GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-01-24 05:02:00, GGRNA.v2 : RefSeq release 203 (Nov, 2020)

LOCUS       NM_001303850            1275 bp    mRNA    linear   VRT 13-MAY-2020
DEFINITION  Esox lucius claudin-4-like (LOC105029466), mRNA.
ACCESSION   NM_001303850 XM_010902873
VERSION     NM_001303850.1
KEYWORDS    RefSeq.
SOURCE      Esox lucius (northern pike)
  ORGANISM  Esox lucius
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Protacanthopterygii;
            Esociformes; Esocidae; Esox.
REFERENCE   1  (bases 1 to 1275)
  AUTHORS   Leong JS, Jantzen SG, von Schalburg KR, Cooper GA, Messmer AM, Liao
            NY, Munro S, Moore R, Holt RA, Jones SJ, Davidson WS and Koop BF.
  TITLE     Salmo salar and Esox lucius full-length cDNA sequences reveal
            changes in evolutionary pressures on a post-tetraploidization
            genome
  JOURNAL   BMC Genomics 11, 279 (2010)
   PUBMED   20433749
  REMARK    Publication Status: Online-Only
COMMENT     PREDICTED REFSEQ: This record has not been reviewed and the
            function is unknown. The reference sequence was derived from
            BT079217.1.
            On Jan 13, 2015 this sequence version replaced XM_010902873.1.
            
            ##Evidence-Data-START##
            Transcript is intronless :: BT079217.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1275              BT079217.1         6-1280
FEATURES             Location/Qualifiers
     source          1..1275
                     /organism="Esox lucius"
                     /mol_type="mRNA"
                     /db_xref="taxon:8010"
                     /chromosome="1"
                     /map="1"
     gene            1..1275
                     /gene="LOC105029466"
                     /gene_synonym="Claudin-4; CLD4"
                     /note="claudin-4-like"
                     /db_xref="GeneID:105029466"
     exon            1..1275
                     /gene="LOC105029466"
                     /gene_synonym="Claudin-4; CLD4"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    70..72
                     /gene="LOC105029466"
                     /gene_synonym="Claudin-4; CLD4"
                     /note="upstream in-frame stop codon"
     CDS             103..738
                     /gene="LOC105029466"
                     /gene_synonym="Claudin-4; CLD4"
                     /codon_start=1
                     /product="uncharacterized protein LOC105029466"
                     /protein_id="NP_001290779.1"
                     /db_xref="GeneID:105029466"
                     /translation="
MVSMGKQMLGLALALIGFLGTIIVCALPMWKVTAFIGANIVTAQVIWEGVWMNCVTQSTGQMQCKIYDSVLALPQDLQVARAMLVIAIIVAFLGILLCILGGKCTNFIEDEVSKVKVVIASGVIFILAGILILVPVCWTANTIIRDFYNPLLIEAQRRELGASLYIGWATAGLLILGGGLLCSSCPPKQEHDNYPVKYSQAKSTATSQAYV"
     misc_feature    112..615
                     /gene="LOC105029466"
                     /gene_synonym="Claudin-4; CLD4"
                     /note="PMP-22/EMP/MP20/Claudin family; Region:
                     PMP22_Claudin; cl21598"
                     /db_xref="CDD:304458"
ORIGIN      
agtcaacaacgatttaaaccaacctgaactaacctgaggatcttgtctacaaactctgactacacttactaattttgcaacaagacacaagaagtcttcagcatggtgtcgatgggaaaacagatgctgggcctagccctggctctcattgggttcctggggaccatcattgtgtgcgccttgcctatgtggaaagttacagccttcatcggtgccaacatagtaacggctcaggtcatctgggagggtgtgtggatgaactgtgtgacccagagcacgggacaaatgcagtgcaagatttacgactccgtcttggctttaccccaggacctgcaggttgccagagctatgctggtcattgccatcattgtggcatttttgggcattttactgtgcattttgggaggaaagtgtaccaacttcatagaagatgaggtgtcaaaagttaaagtagtcattgccagtggggtcattttcattttggctggcattctcatccttgtcccagtctgctggacagccaacaccatcatcagggacttctacaaccctctgctgatcgaggcccagaggagggagctgggagcatcactgtacattggctgggccaccgcaggtctcctgatcctgggaggagggctcctctgcagctcctgcccacctaagcaagaacatgacaactacccagtcaagtactcacaggcaaagtccacagctaccagccaagcctacgtttgagcttgaaactgactttgaattattaaaagatgatctttgttatgtgaagattatctttggtaatcctctctagatgggaattgaaaagtgactggtattatcaagctctttacattgtgtaactatataaaaacatttcgacatggatataaaatcagaacagagtctgtgaaaatgtatttaatgagcacttatgaactatgcaagaaaaataataacaatacaaataattagtgctactgtgtatagtattttgtatggaaatagccatggagtgatgactgaatggaagccttttccctagtccaaaactctcatttattgtaaaagtacagcgtttattgaagttataatatcaatattcatttaataacatgtactaatgtgagaatgaaactatattctgtataaatgtatcattgacctgtaataaattatttttttttaccattgatcactgtattttgcaatttttgcattttaaatgttgattgcttgttgattgtatgcaatgtgtttaaataaagtccacggtac
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]