GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-23 03:26:39, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       NM_001307219           26769 bp    mRNA    linear   INV 15-AUG-2018
DEFINITION  Caenorhabditis elegans CLArinet, functional homolog of cytomatrix
            at the active zone proteins piccolo and fife (cla-1), partial mRNA.
ACCESSION   NM_001307219
VERSION     NM_001307219.2
DBLINK      BioProject: PRJNA158
            BioSample: SAMEA3138177
KEYWORDS    RefSeq.
SOURCE      Caenorhabditis elegans
  ORGANISM  Caenorhabditis elegans
            Eukaryota; Metazoa; Ecdysozoa; Nematoda; Chromadorea; Rhabditida;
            Rhabditoidea; Rhabditidae; Peloderinae; Caenorhabditis.
REFERENCE   1  (bases 1 to 26769)
  AUTHORS   Sulson,J.E. and Waterston,R.
  CONSRTM   Caenorhabditis elegans Sequencing Consortium
  TITLE     Genome sequence of the nematode C. elegans: a platform for
            investigating biology
  JOURNAL   Science 282 (5396), 2012-2018 (1998)
   PUBMED   9851916
  REMARK    Erratum:[Science 1999 Jan 1;283(5398):35]
REFERENCE   2  (bases 1 to 26769)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (15-AUG-2018) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 26769)
  AUTHORS   WormBase.
  CONSRTM   WormBase Consortium
  TITLE     Direct Submission
  JOURNAL   Submitted (24-JUL-2018) WormBase Group, European Bioinformatics
            Institute, Cambridge, CB10 1SA, UK. Email: help@wormbase.org
REFERENCE   4  (bases 1 to 26769)
  AUTHORS   Sulson,J.E. and Waterston,R.
  TITLE     Direct Submission
  JOURNAL   Submitted (03-MAR-2003) Nematode Sequencing Project: Sanger
            Institute, Hinxton, Cambridge CB10 1SA, UK and The Genome Institute
            at Washington University, St. Louis, MO 63110, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by WormBase. This
            record is derived from an annotated genomic sequence (NC_003282).
            On Aug 25, 2015 this sequence version replaced NM_001307219.1.
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..26769
                     /organism="Caenorhabditis elegans"
                     /mol_type="mRNA"
                     /strain="Bristol N2"
                     /db_xref="taxon:6239"
                     /chromosome="IV"
     gene            <1..>26769
                     /gene="cla-1"
                     /locus_tag="CELE_F45E4.3"
                     /db_xref="GeneID:177539"
                     /db_xref="WormBase:WBGene00018468"
     CDS             1..26769
                     /gene="cla-1"
                     /locus_tag="CELE_F45E4.3"
                     /standard_name="F45E4.3a"
                     /artificial_location="low-quality sequence region"
                     /note="Partially confirmed by transcript evidence;
                     Product from WormBase gene class cla"
                     /codon_start=1
                     /product="CLArinet, functional homolog of cytomatrix at
                     the active zone proteins piccolo and fife"
                     /protein_id="NP_001294148.2"
                     /db_xref="EnsemblGenomes-Gn:WBGene00018468"
                     /db_xref="EnsemblGenomes-Tr:F45E4.3a"
                     /db_xref="GeneID:177539"
                     /db_xref="GOA:W6RTA4"
                     /db_xref="InterPro:IPR000008"
                     /db_xref="InterPro:IPR001478"
                     /db_xref="InterPro:IPR035892"
                     /db_xref="InterPro:IPR036034"
                     /db_xref="UniProtKB/TrEMBL:W6RTA4"
                     /db_xref="WormBase:WBGene00018468"
                     /translation="
MSSWFSYFGFSKGPPLEEVREESEEDAQVPEQVVSKNTEEEIADAINRLSPEQQNLIQDVLRRAESSRKEAKVVVDAEMMRSRFRQRDSIEDSQEIDHRYSLIQMDSIPENMVTNEMEERLATTQNEDIIPESSQRSPITPRKIHEKRASITEVTTENLRHRFQKMKSHLTTWFNSLDYDGEYIFDFTSKPEKSEKLGELTMQYIDALSQAIMISSHIEYSHHVLSSNPKFQQMCTQFCESIFSVAFDELTYQLLDDKVQETLNEYCGQIAEEALQAAFFTMISKTLSKSKECEQVLNEISSMHKSRSFESAKQLDQLLSRIEDDRESSRKSSPYLYEVLGKSSDSPSTSASVEYRSQNSYESEISFETPDIHVEELFDTHLNEKDETKLILKSVEDKLETTEIEGNVPKIDENLIENIQYDSGDQEHYIWISGPLGRINEEHEDDFEARSESSSGSMITHSTEPKMQLNVEEYIQTMIARVSTENEITNTSNQTANIVIDPGSIDSEEINKLAAKLVEESILKASQEAASDNHEKERSSATSKADYERSFDQDVTYERSSPLLEPSEEPVMESKEPELTQEEIDHIARIQSLAEQSSFEQASTIPDRPPLPARLPTVDEPIVISEQHEEDRSSATSGADYERSFDQEVTYERSSPLLEPCEEPVMESKEPELTQEEIDHIARIQSLAEKSSFEQASTIPDRPPLPARLPTVDEPIVISEQHEEDRSSATSGADYERSFDQDVTYEKSSPLLEPSEDPVMESKEPELTQEEIDHIARIQSLAEKSSFEQTSTIPDRPPLPARLPTVDEPIVSSEQHEEDRSSATSGADYERSFDQDVTYERSSPLLEPCEEPVMESKEPELTQEEIDNIAWIQSIAEQSSFEQASTIPDRPPLPVRLPTVDEPIVSSEQQEEDRSSATSGADYERSFDQDVTYERSSPLLEPSEDPVMESKEPELTQEEIDHIAWIQSIAEQSSFEQASTVPDRPPLPVRLPTVDEPIVSSEQHEDDRSSATSGADYERSFDQDVTYERSSPLLEPCEEPVMESKEPELTQEEIDHIAWIQSSAEQSSFEQASTVPDRPPLPVRLPTVDEPIVSSEQHEEDRSSATSGADYERSFDQDATYERSSPLLEPCEEPVMESRVPELTQEEIDHIARIQSLAEKSSFEQTSTIPDRPPLPARLPTVDEPIVSSEQHEEDRSSATSGADYERSSDQEVTYERSSPLLEPCEEPVMESKEPELTQEEIDHIAWIQSIAEQSSFEQASTVPDRPPLPVRLPTVDEPIVSSEQHEDDRSSATSGADYERSFDQDVTYERSSPLLEPCEEPVMESKEPELTQEEIDHIAWIQSIAEQSSFEQASTVPDRPPLPVRLPTVDEPIVSSEQHEDDRSSATSGDDYERPFDQDFTYERSSPLLEPCEEPVMESRVPELTQEEIDHIAWIQSIAEQSSFEQASTIPDRPPLPVRLPTVDEPIVSSEQHEDDRSSATSGADYERSSDQEVTYERSSPLLEPCEEPVMESKKPELTQEEIDHIAWIQSIAEQSSFEQASTIPDRPPLPVRLPTVDEPIVSSEQHEDDRSSATSGADYERSFDQDVTYERSSPLLEPSEDPVMESKEPELTQEEIDHIAWIQSIAEQSSFEQASTIPDRPPLPVQLPTVDEPIVSSEQQEEDRSSATSGADYERSFDQDVTYERSSPLLEPSEDPVMESKEPELTQEEIDHIAWIQSIAEQSSFEQASKIPDRPPLPVRLPTVDEPIVSSEQHEEDRSSATSGADYERSFDQDVTYERSSPLLEPSEEPVMESRVPELTQEEIDHIAWIQSIAEQSSFEQASTIPDRPPLPVRLPTVDEPIVSSEQHEEDRSSATSGADYERSSDQEVTYERSSPLLEPCEEPVMESKEPELTQEEIDHIAWIQSIAEQSSFEQASTIPDRPPLPVRLPTVDEPIVISEQHEEDRSSATSGADYERSFDQDVTYERSSPLLIPSEDPVMESKESELTQEEIDHIARIQSLAEQSLFEQASTIPDRPPLPVRLPTVDEPIVISEQHEGDRSSATSGADYERSFDQDVMYERSSPLLIPSEDPVMESKESELTQEEIDHIARIQSLAEQSSFEQASTIPDRPPLPVRLPTVDEPIVISEQHEGDRSSATSGADYERSFDQDVTYERSSPLLEPCDEPVMESKEPELTQEEIDHIARIQNLAEQSSFEQASTITDRPPLPVRLPTVDEPIVISEQHEGDRSSATPGADYERSYDQDVTYERSSPLLEPSEVPVMVSKAAVLTQEEIDHIAIMQSLAETEDRKALLEPCEEPVMESKKPELTQEEIDHIAWIQSIAEQSSFEQASTIPDRPPLPVRLPTVDEPIVSSEQHEDDRSSATSGADYERSIDQEVTYERSSPLLEPCEEPVMESKKPELTQEEIDHIAWIQSIAEQSSFEQASTIPDRPPLPVRLPTVDEPIVSSEQHEEDRSSATSGADYERSSDQEVTYDRSSPLLEPCEEPVMESKPELTQEEIDHIAWIQSIAEQSSFEQASTIPDRPPLPVRLPTVDEPIVSSEQHEEDRSSATSGADYERSFDQDVTYERSSPLLEPSEDPVMESKEPELTQEEIDHIAWIQSIAEQSSFEQASTIPDRPPLPVRLPTVDEPIVSSEQHEDDRSSATSGTDYERSFDQDVTYERSSPLLEPCEDPVMESKEPELTQEEIDHIAWIQSIAEQSSFEQASTIPDRPPLPVRLPTVDEPIVSSEQHEDDRSSATSGADYERSFDQDVTYERSSPLLEPSEDPVMESKEPELTQEEIDHIARIQSLAEQSSFEQASTVPDRPPLPVRLPTVDEPIVSSEQHEDDRSSATSGADYERPFDQDFTYERSSPLLEPCEEPVMESKKPELTQEEIDHIAWIQSIAEQSSFEQASTIPDRPPLPVRLPTVDEPIVSSEQHEEDRSSATSGADYERSFDQDVTYERSSPLLEPYEEPVMESKVPELTQEEIDHIARIQSLAEQSSFEQAPTIPDRPPLPVRLPTVDEPIVISEQHEGDRSSATSGADYERSFDQDVTYERSSPLLIPSEDPGNPSEPAPTPEEIHHTACDPSIAAPSSSFEQASTVPDRPPLPVRLPTVDEPIVSSEQHEDDRSSATSGADYERSFDQDVTYERSSPLLEPCEEPVMESKEPELTQEEIDHIAWIQSIAEQSSFEQASTVPDRPPLPVRLPTVDEPIVSSEQHEDDRSSATSGADYERSFDQDVTYERSSPLLEPCEEPVMESKEPELTQEEIDHIAWIQSIAEQSSFEQASTIPDRPPLPVRLPTVDEPIVSSEQHEDDRSSATSGTDYERSFDQDVTYERSSPLLEPSEEPVMLSKEAELTQEEIDHIAIIQSLAEKSSFEQFGIQTGHPFLPVRILTERQNDHDRISEEDNTSSCSSENNIILKYSDISYDRNTPLLNSDDEFLEKDFGASAESSEPSQGNWAKFEEISSSSNAEWPTNISTYKFPSFSEKNVNEDLLNKSSWDCRDNVIVDDVIEEEDENDLLGDVTYSREVNKDYWKDSSTIPLVRIECVSDEQINVNEETPGIDKEIKSAEISKDDNSVVSCSSENQIDHTNDEHFDFGQEDSEHEELKHCSSQYSFDSSLPPFHRYVACPSITPSEGDDGGSSETGHPTTDECYNEDVNRQIEQYSALASLSKSVLPVVEIKIDEATSESSVLQLDDDDKSISEQEDFIDNMDLTLKRNEDKTNITNLGASEIQQQEENEISAQTAEVESSDSWNSKTVKMLSDDSAFAEETQHVDLVSTSATKHEDYAEEQTLSQEEIDHIARITAMATEDNTDLQTLPTPQVRQNEPELSQKEIDHITRIAAMANKDFGMYPSIVSEHPAPVESELTQEELDHIARITEIASMDISTLPPPTGKPSETSLTQEELDHIARIAEMASAEYDVPVKIFEPPELTQEELDHIAKITAMAAQDVQLPATQRSITHKVSLTPPPPPPSKHFEQDLTQEELDHIARIAEMADMDYNTPFTAEPVQDEEEEPITESGSDATSGADIFDEQEDASSDREKRSGTSFPDNAETSLEDDTAHEKSYPQLEPSEEPVMKSKEPELTQEEIDHFARIQSLAEQSSFEQASTIPDRQPLPVRLPTVDEPIVISEQHEGDRSSATSGADYERSFDQDVTYERSSPLLEPCDEPVMESKEPELTQEEIDHIARIQSLAEQSSFEQTSTIPDRQPLPVRHPTVDEPIVISGQHEEDRSSATSGADYQQSFDQDDPSKRSSPLLEPNEEQMMESTQPELTQDHSSTTISDILIKEVDKFIPEAKFGRSFEEHDGRLIHSGNLDIDVPLESDCRKTFGQDKSESTMPTELTEADLERVARIHQHFDQSSFDEVVVPTSHPDDGRSSSVRSSEYLDTVTPLSSCAATPILTNPKLVQEELDHIAFIQKMAEQFTFDEVETPILRQNTTSHSVSYNFVQRSCHEDVSFQKKESPALTSLKEIAESSQLTQEELDHIASIQQMADQPYFEESHFIFKSDVKEEKKEDKLHHELFVEECVAQESITQDDVERKPLELTQEEIDHIAKIQKLADQSSFEQASAIQSLPTAEEPIVEKREDDKSNITSGADYQQSFDQDVTYKRSSPLLEPSEEPVMESKEPELTQEEIDHIARIQSLAEQSSFEQASTIPDRPPLPVRLPTVDEPIVISEQHEGDISSATSGADYERSLDQDVTYERSSPLLEPCDEPVMESKEPELTQEEIDHIARIQSLAEQSSFEQASTIPDRPPLPVRLPTVDEPIVSSEQHEEDRSSATSGADIERSFDIDVSQDRVSPISEHEEGVTQEEMEHIARIAAMAAEDFKHPEGNLEPEFSQPDKDHIAMMKKLEEQSKMENQELPANPIIHTDQVDRQESEGSSSATSGADIPSSFDISSPIPPEPLQDHITTSQKLISRPSIEISNVPSRLPELSLTAVQRGSEDISSATSGAGIERSFDGISPLPNFSEEPIMINDEMNYVLMVTHMAQKIDVQQPIQETSTLRKAVLCESPEDFSEATSGADTESISETTANKKDSNDSNGLTEEEMKHIAEVLRKAEASSAASGMFERDSNLPPLRRTSITYTSHFSPSVIRDLRSSTSFTSVPAASDEEEIVKGKLKREPSTQVVYTDHFLRDLQSINAYLEKGEDGTDVTIEETSHDNESSSLPEEDEHITDVYHFDVGTSLLVQQYILQQSTFQEAAGLHISPIRRTMSAACTAEKHIDDEENIKEREVKHAQSHDQIKKRAGGEPNAYELLEQHSFRHTQPLLCNVDFLWRLNFAANRMTEEIADEAGRELRAHYRNVANPRARYFSDAYDIGTDDEEEEVTETSQAGFSVEPMRHEEQSYGLFSFFTSSKRSVSDRPRSALAMFTNPSPSASPSLLRKESEDRGDILNLLRRSSGADSRASNDSSASRLPDTALVGLSEAEKQHIMSVMSRSNRNTSPMTSRRCSSALQMLPEVDNLSEAEKEHIQTILEKAESKTPFMIKVPMKKQISSRTESTNSRVSSEGIDEEVENEVQRKKTIEEPIVEIPSRAVTPRNNLRVIPPPIAISHPTPPHSAKTDTGSRHSSGSSAHSQFGFSTPSISGFKIFFDKAKTATETLVKEIKDEVIVEVDKDKTETKPEPNVSNELTAEEFEHIRRINEMAGIDEPIQPPPIAQERRKSSVVSGLKNMFGVGKHDESELTTEEKEHIRQMSLMAEKMDEEILDEQSKPKSTFGLKNFFGKATQSVMHATDSVIKNVQNQSKQSLSGLTQEELDNIAQATESAQQESKQELTQDEIDHIARINAMAAEDFEQPAVNMNQGLSQAEKDHIARIEAMAADDSQSKIIVPPPSIIQKDIELSMEEMDHIARIAAMADEDFTHPVKGAVAPIYDENYSRDDGAIDRFPASTATPVFAQPSEIELSEEEREHISRIAAMAEEDFNTPYVSTHPTQQIEIELTEEEKEHIARIEAMASEDLNAPSPFIQQEQRVATMPVPINYHVEEPTLSQEEIDHIARITAMATEDNTDLQTLPTPQVKQNEPELSQEEIDHITRIAAMANEDFGMYPSIVSEHPAPVESELTQEELDHIAKITGMASMDISTLPPPTGKPSETSLTQEELDHIARIAEMASAEYDVPVKIFEPPELTQEELDHIAKITAMAAQDVQLPATQRSITHKVSLTPPPPPPSKHFEQDLTQEELDHIARIAEMADMDYNTPFTAEPVQDEEEEPITESGSDATSGADIFDEQEDASSGASGSFDNNNAQVLTSGFSPDRVTSPAALDTTEEPQGPIMAQKTVSPTPSADSMASRKSSEYDIRSISEIRQESESDIGKWYEEQLSFMRQSIHDEEEDVGHEIRTDVEEFPLEYVEDQLHFLEGIDVESQHHEPTTSSAFFGTGRSIGEGEKRKYGDDAVEQQKLENYEEEEKTKSSSREAFDDGFETQREESLRAQQTPIDSLPGSRMLKRPNFGFLSNIANDAINKAKEAGSQIQAAVPIKPSSSSSNIVNNNVFSSSKSSTSLGTSAPTKSIPSPQIGIPMDGLSEEERRQIMSVMAAADFDDSVNNVKPSTSGSSNIPAGMEDLSEAEREKIMSVMANAEMEMGARFPPPSSQIPTRSPSVMSSSIMSELPPGLDDLSDDERMKIMAVMAEADMQNVRKPIARGPPPMPPSTSMIPPGMEGLSEEERQKIMSVMANAETDSSSSVITSRQPSRSPSVARMQPQLMPPQQAIPIIPPGLEGLSDEERHTIMSVMAEAEFEESRSQVPSRQPSRSPSFVNPQQSFHPIPSFEPIVPPGLEDLSEEERQKIMSVMMNAEVEESRSQLPSRQPSRSPSVAMIQAPAVPIIPSGMEDLPEAERQKIMSVMAEAEIQNFVPSRSPSNYSMQPVPVIPHGLEDLSEAERQKILSVMAEAEIDSAKIPSRSTSSYSMPPPLPQMSQPEITTGLEHSSEADMEFGRDSSRSHQVIPPGLENLSEEERQQIMSVMAHAELESIIPSGHIDQPISLPRGHTGFKPAGIVNEDELFETERKQREESPTRESGYATSTSYERELAMGDEERMDGLLEDIIRIREGARSRRDSRDEVLHRREEDPEVHTPEESSTAVVTDVPSVSPVTENVPEKQTDDFDFTYSDSRFAEIVQMQEEEEAGSLQKQKVDEKPRMWETVFDGDESELPHQDFVFNEPTTKKTSDFDFPKETDEVFEKPSEIQRIRVTKNHDVDMDEIYDNVIATEAPSSVSQRRQPVDSETSVKSRTIQRGPTKPPPMIKITVEEETKSDSDEESCSEDDEEYPDRVVAAPTAPAPTFEEVENERIRQEELGKEVLQQIMAFGEVANDEFDVQWAKTTTSQTPSTSTKPTVTAPKRSDPIPIAPSQRSKEIEEERIRTEALEEEEFYRHGHNPFLESPEEDEVSINMEDVEYAEIARLYESANQTMRRPGPVYTITEDESEDDGTLSNSESRLVAREKRLMDKKTADSLMAKYQKMKKVQAKQTTTASSTSVTATPAYAIINFSDLKTSTRTTDSNSYFETTKNIPALEIKDPKKDIPPEISASIDKTMAEVDALLGQVYTNEKAIPNLLCFDQSNFSNHPPTSSASTSTADDLILLKNNNSSSPSFLLPLQSSVLGSQLDSVRDDNERNENETTSPRGLKRSPGMLLPSPTSTSIFPMPPTAAESVGAAIGATTASMFGGISVADPPPTMDGLTNSYKWLQNIEDDGNLANNDMGRRKLPSIPPNSSAFPPPTSVTTNVISTDTSMPSTSSGPAPTYVDDYNVTLPSDPIVAESLLKGGSLTRRHQHQQQHQAPVYITSSASRPPSAAGSNIFQESRPTSSLSMYQNDVILSRPGSAASNYTTASTINPTILAGASYSSKASSHIRQPVSVRSPRAQTGTTQTTAASGSASNSIRPSIGSSSVTTRVPNTLARVLLKKELKDVLIQRKQRLEATEIEANQRHYKVQKMLITGLLPEKPEDDIPNIVKCDLPADLVRGVHISMQPPSPAVSAFSPRRYHHPTSVASHQSHPSTFKHMSKSIACQADELPPVKPMISLRTQLDMERRPQLMTYVGKRSAETQTELANYESITPTVRYGSIPRSSRERTASRRYREQQQQIYNQMPQNHNDLLEITKKYFEDYDRQLREFGERARRHSRRRFDFHDDDDQDDMRKNQVMHELARRKERMCASCEILSTTDPIRTALNPNVPMSSDYSSHVPHYGSLPRIDYPRGTRSDVRDFTYRQQHLPQQPPTNYSYNYGSLPRNFERGFSDLPPIEIENEQSFGAPPRHRSNLGYESTSMFNLSDPVYLGYDSIPMVQHQQPRVYDQIPSGYAQDTTNLNSLNQGVRGSDMVSQYASYLNSQFQSGLQQSAQLPQPMIPITRYDAPMSDPYVSSRSRLVDQMNQGYNSNQYHHHSTLLAPKSAQMTHIAPTYNQLAQQQGIPMQNTQMDPLMMSSGRIPSSSSQVYSRNEMNYGSRPAQSSLFEYGNRRQYGAAPPPTYDVPNVSSASDWRTTQQQGLIQQMPMQMQQQQHNTFDARWPKEDALSRMYATASRRRAQETALTSSNKISTGSRSYARRPIRPSSYRNPEATNSMPDRHVARRTAENSRYDVKRILLTRSYKHHNIYNDLGVRVVGGKRQMNGELSAYVSQLHSTANNQTLGQIKIGDEVVEWNGILLRGKTFEEVERIVNKSHGEIEMVIRTYKNPSSGVYDTLPLNRNTMRDDLSPDRVPPVPMHRINGINNNSVLHHHTLSDSSCHGHIQVSLGYDGNSRLVAKIIRARGLKSRDQSRSAPNPFVKVYLLPGRKVSHKRRTRFVDSSCAPEWNQVLEYQVAPHTLNTMFLEFTVCDYQRDVDDLPLGNVQIPLADKSAINTGPRWYPLQGSYDQPIPQHYMNGTSLSQIPSIAAASKHSAAVHNHHNHNYSEVPPSILYPKGGVGTRHPDKPVRHATFNYNPVSLDIGYPAIN"
     misc_feature    2182..>2781
                     /gene="cla-1"
                     /locus_tag="CELE_F45E4.3"
                     /note="Bacterial conjugation TrbI-like protein; Region:
                     TrbI; cl23849"
                     /db_xref="CDD:329122"
     misc_feature    25702..25974
                     /gene="cla-1"
                     /locus_tag="CELE_F45E4.3"
                     /note="PDZ domain found in a variety of Eumetazoan
                     signaling molecules, often in tandem arrangements. May be
                     responsible for specific protein-protein interactions, as
                     most PDZ domains bind C-terminal polypeptides, and binding
                     to internal (non-C-terminal)...; Region: PDZ_signaling;
                     cd00992"
                     /db_xref="CDD:238492"
     misc_feature    order(25753..25764,25768..25770,25924..25929,25936..25941)
                     /gene="cla-1"
                     /locus_tag="CELE_F45E4.3"
                     /note="protein binding site [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238492"
     misc_feature    26140..26514
                     /gene="cla-1"
                     /locus_tag="CELE_F45E4.3"
                     /note="C2 domain first repeat contained in
                     Rab3-interacting molecule (RIM) proteins; Region:
                     C2A_RIM1alpha; cd04031"
                     /db_xref="CDD:175997"
     misc_feature    order(26230..26232,26251..26253,26413..26415,26419..26421,
                     26437..26439)
                     /gene="cla-1"
                     /locus_tag="CELE_F45E4.3"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:175997"
     STS             11585..12570
                     /gene="cla-1"
                     /locus_tag="CELE_F45E4.3"
                     /standard_name="T23A7.b"
                     /db_xref="UniSTS:322629"
     STS             11585..12288
                     /gene="cla-1"
                     /locus_tag="CELE_F45E4.3"
                     /standard_name="T23A7.b"
                     /db_xref="UniSTS:322629"
     STS             16477..17659
                     /gene="cla-1"
                     /locus_tag="CELE_F45E4.3"
                     /standard_name="F45E4.4"
                     /db_xref="UniSTS:311229"
     STS             23931..24984
                     /gene="cla-1"
                     /locus_tag="CELE_F45E4.3"
                     /standard_name="F45E4.3"
                     /db_xref="UniSTS:306319"
ORIGIN      
atgtcatcctggttttcatattttggattcagtaaaggtccacctctggaagaggtaagggaggaatccgaggaagatgctcaagtgcctgaacaagttgtgtctaaaaatacagaggaagaaatagcggatgcaataaatagattgtcaccagagcaacaaaatttaatacaagatgtgcttcgacgagcagaaagttcaagaaaagaagccaaagttgttgtagacgctgaaatgatgagatcgagatttagacaaagagattcaatagaagactcacaggaaatagaccatcgttattcgttaattcaaatggattcgatcccggagaatatggtcacaaatgaaatggaagaacgattggccacaacacaaaatgaagatataatcccagaatcctcccaaagaagtccaataactccacggaaaatacatgaaaaacgagcatctattacggaagtgacaacagaaaaccttcggcatcgattccaaaaaatgaaatcacatttgactacatggttcaactcacttgattatgatggtgaatacattttcgattttacgagtaaacctgaaaagtctgaaaaactcggagaactcacaatgcaatacattgatgctctaagccaggcaataatgatatcatctcatattgaatattcgcatcatgtattatcatctaatcccaaatttcaacagatgtgcactcaattctgtgaatcgatattttcagtagcttttgatgaattaacttatcaattattggatgataaggttcaagaaacgctcaacgaatattgtggtcaaatagccgaagaagcccttcaagcagctttctttacaatgatttcaaagacattgtcgaaatctaaagaatgcgaacaagtattgaatgaaatttcatcgatgcacaaatcacgatcatttgaaagtgcaaaacaactagatcaattattgagcagaatagaagacgatcgcgaatcgagcagaaaatcatctccttatttgtacgaagtacttggaaaatcaagtgacagcccatcaacatcagcatccgtcgaatatcgttctcaaaattcttacgaatcagaaatctcatttgaaacaccagatattcatgttgaagaattgtttgatacgcatctgaacgaaaaagacgaaacaaagctaattctgaagtcagttgaggataagctcgaaaccactgaaatagaaggaaacgtgccaaaaattgacgagaatcttatcgagaatattcaatatgatagtggcgaccaagaacattatatttggatctctggtccattgggaaggataaatgaggaacatgaagacgacttcgaggcacgttcagaaagtagctcaggaagtatgataacacatagtacagagccgaagatgcaactgaacgttgaagaatatattcaaacaatgatcgcaagagtttccacggaaaatgaaattaccaatacgagtaatcaaacagcaaacatagtaattgatccaggaagtattgattcagaagaaataaacaaattagccgcaaaattagttgaagaatcaattctcaaagcatcacaggaagcagcatcagataaccacgagaaagaaagatcaagtgcaacatcaaaagctgattatgaaagatcatttgatcaagacgtcacttatgaaagatcttcaccgttgcttgaaccaagtgaagaaccagtgatggaatccaaagaaccagaactgacacaagaagagattgatcacattgcaaggatccagagtcttgcagaacaatcatcattcgaacaagcttcaacgattcctgatcgaccacctcttccagcccggcttccgactgtagacgagccgattgtcatctcagaacaacacgaagaagacagatcaagtgcaacatcgggagctgactatgaaagatccttcgatcaagaagtcacgtatgaaagatcttcaccgttgcttgaaccatgtgaagaaccagtgatggaatccaaagaaccagaactgacacaagaagagattgatcatattgcaaggatccagagtcttgcagaaaaatcatcattcgaacaagcttcaacgattcctgatcgaccacctcttccagcccggcttccgactgtagacgagccgattgtcatctcagaacaacacgaagaagacagatcaagtgcaacatcaggagctgactatgaaagatccttcgatcaagacgtcacgtatgaaaaatcttcaccgttgcttgaaccaagtgaagatccagtgatggaatccaaggaaccagaactgacacaagaagagattgatcatattgcaaggatccagagtcttgcagaaaaatcatcattcgaacaaacatcaacgattcctgatcgaccacctcttccagcccggcttcctactgtagacgagccgattgtcagctcagaacaacacgaagaagacagatcaagtgcaacatcaggagctgattatgaaagatccttcgatcaagacgtcacgtatgaaagatcttcaccgttgcttgaaccatgtgaagaaccagtgatggaatccaaggaaccagaactgacacaagaagagattgataatattgcttggattcaaagcattgcagaacaatcatcattcgaacaagcttcaacgattcctgatcgaccacctcttccagtccggcttccgactgtagacgagccgattgtcagctcagaacaacaagaagaagacagatcaagtgcaacatcaggagctgattatgaaagatccttcgatcaagacgtcacgtatgaaagatcttcaccgttgcttgaaccaagtgaagatccagtgatggaatctaaggaaccagaactgacacaagaagagattgatcatattgcttggattcaaagcattgcagaacaatcatcattcgaacaagcttcaacggttcctgatcgaccacctcttccagtccggcttccgactgtagacgagccgattgtcagctcagaacaacacgaagatgacagatcaagtgcaacatcaggagccgattatgaaagatccttcgatcaagacgtcacgtatgaaagatcttcaccgttgcttgaaccatgtgaagaaccagtgatggaatccaaagaaccagaactgacacaagaagagattgatcatattgcttggatccagagctctgcagaacaatcatcattcgaacaggcttcaacggttcctgatcgaccacctcttccagtccggcttccgactgtagacgagccgattgtcagctcagaacaacacgaagaagacagatcaagtgcaacatcaggagctgattatgaaagatccttcgatcaagacgccacgtatgaaagatcttcaccgttgcttgaaccatgtgaagaaccagtgatggaatccagagtaccagaactgacacaagaagaaattgatcacattgcaaggatccagagtcttgcagaaaaatcatcattcgaacaaacatcaacgattcctgatcgaccacctcttccagcccggcttcctactgtagacgagccgattgtcagctcagaacaacacgaagaagacagatcaagtgcaacttcaggagctgactatgagagatcatctgaccaagaagtcacgtatgaaagatcttcaccgttgcttgaaccatgtgaagaaccagtgatggaatccaaggaaccagaactgacacaagaagagattgatcatattgcttggattcaaagcattgcagaacaatcatcattcgaacaagcttcaacggttcctgatcgaccacctcttccagtccggcttccgactgtagacgagccgattgtcagctcagaacaacacgaagatgacagatcaagtgcaacatcaggagctgattatgaaagatccttcgatcaagacgtcacgtatgaaagatcttcaccgttgcttgaaccatgtgaagaaccagtgatggaatccaaagaaccagaactgacacaagaagagattgatcatattgcttggattcaaagcattgcagaacaatcatcattcgaacaagcttcaacggttcctgatcgaccacctcttccagtccggcttccgactgtagacgagccgattgtcagctcagaacaacacgaagatgacagatcaagtgcaacatcaggagatgattatgaaagacccttcgatcaagacttcacgtatgaaagatcttcaccgttgcttgaaccatgtgaagaaccagtgatggaatccagagtaccagaactgacacaagaagagattgatcatattgcttggattcaaagcattgcagaacaatcatcattcgaacaggcttcaacgattcctgatcgaccacctcttccagtccggcttccgactgtagacgagccgattgtcagctcagaacaacacgaagatgacagatcaagtgcaacatcaggagctgattatgaaagatcatctgaccaagaagtcacgtatgaaagatcttcaccgttgcttgaaccatgtgaagaaccagtgatggaatccaaaaaaccagaactgacacaagaagagattgatcatattgcttggattcaaagcattgcagaacaatcatcattcgaacaggcttcaacgattcctgatcgaccacctcttccagtccggcttccgactgtagacgagccgattgtcagctcagaacaacacgaagatgacagatcaagtgcaacatcaggagctgattatgaaagatccttcgatcaagacgtcacgtatgaaagatcttcaccattgcttgaaccaagtgaagatccagtgatggaatctaaggaaccagaactgacacaagaagagattgatcatattgcttggattcaaagcattgcagaacaatcatcattcgaacaagcatcaacgattcctgatcgaccacctcttccagtccagcttccgactgtagacgagccgattgtcagctcagaacaacaagaagaagacagatcaagtgcaacatcaggagctgattatgaaagatccttcgatcaagacgtcacgtatgaaagatcttcaccgttgcttgaaccaagtgaagatccagtgatggaatctaaggaaccagaactgacacaagaagagattgatcatattgcttggattcaaagcattgcagaacaatcatcattcgaacaagcttcaaagattcctgatcgaccacctcttccagtccggcttccgactgtagacgagccgattgtcagctcagaacaacacgaagaagacagatcaagtgcaacatcaggagctgattatgaaagatccttcgatcaagacgtcacgtatgaaagatcttcaccgttgcttgaaccaagtgaagaaccagtgatggaatccagagtaccagaactgacacaagaagagattgatcatattgcttggattcaaagcattgcagaacaatcatcattcgaacaagcttcaacgattcctgatcgaccacctcttccagtccggcttccgactgtagacgagccgattgtcagctcagaacaacacgaagaagacagatcaagtgcaacatcaggagctgattatgaaagatcatctgaccaagaagtcacgtatgaaagatcttcaccgttgcttgaaccatgtgaagaaccagtgatggaatccaaagaaccagaactgacacaagaagagattgatcatattgcttggattcaaagcattgcagaacaatcatcattcgaacaagcttcaacgattcctgatcgaccacctcttccagtccgacttccgactgttgacgagccgattgtcatctcagaacaacacgaagaagacagatcaagtgcaacatcaggagctgattatgaaagatcttttgatcaagacgtcacgtatgaaagatcttcaccgttgcttataccaagtgaagatccagtgatggaatccaaggaatcagaactgacacaagaagagattgatcatattgcaaggatccagagtcttgcagaacaatcattattcgaacaagcttcaacgattcctgatcgaccacctcttccagtccggcttccgactgtagacgagccgattgtcatctcagaacaacacgaaggagacagatcaagtgcaacgtcaggagctgattatgaaagatcctttgatcaagacgtcatgtatgaaagatcttcaccgttgcttataccaagtgaagatccagtgatggaatccaaggaatcagaactgacacaagaagagattgatcacattgcaaggatccagagtcttgcagaacaatcatcattcgaacaagcttcaacgattcctgatcgaccacctcttccagtccggcttccgactgtagacgagccgattgtcatctcagaacaacacgaaggagacagatcaagtgcaacatcaggagctgattatgaaagatcctttgatcaagacgtcacgtatgaaagatcttcaccattgcttgaaccatgtgatgaaccagtgatggaatccaaggaacccgaactgacacaagaagagattgatcacattgcaaggatccagaatcttgcagaacaatcatcattcgaacaagcttcaacgattactgatcgaccacctcttccagtccggcttccgactgtagacgagccgattgtcatctcagaacaacacgaaggagacagatcaagtgcaacaccaggagctgattatgaaagatcctatgatcaagacgtcacgtatgaaagatcttcaccattgcttgaaccaagtgaagtaccagtgatggtatccaaggcagcagttctgacacaagaagagattgatcacattgcaattatgcagagtcttgcagaaactgaagacagaaaggcgttgcttgaaccatgtgaagaaccagtgatggaatccaaaaaaccagaactgacacaagaagagattgatcatattgcttggattcaaagcattgcagaacaatcatcattcgaacaggcttcaacgattcctgatcgaccacctcttccagtccggcttccgactgtagacgagccgattgtcagctcagaacaacacgaagatgacagatcaagtgcaacatcaggagctgattatgaaagatcaattgaccaagaagtcacgtatgaaagatcttcaccgttgcttgaaccatgtgaagaaccagtgatggaatccaaaaaaccagaactgacacaagaagagattgatcatattgcttggattcaaagcattgcagaacaatcatcattcgaacaggcttcaacgattcctgatcgaccacctcttccagtccggcttccgactgtagacgagccgattgtcagctcagaacaacacgaagaagacagatcaagtgcaacatcaggagctgattatgaaagatcatctgaccaagaagtcacgtatgatagatcttcaccgttgcttgaaccatgtgaagaaccagtgatggaatccaaaccagaactgacacaagaagagattgatcatattgcttggattcaaagcattgcagaacaatcatcattcgaacaggcttcaacgattcctgatcgaccacctcttccagtccgacttccgactgtagacgagccgattgtcagctcagaacaacacgaagaagacagatcaagtgcaacatcaggagctgattatgaaagatccttcgatcaagacgtcacgtatgaaagatcttcaccgttgcttgaaccaagtgaagatccagtgatggaatctaaggaaccagaactgacacaagaagagattgatcatattgcttggattcaaagcattgcagaacaatcatcattcgaacaagcttcaacgattcctgatcgaccacctcttccagtccggcttccgactgtagacgagccgattgtcagctcagaacaacacgaagatgacagatcaagtgcaacatcaggaactgattatgaaagatccttcgatcaagacgtcacgtatgaaagatcttcaccgttgcttgaaccatgtgaagatccagtgatggaatccaaggaaccagaactgacacaagaagagattgatcatattgcttggattcaaagcattgcagaacaatcatcattcgaacaggcttcaacgattcctgatcgaccacctcttccagtccggcttccgactgtagacgagccgattgtcagctcagaacaacacgaagatgacagatcaagtgcaacatcaggagctgattatgaaagatccttcgatcaagacgtcacgtatgaaagatcttcaccgttgcttgaaccaagtgaagatccagtgatggaatccaaggaaccagaactgacacaagaagagattgatcatattgcaaggatccagagtcttgcagaacaatcatcattcgaacaagcttcaacggttcctgatcgaccacctcttccagtccggcttccgactgtagacgagccgattgtcagctcagaacaacacgaagatgacagatcaagtgcaacatcaggagctgattatgaaagacccttcgatcaagacttcacgtatgaaagatcttcaccgttgcttgaaccatgtgaagaaccagtgatggaatccaaaaaaccagaactgacacaagaagagattgatcatattgcttggattcaaagcattgcagaacaatcatcattcgaacaggcttcaacgattcctgatcgaccacctcttccagtccggcttccgactgtagacgagccgattgtcagctcagaacaacacgaagaagacagatcaagtgcaacatcaggagctgattatgaaagatcttttgatcaagacgtcacgtatgaaagatcttcaccgttgcttgaaccatatgaagaaccagtgatggaatccaaagtaccagaactgacacaagaagagattgatcatattgcaaggatccagagtcttgcagaacaatcatcattcgaacaagctccaacgattcctgatcgaccacctcttccagtccggcttccgactgttgacgagccgattgtcatctcagaacaacacgaaggagacagatcaagtgcaacatcaggagctgattatgaaagatcttttgatcaagacgtcacgtatgaaagatcttcaccgttgcttataccaagtgaagatccagggaatccaagcgaaccagcaccgacaccagaagagattcatcatactgcctgcgatccaagcattgcagcaccatcatcatcattcgaacaagcttcaacggttcctgatcgaccacctcttccagtccggcttccgactgtagacgagccgattgtcagctcagaacaacacgaagatgacagatcaagtgcaacatcaggagctgattatgaaagatccttcgatcaagacgtcacgtatgaaagatcttcaccgttgcttgaaccatgtgaagaaccagtgatggaatccaaagaaccagaactgacacaagaagagattgatcatattgcttggattcaaagcattgcagaacaatcatctttcgaacaagcttcaacggttcctgatcgaccacctcttccagtccggcttccgactgtagacgagccgattgtcagctcagaacaacacgaagatgacagatcaagtgcaacatcaggagctgattatgaaagatccttcgatcaagacgtcacgtatgaaagatcttcaccgttgcttgaaccatgtgaagaaccagtgatggaatccaaagaaccagaactgacacaagaagagattgatcatattgcttggattcaaagcattgcagaacaatcatcattcgaacaggcttcaacgattcctgatcgaccacctcttccagtccggcttccgactgtagacgagccgattgtcagctcagaacaacacgaagatgacagatcaagtgcaacatcaggaactgattatgaaagatccttcgatcaagacgtcacgtatgaaagatcttcaccattgcttgaaccaagtgaagaaccagtgatgttatccaaggaagcagaactgacacaagaagagattgatcacattgcaattatccagagtcttgcagaaaaatcatcttttgaacaatttgggattcaaactggacacccatttttgcccgtcaggattttaactgaaagacagaatgatcatgatagaatctcagaagaagacaacacttcaagttgttcctcggaaaacaacataattctaaaatattctgacatttcatatgatcgtaataccccgcttctaaattctgacgatgagtttttggagaaagactttggagcatcagctgaaagttcagagcccagtcaaggtaactgggcaaagttcgaagaaattagttcctcatcgaatgctgaatggccgacaaacatatcaacttataagttcccatcattctccgaaaagaatgttaatgaagaccttctaaacaaatctagttgggattgtagagataatgttatcgtagatgatgtgattgaagaagaagacgaaaatgatctattaggagatgtaacatattctcgcgaagtaaataaagattactggaaagattcttcaacaattccgttggttcgaattgaatgcgtatcggatgaacaaattaatgttaatgaagaaaccccgggaatagataaagaaattaaaagtgctgaaatctcgaaagatgataattcagtcgtgtcctgctcttcggagaatcaaattgatcataccaacgatgaacactttgattttggtcaagaagattcagaacatgaggaattgaaacactgctcgtcacaatattcatttgattcatctttgcctcctttccatcgatatgttgcatgcccttcaattactccttcagaaggtgatgatggaggatcatctgaaactggtcatccaactactgatgaatgttataatgaagatgtcaacaggcaaattgagcaatattctgctttggcatcattgtcgaaatctgttcttccagttgttgaaataaaaattgatgaagcgacaagtgagtcatcagtattacagttagatgatgacgataaatcaatttctgaacaagaggactttattgacaacatggacttgacactgaaacgaaatgaagataaaacaaatattacaaatctgggagcatcagaaattcagcaacaagaagaaaacgaaatcagcgcacaaactgcagaagttgaatcttcggatagctggaactcgaaaacagtaaaaatgctttctgatgattcagcattcgcagaggaaacccagcatgttgatttagtctctacttcagcaacaaaacatgaggactatgcagaagaacaaactctatcgcaagaagaaattgatcacattgcaagaataacagctatggctactgaagataacactgatctacaaactctaccaactcctcaagttagacaaaatgaaccggagctctcccaaaaagaaatcgatcacattactcgaatagctgcaatggcaaataaagactttggaatgtatccttcaattgtttctgaacatcctgctccagttgaatctgaacttactcaagaagaacttgaccatatcgctaggatcactgaaatagcatctatggacatcagtactctaccacctccaacaggaaaaccatccgagacatcacttactcaggaagaacttgatcatattgctcgcatagctgaaatggcatcagcagaatatgatgttcctgtaaaaatattcgaaccaccagaactaactcaagaggaacttgatcatatagcaaagattactgcaatggctgcacaagatgtccaacttcctgccacccaaagatcgattactcataaggtttcgttgactccacctcctcctcctccttctaaacactttgagcaagatctcactcaagaagagcttgaccatattgcaagaattgctgagatggctgatatggattataacactccattcactgctgaaccagttcaagatgaagaagaagaaccaataacagaaagtggatcagatgcaacatcaggtgctgatatattcgatgaacaagaagatgcaagttcagatagagagaagcgatcgggtacttcatttcctgataatgctgaaacatcattagaagatgacaccgcgcacgagaaatcttatccgcagcttgaaccaagtgaagaaccagtgatgaaatccaaggaaccagaactgacacaagaagagattgatcactttgcaaggatccaaagccttgcagaacaatcatcattcgaacaagcttcaacgattcctgatcgacaacctctaccagttcggcttccgactgttgacgagccgattgtcatctcagaacaacacgaaggagacagatcaagtgcaacatcaggagctgattatgaaagatccttcgatcaagacgtcacgtatgaaagatcttcaccattgcttgaaccatgtgatgaaccagtgatggaatccaaggaaccagaactgacacaagaagagattgatcacattgcaaggatccaaagtcttgcagaacaatcatcatttgaacaaacttcaacgattcctgatcgacaacctcttccagtccggcatccgactgttgacgagccgattgtcatctcaggacaacacgaagaagacagatcaagtgcaacatcaggagctgactatcaacaatcatttgatcaagacgatccttccaaaagatcttcacctttgcttgaaccaaatgaagaacaaatgatggaatccacccagcctgaattaacacaagatcacagttcaacaactatatccgatattttaatcaaagaagttgataaattcataccagaagcaaagtttgggcgaagtttcgaagaacatgacggaagactcattcattcaggaaatttagatattgatgttccattagaatctgattgtagaaagacatttggccaagataagagcgagtcaactatgccaaccgagcttacggaagcggatcttgaaagagttgctagaatccatcaacattttgatcaatcatcgtttgatgaagtggttgttccaacttcccatccagatgatggtcgctcaagttctgttagatcaagtgaatatctagatacagtaacgccactttcttcttgtgcagccacccctattttgacgaatccaaagctcgttcaagaagaacttgatcatatcgcattcattcaaaaaatggctgaacaattcacatttgacgaggtggaaactccaattttgaggcagaacacaacatcacacagcgtcagttacaactttgttcaaagatcatgtcatgaagatgtcagtttccagaaaaaagaatcaccagctctaacttcattgaaagaaattgcggaatcatcgcagttaactcaagaagaactagatcatatagcaagcattcaacaaatggcagatcagccgtattttgaagaaagtcatttcattttcaaatctgatgttaaagaggaaaaaaaggaagataaactacaccatgaattatttgttgaagaatgtgtagcacaagaatcaataacacaagatgatgttgagagaaaacccctcgagctgacgcaagaagagattgatcacattgcaaaaatccagaaacttgcagatcaatcgtcatttgaacaagcttcagctatccaatcacttccaactgccgaagaaccaatcgtggagaaacgtgaagatgacaaatcaaatataacttcaggagctgattatcaacaatcatttgatcaagatgtcacgtataaaagatcttcaccgttgcttgaaccaagtgaagaaccagtgatggaatccaaggaacccgaactgacacaagaagagattgatcacattgcaaggatccagagtcttgcagaacaatcatcattcgaacaagcttcaacgattcctgatcgaccacctcttccagtccggcttccgactgttgacgagccgattgtcatctcagaacaacacgaaggagacatatcaagtgcaacatcaggagctgattatgaaagatcccttgatcaagacgtcacgtatgaaagatcttccccattgcttgaaccatgtgatgaaccagtgatggaatccaaggaacccgaactgacacaagaagagattgatcacattgcaaggatccagagtcttgcagaacaatcatcattcgaacaagcttcaacgattcctgatcgaccacctcttccagtccggcttccgactgttgacgagccgattgtcagctcagaacaacacgaagaagacagatcgagtgcaacatctggagctgatattgagagatctttcgatattgatgtgtcacaagatcgagtatcaccaatttctgagcacgaagaaggtgtcacacaagaagaaatggaacatattgcaagaattgctgcaatggctgcagaagattttaaacatcctgaaggtaacttggagccagagttttctcagccagataaggaccatattgctatgatgaaaaaactagaagagcaatcgaaaatggagaatcaggaattacctgcaaacccaattattcatacagatcaagtggatcggcaagagtcagaaggaagttctagtgctacttctggtgcagatataccctcttcatttgacatttcatctcccattccaccagaaccacttcaagatcatattaccacttctcaaaaattaatatcacgaccttcaattgaaatatcgaatgttccgagccgtcttccagagctatcattaacagctgttcaacgtggttctgaagatatttctagtgcaacatctggggctggtatcgagcgatcattcgatggaatatctccacttcccaacttttcggaagaaccaatcatgatcaatgatgagatgaattacgtgctgatggttacccacatggctcagaaaatcgatgttcagcagccaatacaggaaacatcaacactcagaaaagctgtactttgtgagagccctgaagatttttcagaggcaacatccggagctgacactgaatcaatatctgaaacaaccgcaaataagaaagacagcaatgattcaaatggtctcactgaagaagaaatgaaacatattgctgaagttctaagaaaagcagaagcatcatctgctgccagtggaatgtttgaaagggattccaatctgcctccacttcgaagaacttccatcacatacacttctcatttctctccgtcagtgattagagatctcagatcttctacttcttttacatcagttccggcagccagtgatgaagaagaaattgttaagggcaaattgaaaagagaaccaagtacacaagttgtttatactgatcatttccttcgagatcttcaatcaataaatgcatatttggaaaaaggagaagatggtacagatgtgacaattgaagaaaccagtcatgataatgaaagttcatcacttccagaagaagatgagcacatcactgatgtatatcattttgatgtgggaacttcacttttggttcaacagtatatactgcaacaatcaacattccaagaagctgctggtcttcatatttctccaattcgtagaacaatgagtgcagcttgcacagcagaaaaacatattgatgatgaagaaaatataaaagaaagagaagttaagcatgcacagagccatgatcaaattaagaaaagagcgggtggcgagccaaatgcttatgaactcctcgagcagcacagcttccgtcatacacaaccccttctctgtaatgtcgatttcctttggcgcctcaatttcgcagcaaacagaatgaccgaggagattgccgatgaggctggcagagaattgcgtgcacactaccggaatgtggctaacccacgagccagatatttctccgacgcttatgatattggtacggacgacgaagaggaagaggtcactgaaacgtcacaagccgggttctctgtggagccaatgcgtcatgaagaacagtcatatggtctgttttcattcttcacatcatctaagagaagtgtcagtgatcgtccacgttccgctttggcaatgttcacgaatccatcaccatcagcttcacctagtctgttgagaaaagaatctgaagatcggggtgacattctcaatttgctcaggagatcctctggtgctgattcaagagcatcgaacgatagttcggcttctcgtttgccagatacagcattggttggactatcagaagcagaaaaacagcacattatgtcagttatgtcacgttccaatagaaatacatcaccaatgacatcgagaagatgttcatcagcattacaaatgctacctgaagtcgataatctgtctgaagctgaaaaagagcatattcaaaccattttggagaaagcagaatcgaaaactccgtttatgatcaaggttccaatgaaaaaacaaatatcatctagaacagaatcaacgaattctcgggtttcaagtgaaggaattgatgaagaagttgaaaatgaagtacaaagaaagaagacaatagaagaaccaattgtggaaattccatcaagagcagttacgcctagaaataatctgagagtgatcccacctccaattgcgatatcacatccaactccaccacattcagcaaaaactgatacaggatccaggcacagtagtggttcatctgcacattctcaattcggattttcaacaccttctatttctggattcaagatattctttgataaagccaagacagctacagagacacttgttaaagagataaaagatgaagttattgtggaagttgataaagataaaactgaaacaaaaccagaaccaaatgtttcaaatgaattgacggctgaagaatttgaacatattagaagaatcaatgaaatggcaggaatcgatgaaccaattcaacctccaccaatagctcaagaaagacgtaaatcaagtgttgtaagtggattgaagaacatgttcggagttggtaaacacgacgaatcagagctcactacggaagagaaggaacatattcgacaaatgtcattaatggcagagaagatggatgaagagattctcgatgaacagtctaaaccaaaatctacatttggactaaagaatttcttcggaaaagctacccagtcggtcatgcatgctacagattctgtgataaagaacgttcaaaatcaatcaaagcaatctcttagtggtctaacccaagaagagctagataacattgcacaggctactgaaagtgctcagcaagaatctaagcaagagctcacacaagatgaaatagatcacattgccagaattaatgctatggcagcggaagactttgaacaacccgcagttaatatgaatcaaggattgtcacaagcagagaaagatcatatcgctcgtattgaggctatggcagcggatgattcacaatctaaaatcattgttcctcctccttcaattatccaaaaagatattgaactttcaatggaagaaatggatcacattgctcgaatagctgcaatggctgacgaggactttacacatcctgttaaaggagctgtcgcgccaatttatgatgaaaattatagtagggacgatggtgcaattgatagattcccagcttcgacagctactccagtgtttgcgcagccgtctgaaattgaactttctgaagaagagcgtgaacatatttccagaatcgctgcaatggctgaagaagattttaatacaccatacgtttcaacacatccaacacagcaaattgaaatagaactaacggaagaagaaaaagaacatattgcaaggatcgaggcgatggcttccgaagatttaaatgcgccatctccctttatccaacaagagcaacgagttgcgacaatgccagtgccaattaattatcatgttgaagaaccaactctatcgcaagaagaaattgatcacattgcaagaataacagctatggctactgaagataacactgatctacaaactctaccaactcctcaagttaaacaaaatgaaccggagctctcccaagaagaaatagatcacattactcgaatagctgcaatggcaaatgaagactttggaatgtatccttcaattgtttctgaacatcctgctccagttgaatctgaacttactcaagaagaacttgatcatatcgctaagatcacaggaatggcatctatggacatcagtactctaccacctccaacaggaaaaccatccgagacatcacttactcaggaagaacttgatcatattgctcgcatagctgaaatggcatcagcagaatatgatgttcctgtaaaaatattcgaaccaccagaactaactcaagaggaacttgatcatatagcaaagattactgcaatggctgcacaagatgtccaacttcctgccacccaaagatcgattactcataaggtttcgttgactccacctcctcctcctccttctaaacactttgagcaagatctcactcaagaagagcttgaccatattgcaagaattgctgagatggctgatatggattataacactccattcactgctgaaccagttcaagatgaagaagaagaaccaataacagaaagtggatcagatgcaacatcaggtgctgatatattcgatgaacaagaagatgcaagttcaggcgccagcggctccttcgataacaacaatgctcaagtgctaacgagcggcttctctccagatcgagttacatctcctgctgcacttgacacaactgaagagccccagggtcctattatggctcagaagactgtgtctccgacgccatcagcagattcgatggcgtcacggaagagtagtgaatacgacattagaagtatatcagagattaggcaagagtccgagtcggatatcggaaagtggtatgaggagcaactcagtttcatgcgacaatcgatccacgatgaggaagaagatgtggggcatgaaattcgaactgacgttgaagagttcccattggagtatgttgaggatcaacttcacttccttgaaggtattgacgtagagagccaacaccatgagcccaccacttcttctgccttctttggcaccggaagatcgattggtgaaggggaaaagagaaaatatggtgacgacgccgtggagcagcaaaaactggagaactacgaagaggaggagaagacgaagagtagtagtcgtgaggcttttgatgatggatttgagacgcagagagaagagtcgttgagggcgcagcagacacccatcgattcactgccgggtagtcgtatgttgaagcgacccaatttcggcttcctttctaatattgcaaatgatgctattaataaggcaaaggaagcgggttcgcaaatccaagccgccgtacccatcaagccatcctcttcatcatcaaatattgtcaacaacaatgtcttctctagcagcaaatcctcaacctccctaggcaccagtgctccaaccaaatctattccctctccacaaatcggtattccgatggatggtctttccgaagaagaacgtcgacaaatcatgtcagttatggctgcagccgactttgacgattctgttaataatgtaaaaccaagcacaagtggttcatcaaatattccagcaggaatggaggatctttcggaagcagaaagagaaaagatcatgtcagttatggcaaatgcagaaatggagatgggcgcacgtttccctcctccttcaagtcaaattccaacaagatctcccagtgttatgagttcaagtataatgtccgaattaccacctggactcgatgatttgtcagatgatgaaagaatgaaaattatggcagttatggcagaagctgatatgcagaatgtgcgaaaacccattgcaagaggcccaccaccaatgccaccaagcacatcaatgatcccaccaggaatggaaggtctatccgaagaagaacgccaaaagatcatgtctgtaatggcaaatgcagagacggattcatcgagtagtgtaataacttcacgtcaacccagtagatcacctagtgtcgctagaatgcaaccacaattgatgccacctcaacaagcaataccaataattccaccaggattagaaggcttatcagacgaagaacgccacacaattatgtcagtaatggcagaagctgaatttgaagaatcaagaagccaagttccatccagacaaccaagtagatcgccgagctttgttaatccacaacaatcattccaccccataccatcatttgaaccaattgtgccaccaggattagaagatttatcagaagaagaacgtcaaaagatcatgtcagtaatgatgaatgcagaagttgaagaatctagaagtcaactaccatcaagacaaccaagtcgttcaccgagtgttgcaatgatacaggcaccagcagttccaatcattccttctggaatggaagatttgccagaagcagaaagacaaaagattatgtcagttatggcagaagcagaaattcagaactttgtacctagtagatcaccgagtaattattcgatgcaaccagttccagtgataccacatggattagaagacttatctgaagctgaacgacagaaaatattgtctgtgatggctgaagctgaaatcgattctgcaaaaattccaagtcgatcaacgagtagttattcgatgccaccaccgttaccacaaatgagccaacctgaaattacaaccggattagaacattcatctgaagctgatatggaatttggaagagattcgagtagatcacatcaagtcatcccacctggattagaaaacttatcagaagaggaaagacaacaaataatgtcagtaatggcacatgcagagttggaaagcatcataccatcaggccatatcgatcagccaatttctcttccacgtggacacactggcttcaaaccagctggaattgtaaatgaagatgaattatttgaaacagaaagaaaacaacgagaagaatcaccgacacgagaatctggatatgccacgtcgacatcttacgaacgagaattggcaatgggtgacgaagagcggatggatggactactcgaagatattatccgaattcgagaaggtgctagatcaagaagagacagtcgtgatgaggttttacacagaagagaagaagatccagaggttcatactccagaagaatcttcgacggcggtagtgacagatgttccatctgtgtcaccagttactgaaaatgttcccgagaaacaaacggacgattttgatttcacgtattctgattcaagatttgcagaaattgtacaaatgcaagaggaagaagaagccggctcacttcaaaagcagaaagttgatgaaaagccacgaatgtgggaaacagtttttgatggcgatgaatcagagttaccccaccaggactttgttttcaacgagcctacaacaaagaaaacgtcagattttgatttccccaaggagacggacgaagtgtttgagaaaccatccgaaattcaaagaattcgggtcactaagaatcatgacgttgatatggatgaaatttacgataacgttattgccactgaagcaccatcttctgtatcacaacgacgacaaccagtagatagtgagacgtctgtgaaatctagaacaattcaaagaggtccaacgaaacctcctccaatgataaaaataactgtcgaagaagaaacaaaatctgatagtgacgaagaaagttgttcagaagacgatgaagaatatcctgatagagttgtcgctgcaccaactgcaccagcaccaacatttgaagaagttgaaaatgaaagaattcgacaagaagagttgggaaaagaagttcttcaacaaattatggcatttggtgaagtggcgaatgatgaattcgatgttcaatgggcaaaaactacaacaagtcagacaccgagtacatcaactaaaccaacagtgactgctccgaaacgaagtgatcctattccaattgcaccatcacaaagatcgaaagaaattgaagaggagagaatccgtacagaagcactggaagaagaggagttctatcggcatgggcacaatccatttttggaatcacctgaagaagatgaagtgtcaattaatatggaagacgttgaatacgctgaaattgctcgtttgtacgaatcagcaaatcaaacaatgcggcgcccaggacctgtttatacaataactgaagatgaatctgaagatgatggtaccttgagcaattcagaaagccgtttggttgctcgagagaaacgtctaatggataagaaaacagctgattctttaatggctaaatatcagaaaatgaagaaagtccaagcaaaacaaacaactacagcttcttcaacatcagtgactgcaacacctgcatacgctataatcaatttctcggatctcaaaacttcaacaagaaccactgattcaaattcatactttgaaacaacaaagaatattcctgcattggaaattaaagatccgaaaaaagatattccacctgaaatctcagcgtcaattgataaaacaatggcagaagtggatgcactacttggacaagtgtacacaaatgaaaaggcaataccaaatttgttgtgttttgatcaaagcaatttctctaatcatccaccaacttcatctgcaagtacatctactgctgatgatctcattctattgaaaaacaacaattcgtcgtctccatcattccttcttccacttcaatcttcagtcctcggtagccaattggattcagttcgcgatgacaacgaaaggaatgaaaatgaaactacttctccaagaggtctaaaacgctcgccaggcatgcttcttccttctccaacatccacaagtatcttcccaatgcctccaactgctgctgaatcggttggagctgcaattggagcaacaacagcttcaatgttcggtggaatcagtgtagctgatcctccaccaacaatggatggattgacaaattcatataaatggcttcagaatattgaggatgatggaaaccttgccaataacgatatgggccgccgaaaacttccatctattccacctaattcgtcggcgttcccaccgccaacatcagtcactacaaatgtcatttcaacggatacgtcaatgccttccacatcatctggtccagctccaacatacgttgatgactataacgtaacactgccttctgatccaattgtagctgaatctttactgaaaggaggatcattgacaagaagacatcaacaccagcaacaacatcaagctcctgtttatataacatcgtctgcaagtcgtccaccatcagcagctggaagtaatatattccaagagagtcgtccaacttcctcgctctcaatgtatcaaaacgatgttattttgtcaaggcctggatcagcagcaagtaattacactactgcttcaactatcaatccaacgatattagctggtgcttcgtattcttcaaaggcatctagtcatatcaggcaaccagtatcagttcgatcaccacgagctcaaactggaacaactcaaaccactgcagcttccggttctgcttcaaattcaattcgaccatcaatcggaagctcgtctgtgacaacacgagttccaaacacattggccagagtcttgttgaaaaaagagctgaaagatgtgctgattcaaagaaaacaacgtttggaagctactgaaattgaagcaaaccaacgacattacaaagttcaaaagatgctgataacaggattactacctgagaaacctgaagatgatattccgaacatcgtcaaatgtgatcttccggcagatttagtacgtggtgtccatatatcaatgcagccaccatctcctgctgtatctgcattttctccgagaaggtatcaccatccaacatcagtagcatcacatcaatcacatccatcaacgttcaagcacatgtccaaaagcattgcttgtcaggcagatgaacttccaccagtcaagccaatgatatcacttcgaactcaattggatatggaaagaagaccacaattaatgacgtatgttggaaaaagaagtgcagagactcaaacagaattggcaaattatgaatcaattacaccaactgttcgatatggttcaattccaagaagtagtcgtgaaagaactgcatctcgtcgatatcgagaacaacaacaacagatttacaatcagatgcctcaaaatcacaatgatttgttggaaatcacgaagaaatacttcgaagattacgatcgtcaacttcgagaattcggtgaacgagcccggcgacattcacgacgaagattcgattttcatgatgatgacgatcaagatgatatgagaaagaatcaagttatgcatgagttggctcgacgaaaagaacgaatgtgtgcaagttgtgaaatactttcaactactgatccaattagaacagctttaaatccaaatgttccaatgtcatcagactacagtagtcatgttccacattacggttctcttccaagaatcgattatcctcgaggtacaagatcagatgttcgagactttacatatcgtcagcaacatcttccacagcaaccaccaacaaattactcctacaattatggctcattaccgagaaactttgaacgaggtttcagtgatcttcctccaattgaaattgaaaacgaacagtcgtttggagcaccgccgcgtcatcgttcaaatctgggatacgagtcaacttccatgtttaatctctcagatccagtctatcttggatatgattcaattccgatggttcaacaccaacaaccaagggtatatgatcaaattccaagtggttatgctcaggacacaactaacctgaacagcttaaatcaaggagtacgtggaagtgatatggttagtcaatatgcaagttatctcaactctcaattccaatctggtcttcaacaatctgctcaacttcctcaaccaatgattccgattacaagatatgatgcaccgatgtccgatccttacgtgtcgagtagatctcgtcttgtggatcagatgaatcaaggttacaactccaatcaatatcatcatcattccacactgctcgcaccaaaatctgctcaaatgactcatattgctccaacctataatcaacttgctcaacaacaaggaataccgatgcaaaacactcaaatggatccattgatgatgtcttcaggtagaattccatcttcttcgtcgcaagtctactcaagaaatgagatgaactacggaagtcgtccagctcagagtagtttattcgaatatggaaatcgccgacagtatggagccgcaccacctccaacatatgatgttccaaatgtatcaagtgcctcggattggagaacaactcaacaacaaggattaatacaacaaatgccgatgcaaatgcaacaacaacaacataatacatttgatgctcgatggccaaaagaagatgctctctcaaggatgtatgcaactgcttcacgaaggcgtgctcaagaaactgctctcacctcgtcaaataaaataagcacaggctcacgtagctatgcacgtcgtccgattcgtccctcctcttaccgtaatccagaagccactaactcaatgccagatcgacacgtggcaaggagaactgctgaaaatagtagatatgatgtgaaaagaattctattgactcgcagttacaagcatcacaatatctacaatgatctcggagtccgagttgttggtggaaaacgacagatgaatggagaactcagtgcgtatgtatctcaattgcatagcaccgcaaataatcagactctgggacaaattaaaattggcgacgaggtcgttgaatggaacggtattctccttcgaggaaagacatttgaagaggtggaacgaattgtgaacaagagtcatggggaaattgaaatggttattcgaacttacaagaatccatcatctggagtgtatgatacacttccattgaaccgtaatactatgagagatgacttgtcacctgatcgtgttccaccagttccaatgcatcgtattaatggaattaataacaatagtgtactccatcatcacactctttccgattcttcatgtcatggccacattcaagtttctcttggttacgatggaaattctcgtcttgtcgccaaaatcattcgagcaagaggattgaaatctcgtgatcaatctcgaagtgctcctaatccatttgttaaagtgtatcttcttcctggaagaaaagtatctcataaacgaagaactcgctttgttgactcctcttgtgctcctgaatggaatcaagtacttgaatatcaagtagctccacatacccttaatacaatgttccttgaatttactgtatgtgattatcaacgagatgttgatgatcttccgttgggaaatgttcaaattccacttgctgataagtctgcaatcaacactggtcctcgatggtacccacttcaaggatcctacgatcaaccgattcctcagcattacatgaatggaacctcgttatctcaaattccatcaatcgccgcagcttccaagcattctgcagccgtacacaaccatcataatcataattattctgaagttcctccatcaattctttatccgaaaggaggtgtcggcacacgtcatccagacaaaccagtccgacatgcaacattcaactataatccagtgtcactggacatcggctaccctgcaataaactga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]