim. Biophys. Acta 1490 (1-2), 184-188 (2000)
   PUBMED   10786635
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DA000829.1, AK310326.1 and
            AI038040.1.
            On May 31, 2019 this sequence version replaced NM_001319847.1.
            
            Summary: This gene encodes a member of the C19 peptidase family,
            also known as family 2 of ubiquitin carboxy-terminal hydrolases.
            The encoded protein cleaves ubiquitin from ubiquitinated proteins
            for recycling in intracellular protein degradation. The encoded
            protein is also able to release NEDD8, a ubiquitin-like protein,
            from NEDD8-conjugated proteins. This gene has been referred to as
            USP16 and USP23 but is now known as USP21. Alternatively spliced
            transcript variants encoding different isoforms have been found for
            this gene. [provided by RefSeq, Feb 2016].
            
            Transcript Variant: This variant (4) encodes the longest isoform
            (a).
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK310326.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA1968189, SAMEA2144120
                                           [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-20                DA000829.1         43-62
            21-2256             AK310326.1         2-2237
            2257-2262           AI038040.1         8-13                c
FEATURES             Location/Qualifiers
     source          1..2262
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1q23.3"
     gene            1..2262
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /note="ubiquitin specific peptidase 21"
                     /db_xref="GeneID:27005"
                     /db_xref="HGNC:HGNC:12620"
                     /db_xref="MIM:604729"
     exon            1..267
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="gccg"
                     /replace="gccggtggccg"
                     /replace="gccggtggccggtggccg"
                     /db_xref="dbSNP:3841331"
     variation       7
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366304902"
     variation       9
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1377400748"
     variation       10
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1310181850"
     variation       11
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1444658382"
     variation       15
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1352828505"
     variation       20
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978508891"
     variation       21..23
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1486278284"
     variation       22
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1406430390"
     variation       23
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1368060770"
     variation       27..35
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="ggcggc"
                     /replace="ggcggcggc"
                     /db_xref="dbSNP:1162249922"
     variation       28
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1557999285"
     variation       29
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199955506"
     variation       30
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:574535198"
     variation       32
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1178561456"
     variation       33
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1468340643"
     variation       34
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:925262965"
     variation       36
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1221721570"
     variation       37
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1490702404"
     variation       38
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1426903854"
     variation       39
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1289451839"
     variation       40
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:936759820"
     variation       44
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1185325919"
     variation       46
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225683381"
     variation       49
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1371506111"
     variation       50
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1279011326"
     variation       51
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1437223096"
     variation       59
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1243629515"
     variation       62
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:944619354"
     variation       63
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1438890927"
     variation       67
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1156588596"
     variation       68
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1038920475"
     variation       69
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1161783645"
     variation       74
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1365200626"
     variation       76
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:947814268"
     variation       77
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:900304631"
     variation       78
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:895352220"
     variation       80
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112604935"
     variation       83
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1266171865"
     variation       88
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1403220877"
     variation       89
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198586585"
     variation       91
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:886119324"
     variation       93..99
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="gggggg"
                     /replace="ggggggg"
                     /replace="gggggggg"
                     /db_xref="dbSNP:1262243998"
     variation       93
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1004583454"
     variation       94
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1046673372"
     variation       95
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:886704992"
     variation       98
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:537144107"
     variation       105
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1031113402"
     variation       105
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1232767863"
     variation       113
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1557999516"
     variation       114
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750709377"
     variation       116..136
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="gggggtggccctgaactgggg"
                     /replace="gggggtggccctgaactggggggtggccctgaactgggg"
                     /db_xref="dbSNP:1176257500"
     variation       116
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1325786979"
     variation       117
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1426589101"
     variation       120
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1204345281"
     misc_feature    127..129
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /note="upstream in-frame stop codon"
     variation       133
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:956987927"
     variation       134
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1015679303"
     variation       137
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:986858621"
     variation       140
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757153392"
     variation       144
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1263687993"
     variation       151
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368750833"
     variation       157
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:995292059"
     variation       159
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1485385009"
     variation       161
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:556790397"
     variation       163
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:953881564"
     variation       170
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1462855011"
     variation       177
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1261310605"
     variation       188
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1175326941"
     variation       196
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1252395886"
     variation       199
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1298282942"
     CDS             202..1986
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /EC_number="3.4.19.12"
                     /note="isoform a is encoded by transcript variant 4;
                     ubiquitin specific protease 21; ubiquitin thiolesterase
                     21; ubiquitin-specific processing protease 21;
                     deubiquitinating enzyme 21; ubiquitin carboxyl-terminal
                     hydrolase 21; ubiquitin-specific protease 16;
                     NEDD8-specific protease; ubiquitin thioesterase 21"
                     /codon_start=1
                     /product="ubiquitin carboxyl-terminal hydrolase 21 isoform
                     a"
                     /protein_id="NP_001306776.1"
                     /db_xref="GeneID:27005"
                     /db_xref="HGNC:HGNC:12620"
                     /db_xref="MIM:604729"
                     /translation="
MAGCGGAQREDCSRPERTLSTKVQPVVSTMPQASEHRLGRTREPPVNIQPRVGSKLPFAPRARSKERRNPASGPNPMLRPLPPRPGLPDERLKKLELGRGRTSGPRPRGPLRADHGVPLPGSPPPTVALPLPSRTNLARSKSVSSGDLRPMGIALGGHRGTGELGAALSRLALRPEPPTLRRSTSLRRLGGFPGPPTLFSIRTEPPASHGSFHMISARSSEPFYSDDKMAHHTLLLGSGHVGLRNLGNTCFLNAVLQCLSSTRPLRDFCLRRDFRQEVPGGGRAQELTEAFADVIGALWHPDSCEAVNPTRFRAVFQKYVPSFSGYSQQDAQEFLKLLMERLHLEINRRGRRAPPILANGPVPSPPRRGGALLEEPELSDDDRANLMWKRYLEREDSKIVDLFVGQLKSCLKCQACGYRSTTFEVFCDLSLPIPKKGFAGGKVSLRDCFNLFTKEEELESENAPVCDRCRQKTRSTKKLTVQRFPRILVLHLNRFSASRGSIKKSSVGVDFPLQRLSLGDFASDKAGSPVYQLYALCNHSGSVHYGHYTALCRCQTGWHVYNDSRVSPVSENQVASSEGYVLFYQLMQEPPRCL"
     misc_feature    922..1953
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /note="Ubiquitin carboxyl-terminal hydrolase; Region: UCH;
                     pfam00443"
                     /db_xref="CDD:278850"
     misc_feature    925..1956
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /note="A subfamily of peptidase C19. Peptidase C19
                     contains ubiquitinyl hydrolases. They are intracellular
                     peptidases that remove ubiquitin molecules from
                     polyubiquinated peptides by cleavage of isopeptide bonds.
                     They hydrolyze bonds involving the carboxyl...; Region:
                     Peptidase_C19R; cd02674"
                     /db_xref="CDD:239139"
     misc_feature    order(934..936,949..951,1840..1842,1888..1890)
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /note="active site"
                     /db_xref="CDD:239139"
     variation       209
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1213335490"
     variation       210
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1361685339"
     variation       211
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1046036763"
     variation       212
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:987024154"
     variation       213
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:927626935"
     variation       214..220
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="gggggg"
                     /replace="ggggggg"
                     /replace="gggggggg"
                     /db_xref="dbSNP:912547145"
     variation       214
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1019413351"
     variation       215
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:573536525"
     variation       216
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:967046548"
     variation       217
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1427917036"
     variation       219
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:977994735"
     variation       220
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:944615295"
     variation       221
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:925294178"
     variation       228
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:936666685"
     variation       229
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:535889576"
     variation       236
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:921782535"
     variation       239
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:916651608"
     variation       244
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:949469334"
     variation       245
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1400230910"
     variation       246
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1049357592"
     variation       247
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:886215227"
     variation       252
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047020494"
     variation       256..260
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="ctc"
                     /replace="ctctc"
                     /db_xref="dbSNP:1313837087"
     variation       258
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1391628031"
     variation       260
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373521826"
     variation       261
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295984279"
     exon            268..888
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       272
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1379858238"
     variation       274
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373250780"
     variation       279
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745980122"
     variation       280
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1376418783"
     variation       286
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758436746"
     variation       290
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780262251"
     variation       304
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747180723"
     variation       306
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140487526"
     variation       310
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780961535"
     variation       311
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199737344"
     variation       312
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772975124"
     variation       313
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147848740"
     variation       318
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770506309"
     variation       319
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149985789"
     variation       320
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780111343"
     variation       321
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1355773989"
     variation       325
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764589289"
     variation       326
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116557343"
     variation       328
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762032221"
     variation       329
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1027833821"
     variation       335
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747118690"
     variation       336
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765801629"
     variation       337
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1376338644"
     variation       340
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1294349075"
     variation       342
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:953519657"
     variation       343
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1396716119"
     variation       344
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1433024995"
     variation       353
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750832234"
     variation       355
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780099574"
     variation       362..387
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="cc"
                     /replace="ccaagctaccatttgcccccagggcc"
                     /db_xref="dbSNP:1215143851"
     variation       366
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751846238"
     variation       371
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755162566"
     variation       374
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1319707254"
     variation       376
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780900838"
     variation       377
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748000177"
     variation       378
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1469387885"
     variation       379
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1206250200"
     variation       380
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769407463"
     variation       382
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:575048074"
     variation       385
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188873901"
     variation       387
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749224489"
     variation       388
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770632791"
     variation       389
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369560591"
     variation       391
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759307340"
     variation       399
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149171020"
     variation       400
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:544093165"
     variation       401
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372804422"
     variation       407
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:765465616"
     variation       409
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1048478827"
     variation       413
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751000774"
     variation       414
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773739033"
     variation       415
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:554785282"
     variation       418
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755003081"
     variation       426
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:781510108"
     variation       428
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752802166"
     variation       429
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777424873"
     variation       431
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:976462968"
     variation       436
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749277844"
     variation       437
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:115968198"
     variation       439
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745399364"
     variation       440
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771414801"
     variation       443
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:935089193"
     variation       447
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1391427229"
     variation       448
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775224335"
     variation       449
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1158710471"
     variation       451
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746631922"
     variation       452
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377369830"
     variation       453
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202128032"
     variation       458
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558001075"
     variation       459
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773418847"
     variation       464
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456218383"
     variation       473..474
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1366896376"
     variation       473
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:947870525"
     variation       476
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313249351"
     variation       477
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1357211200"
     variation       480
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:560488704"
     variation       483
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138981004"
     variation       485
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252824621"
     variation       486
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373370594"
     variation       496
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201630346"
     variation       497
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759623543"
     variation       499
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767479799"
     variation       502
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753029463"
     variation       503
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1282831113"
     variation       506
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145921869"
     variation       507
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370790417"
     variation       509
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757075486"
     variation       511
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778995626"
     variation       515
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745744328"
     variation       517
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757988113"
     variation       518
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779429015"
     variation       520
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1174194982"
     variation       522
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746718961"
     variation       526
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1427606378"
     variation       529
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1014931023"
     variation       536
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373004398"
     variation       543
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1396133231"
     variation       548
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776218601"
     variation       549
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1443996437"
     variation       550
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1272565073"
     variation       552
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1346015833"
     variation       557
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749685785"
     variation       558
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:137880709"
     variation       559
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:34779722"
     variation       560
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1422204303"
     variation       561
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147394083"
     variation       563
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775409507"
     variation       565
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:994956917"
     variation       566
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760755383"
     variation       567
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370862481"
     variation       568
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:186717254"
     variation       571
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754044354"
     variation       573
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454777466"
     variation       574
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765114499"
     variation       575
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:976976354"
     variation       577
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1396849490"
     variation       581
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1430565611"
     variation       583
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1027738645"
     variation       585
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1447632624"
     variation       592
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750456510"
     variation       594
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769907409"
     variation       597
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1420043006"
     variation       601
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758241325"
     variation       602
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1321190857"
     variation       605
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1558001478"
     variation       609
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367894011"
     variation       613
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372425350"
     variation       614
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751053740"
     variation       615
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375476473"
     variation       617
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763201934"
     variation       621
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1228387345"
     variation       627
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372271090"
     variation       628
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1442728637"
     variation       635
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1341917803"
     variation       646
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:191180673"
     variation       647
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779217194"
     variation       651
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1468938610"
     variation       652
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1215606462"
     variation       653
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746436438"
     variation       654..657
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1558001601"
     variation       655
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772474679"
     variation       665
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776021910"
     variation       666
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760671742"
     variation       670
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200067760"
     variation       676
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768795185"
     variation       677
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3813616"
     variation       678
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1230716480"
     variation       680
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762124989"
     variation       684
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375923326"
     variation       685
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750167338"
     variation       692
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1456713893"
     variation       696
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762760965"
     variation       697
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1013474720"
     variation       698
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766259751"
     variation       701
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1328520627"
     variation       705
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369057043"
     variation       707
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751449721"
     variation       709
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754462761"
     variation       710
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148485578"
     variation       711
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755738229"
     variation       716
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1266239809"
     variation       717
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1245748978"
     variation       718
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777352567"
     variation       719
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:529747030"
     variation       721..746
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="cggcctgagccacccactttgagacg"
                     /replace="cggcctgagccacccactttgagacggcctgagccacccactttgaga
                     cg"
                     /db_xref="dbSNP:1284907469"
     variation       721
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371692736"
     variation       722
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151044234"
     variation       725
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:566090442"
     variation       726
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143739061"
     variation       734
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762176011"
     variation       737
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1409055622"
     variation       739
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375288621"
     variation       745
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1229292579"
     variation       746
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773447985"
     variation       747
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149047051"
     variation       748
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766142083"
     variation       751
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1312644544"
     variation       752
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751515613"
     variation       753
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369085261"
     variation       757
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752222593"
     variation       759
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:897868457"
     variation       760
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:994821674"
     variation       761
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373262739"
     variation       763
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763740106"
     variation       764
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753471183"
     variation       770
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1352734116"
     variation       772
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1412853864"
     variation       775
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376196870"
     variation       776
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1279258107"
     variation       783
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1485885239"
     variation       788
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140569144"
     variation       789
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369956021"
     variation       791
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1008016886"
     variation       792
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1418193867"
     variation       793
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1431952162"
     variation       795
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747512665"
     variation       797
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1181881199"
     variation       800
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752768895"
     variation       805
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755520314"
     variation       806
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1173574908"
     variation       809
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1187533955"
     variation       811
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1376390838"
     variation       814
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1019119107"
     variation       815
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1306606470"
     variation       816
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:966602309"
     variation       817
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373371747"
     variation       822
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748273705"
     variation       827
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1309233875"
     variation       828
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1329422898"
     variation       840
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1231920757"
     variation       842
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1302612528"
     variation       847
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1348279732"
     variation       849
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538169930"
     variation       850
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1272278343"
     variation       853
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760197993"
     variation       854
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749514583"
     variation       857
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377456378"
     variation       859
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759274012"
     variation       864
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777112723"
     variation       865
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1193513330"
     variation       867
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767469808"
     variation       869
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1339794100"
     variation       874
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775338931"
     variation       876
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456002905"
     variation       880
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554465394"
     variation       882
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149224884"
     variation       883
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868304743"
     variation       884
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753499138"
     variation       886
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756904192"
     exon            889..948
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       889
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1396873393"
     variation       890
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1442934691"
     variation       898
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143385078"
     variation       900
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1472977202"
     variation       904..908
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="ct"
                     /replace="cttct"
                     /db_xref="dbSNP:747526943"
     variation       909
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1382540549"
     variation       916
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:927307916"
     variation       921
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768093328"
     variation       927
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1472461967"
     variation       928
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1353163687"
     variation       931
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268579487"
     variation       932
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776184092"
     variation       942
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1273193261"
     variation       946
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:769200434"
     variation       947
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763336520"
     variation       948
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761180075"
     exon            949..1069
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       950
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1408890590"
     variation       963
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769131942"
     variation       964
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1161217307"
     variation       967
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1394922866"
     variation       970
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1373339540"
     variation       982
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168804171"
     variation       989
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773060192"
     variation       990
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762692645"
     variation       991
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768041063"
     variation       994
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1245839165"
     variation       997
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:753130907"
     variation       998
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1297104547"
     variation       1005
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760903800"
     variation       1007
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764663340"
     variation       1009
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1301919209"
     variation       1011
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754240232"
     variation       1020
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757415336"
     variation       1023
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1258110666"
     variation       1025
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1282983608"
     variation       1029
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198718838"
     variation       1033
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778958998"
     variation       1045
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750682009"
     variation       1048
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758599365"
     variation       1049
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780201653"
     variation       1051
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1180391261"
     variation       1053
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1393162113"
     variation       1059
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746853481"
     variation       1062
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768269159"
     exon            1070..1181
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       1070
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:896779149"
     variation       1074
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780848147"
     variation       1089
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748159936"
     variation       1092
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:938964861"
     variation       1095
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756140031"
     variation       1100
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777811005"
     variation       1101
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1271190505"
     variation       1106
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111293389"
     variation       1107
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748807359"
     variation       1108
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1231763107"
     variation       1113
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770504318"
     variation       1116
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774111165"
     variation       1122
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:896162583"
     variation       1124
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1291892207"
     variation       1133
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1279396976"
     variation       1139
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145716263"
     variation       1140
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1332394066"
     variation       1143
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115167858"
     variation       1147
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1192180828"
     variation       1155
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769102661"
     variation       1166
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776837325"
     variation       1168
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765765976"
     variation       1170
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1416462575"
     variation       1176
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1461537240"
     exon            1182..1337
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       1185
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377383966"
     variation       1186
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779718932"
     variation       1188
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361631774"
     variation       1194
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748518200"
     variation       1197
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770085988"
     variation       1204
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1248893750"
     variation       1215
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:988786204"
     variation       1218
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773767393"
     variation       1221
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750344599"
     variation       1222
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1393725038"
     variation       1223
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:546385110"
     variation       1225..1230
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="ctacac"
                     /db_xref="dbSNP:773953398"
     variation       1225
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376234730"
     variation       1228
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:771042561"
     variation       1230
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370766364"
     variation       1237
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759618282"
     variation       1238
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:968776738"
     variation       1239
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767635139"
     variation       1241
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200765643"
     variation       1243
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760601517"
     variation       1247
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763976152"
     variation       1250
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17356051"
     variation       1252..1257
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace=""
                     /replace="cgccgg"
                     /db_xref="dbSNP:1279356912"
     variation       1252
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200512435"
     variation       1253
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749934766"
     variation       1254
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757859694"
     variation       1255
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114213404"
     variation       1256
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199718002"
     variation       1263
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:778084340"
     variation       1265
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1239657969"
     variation       1266
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1240523510"
     variation       1270
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147410329"
     variation       1271
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771367592"
     variation       1277
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774852233"
     variation       1279
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759545435"
     variation       1285
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772175471"
     variation       1288
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1057511684"
     variation       1294
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1127525"
     variation       1295
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357198951"
     variation       1297
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760947213"
     variation       1298
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1311982602"
     variation       1299
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1333471250"
     variation       1300
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148729808"
     variation       1301
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753705815"
     variation       1303
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:976062697"
     variation       1304
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761658917"
     variation       1306
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765093090"
     variation       1307
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1234929296"
     variation       1309
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199576715"
     variation       1313
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:192656343"
     variation       1320
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750318425"
     variation       1321
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757904173"
     variation       1326
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558004714"
     variation       1327
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1006419712"
     variation       1329
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1238217392"
     exon            1338..1402
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       1342
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773091334"
     variation       1343
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:762919205"
     variation       1349
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765859146"
     variation       1356
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1382221445"
     variation       1357
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1203698456"
     variation       1366
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146775306"
     variation       1367
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:754447783"
     variation       1368
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767167238"
     variation       1369
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752329005"
     variation       1370
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1374428530"
     variation       1375
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1474942459"
     variation       1381
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1165785436"
     variation       1382
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757626220"
     exon            1403..1506
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       1404
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1196376610"
     variation       1410
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1254432738"
     variation       1428
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144266041"
     variation       1434
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755177810"
     variation       1444
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781391210"
     variation       1445
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306960209"
     variation       1456
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1355081464"
     variation       1457
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748371306"
     variation       1464
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1278647056"
     variation       1466
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770080450"
     variation       1470
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777822343"
     variation       1471
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749117248"
     variation       1473
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770696712"
     variation       1488
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774335235"
     variation       1495
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759435509"
     variation       1497
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1237443922"
     variation       1500
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1440253856"
     variation       1503
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771616544"
     exon            1507..1593
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       1507
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752855778"
     variation       1509
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116296675"
     variation       1511
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778073280"
     variation       1518
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150282425"
     variation       1521
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1211991428"
     variation       1523
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778654529"
     variation       1528
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1005739854"
     variation       1529
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220488162"
     variation       1530
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745611981"
     variation       1537
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866698810"
     variation       1538
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772025737"
     variation       1550
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775224656"
     variation       1552
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1558006266"
     variation       1557
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200752473"
     variation       1575
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760245330"
     variation       1578
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:947661179"
     variation       1579
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1017092745"
     variation       1580
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778075451"
     variation       1581
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776411574"
     variation       1583
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:766900223"
     variation       1590
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1361137900"
     exon            1594..1672
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       1594
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145866434"
     variation       1603
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759996638"
     variation       1604
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1263519908"
     variation       1609
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767763815"
     variation       1610
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776101713"
     variation       1615
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1486685028"
     variation       1622
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761061289"
     variation       1623
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1362626583"
     variation       1640
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764610442"
     variation       1641
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543394546"
     variation       1644
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1333581784"
     variation       1645
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374407631"
     variation       1656
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1448635786"
     variation       1657
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765458506"
     variation       1658
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377194833"
     variation       1665
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184941830"
     variation       1666
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1014252597"
     variation       1669
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1477554614"
     exon            1673..1780
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       1681
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868728667"
     variation       1682
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1378901679"
     variation       1690
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1231585601"
     variation       1692
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764510874"
     variation       1697
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:111461715"
     variation       1698
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773005306"
     variation       1701
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:761937444"
     variation       1705
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765296944"
     variation       1706
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:762764076"
     variation       1709
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1179877735"
     variation       1718
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536466461"
     variation       1721
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763064946"
     variation       1724
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:978470909"
     variation       1731
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1371245954"
     variation       1734
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1378369259"
     variation       1737
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1467782864"
     variation       1740
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1166227643"
     variation       1744
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766575729"
     variation       1745
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1192907648"
     variation       1746
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1475411289"
     variation       1747
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751343904"
     variation       1753
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:987643303"
     variation       1754
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1332006216"
     variation       1756
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1402409139"
     variation       1766
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866838339"
     variation       1774..1776
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:757073748"
     variation       1776
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771536058"
     variation       1780
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:865938309"
     exon            1781..1895
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       1788
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262682222"
     variation       1789
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756139933"
     variation       1797
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777810884"
     variation       1798
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753290580"
     variation       1800
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767518085"
     variation       1814
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373253684"
     variation       1815
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1029807161"
     variation       1820
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1236492617"
     variation       1825
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:557777574"
     variation       1827
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1368794125"
     variation       1833
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778485772"
     variation       1835
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1156631087"
     variation       1839
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1359430515"
     variation       1847
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745529060"
     variation       1851
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577574792"
     variation       1857
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1469273472"
     variation       1859
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781514698"
     variation       1872
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395928110"
     variation       1877
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314015452"
     variation       1888
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748464692"
     variation       1890
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1002706050"
     variation       1893
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200656986"
     variation       1894
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770318696"
     exon            1896..2262
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       1896
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373928254"
     variation       1900
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756415420"
     variation       1901
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778205345"
     variation       1905
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749801465"
     variation       1917
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1432237905"
     variation       1921
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3203747"
     variation       1932
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770960871"
     variation       1938
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:908584792"
     variation       1941
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745899561"
     variation       1942
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772424636"
     variation       1946
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:775794234"
     variation       1950
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760603430"
     variation       1954
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1349401801"
     variation       1955
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:938612558"
     variation       1957
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35194262"
     variation       1960
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:763944802"
     variation       1962
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1367169046"
     variation       1963
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776471937"
     variation       1964
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377308026"
     variation       1969
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1316186999"
     variation       1972
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749981017"
     variation       1973
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1257292777"
     variation       1974
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371171675"
     variation       1975
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766035942"
     variation       1976
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751201926"
     variation       1977
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142766324"
     variation       1981
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1297811532"
     variation       1990
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1191457758"
     variation       1992
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1127539"
     variation       1994..1995
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1430746167"
     variation       1996
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1476530479"
     variation       1997
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749813212"
     variation       1999
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1424886998"
     variation       2006
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1418472127"
     variation       2012
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:757810362"
     variation       2014
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779217831"
     variation       2017
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:745955405"
     variation       2023
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772263944"
     variation       2025
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775919041"
     variation       2026
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747202481"
     variation       2027
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1359248786"
     variation       2028
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1218030997"
     variation       2032
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:551498235"
     variation       2033
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1486409248"
     variation       2035
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1318507132"
     variation       2036
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776507876"
     variation       2039
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:904309207"
     variation       2043
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1197999850"
     variation       2046
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1265956574"
     variation       2056
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565240420"
     variation       2060
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1051709484"
     variation       2061
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1307614006"
     variation       2073
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539715797"
     variation       2075
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:530812049"
     variation       2082
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:891283550"
     variation       2090
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1009811926"
     variation       2091
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:998572897"
     variation       2092
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1021142323"
     variation       2095
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:551225479"
     variation       2096
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1301362286"
     variation       2097
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1127571"
     variation       2101
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769313034"
     variation       2111
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:890104582"
     variation       2112
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:567878891"
     variation       2113
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1428166121"
     variation       2118
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1170719953"
     variation       2119..2126
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="ttttttt"
                     /replace="tttttttt"
                     /replace="ttttttttt"
                     /db_xref="dbSNP:1166046856"
     variation       2120
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1476420184"
     variation       2121
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1008552176"
     variation       2126
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1371335057"
     variation       2130..2135
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="aa"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /db_xref="dbSNP:1017885701"
     variation       2135
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:556512200"
     variation       2136
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1196215402"
     variation       2137
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233155550"
     variation       2138
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:958705021"
     variation       2140
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1028199685"
     variation       2143
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:991222856"
     variation       2152
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547193686"
     variation       2154
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1388419772"
     variation       2157
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:983470591"
     variation       2170
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3402"
     variation       2173
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1228019988"
     variation       2181
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:939377771"
     variation       2193
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:971217557"
     variation       2195
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1311466730"
     variation       2199..2201
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1444693359"
     variation       2203
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1364227809"
     variation       2204
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225821605"
     variation       2206
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1327213476"
     variation       2219
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368385818"
     variation       2221
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1459765488"
     variation       2229
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749364714"
     variation       2237
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1164539783"
     variation       2241
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:915862475"
     variation       2249..2254
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="tta"
                     /replace="ttatta"
                     /db_xref="dbSNP:1409753548"
ORIGIN      
ggtggccgggcgggaccaacaaagatggcggcggcccctgcggcgggagcgatctgggcaacggctgcggctaaagctgcagccgggcccacgggggggctgcacgggggtagtagggggtggccctgaactggggcctggccctggctggcctctcccgccgcctcactgggggacaggtacgggccggggcgttatggcatggcggggtgtgggggggcgcagagggaagactgctccagacccgagaggacactctccacaaaggtccagcctgtggtgtccacaatgccccaggcctctgagcaccgcctgggccgtacccgagagccacctgttaatatccagccccgagtgggatccaagctaccatttgcccccagggcccgcagcaaggagcgcagaaacccagcctctgggccaaaccccatgttacgacctctgcctccccggccaggtctgcctgatgaacggctcaagaaactggagctgggacggggacggacctcaggccctcgtcccagaggcccccttcgagcagatcatggggttcccctgcctggctcaccacccccaacagtggctttgcctctcccatctcggaccaacttagcccgttccaagtctgtgagcagtggggacttgcgtccaatggggattgccttgggagggcaccgtggcaccggagagcttggggctgcactgagccgcttggccctccggcctgagccacccactttgagacgtagcacttctctccgccgcctagggggctttcctggaccccctaccctgttcagcatacggacagagccccctgcttcccatggctccttccacatgatatccgcccggtcctctgagcctttctactctgatgacaagatggctcatcacacactccttctgggctctggtcatgttggccttcgaaacctgggaaacacgtgcttcctgaatgctgtgctgcagtgtctgagcagcactcgacctcttcgggacttctgtctgagaagggacttccggcaagaggtgcctggaggaggccgagcccaagagctcactgaagcctttgcagatgtgattggtgccctctggcaccctgactcctgcgaagctgtgaatcctactcgattccgagctgtcttccagaaatatgttccctccttctctggatacagccagcaggatgcccaagagttcctgaagctcctcatggagcggctacaccttgaaatcaaccgccgaggccgccgggctccaccgatacttgccaatggtccagttccctctccaccccgccgaggaggggctctgctagaagaacctgagttaagtgatgatgaccgagccaacctaatgtggaaacgttacctggagcgagaggacagcaagattgtggacctgtttgtgggccagttgaaaagttgtctcaagtgccaggcctgtgggtatcgctccacgaccttcgaggttttttgtgacctgtccctgcccatccccaagaaaggatttgctgggggcaaggtgtctctgcgggattgtttcaaccttttcactaaggaagaagagctagagtcggagaatgccccagtgtgtgaccgatgtcggcagaaaactcgaagtaccaaaaagttgacagtacaaagattccctcgaatcctcgtgctccatctgaatcgattttctgcctcccgaggctccatcaaaaaaagttcagtaggtgtagactttccactgcagcgactgagcctaggggactttgccagtgacaaagccggaagtcctgtataccagctgtatgccctttgcaaccactcaggcagcgtccactatggccactacacagccctgtgccggtgccagactggttggcatgtctacaatgactctcgtgtctcccctgtcagtgaaaaccaggtggcatccagcgagggctacgtgctgttctaccaactgatgcaggagccaccccggtgcctgtgacacctctaagctctggcacctgtgaagccctttaaacacccttaagccccaggctccccgtttacctcagagacgtctatttttgtgtctttttaatcggggaggggggagggggtggttgtagctccattattttttttattaaaaaatacccttccacctggaggctcccttgtctcccagccccatgtacaaagctcaccaagcccctgcccatgtacagcccccagaccctctgcaatatcactttttgtgaataaatttattaagaaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]