GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-27 12:35:18, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_001287796             991 bp    mRNA    linear   INV 17-APR-2022
DEFINITION  Hydra vulgaris homeobox protein Hox-C6a-like (LOC100215022), mRNA.
ACCESSION   NM_001287796 XM_002155415
VERSION     NM_001287796.1
KEYWORDS    RefSeq.
SOURCE      Hydra vulgaris (swiftwater hydra)
  ORGANISM  Hydra vulgaris
            Eukaryota; Metazoa; Cnidaria; Hydrozoa; Hydroidolina;
            Anthoathecata; Aplanulata; Hydridae; Hydra.
REFERENCE   1  (bases 1 to 991)
  AUTHORS   Gauchat D, Mazet F, Berney C, Schummer M, Kreger S, Pawlowski J and
            Galliot B.
  TITLE     Evolution of Antp-class genes and differential expression of Hydra
            Hox/paraHox genes in anterior patterning
  JOURNAL   Proc Natl Acad Sci U S A 97 (9), 4493-4498 (2000)
   PUBMED   10781050
REFERENCE   2  (bases 1 to 991)
  AUTHORS   Shenk MA, Bode HR and Steele RE.
  TITLE     Expression of Cnox-2, a HOM/HOX homeobox gene in hydra, is
            correlated with axial pattern formation
  JOURNAL   Development 117 (2), 657-667 (1993)
   PUBMED   8101168
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from M62870.1.
            
            On Dec 19, 2013 this sequence version replaced XM_002155415.2.
            
            ##Evidence-Data-START##
            Transcript exon combination :: M62870.1, GAOL01020932.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN08648323, SAMN08648421
                                           [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..991
                     /organism="Hydra vulgaris"
                     /mol_type="mRNA"
                     /db_xref="taxon:6087"
                     /chromosome="2"
                     /map="2"
     gene            1..991
                     /gene="LOC100215022"
                     /gene_synonym="Cnox-2"
                     /note="homeobox protein Hox-C6a-like"
                     /db_xref="GeneID:100215022"
     CDS             10..777
                     /gene="LOC100215022"
                     /gene_synonym="Cnox-2"
                     /note="cnox-2 homeoprotein; homeobox Gsx"
                     /codon_start=1
                     /product="homeobox protein Hox-C6a-like"
                     /protein_id="NP_001274725.1"
                     /db_xref="GeneID:100215022"
                     /translation="
MSTSFLIDSLIHEKEKYKIRQQPGTSFLFRESSPPDRSPSYSPGASMIRYSNSSSPRSLDSPINPLDRHPLERVHQVVSCMRGPSMCNCCRPPAVQPMCTVCEPREPGEGTSSQYPYTREPHEHTRGLYGNDRSRLFPILSPLHGQRAQFSPNYVYDLELRHSRQLQLQHQEHETDLYGKSKRIRTAYTSIQLLELEKEFQNNRYLSRLRRIQIAAILDLTEKQVKIWFQNRRVKWKKDKKGYSYSPTGSPQSPE"
     misc_feature    order(553..567,571..573,622..624,640..642,679..681,
                     685..690,697..702,706..714,718..723)
                     /gene="LOC100215022"
                     /gene_synonym="Cnox-2"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(559..561,568..570,688..690,697..702,709..711)
                     /gene="LOC100215022"
                     /gene_synonym="Cnox-2"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    562..723
                     /gene="LOC100215022"
                     /gene_synonym="Cnox-2"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:395001"
ORIGIN      
gaattccgaatgtctacttcgtttttaatagattctctaatacatgaaaaagaaaagtataagatacggcagcagcctggaacatcttttttatttcgtgaatcatctcctccagatcgatcgccgagttattcacccggtgcgtcaatgattagatattccaattcttcttctccaagaagtttagattcacctataaatccattggatcgacaccctcttgaaagagtacatcaagtagttagttgtatgagaggaccttcgatgtgtaattgttgtcggcctccggctgttcaacctatgtgtacagtatgtgaacctagggaaccaggtgaaggtacctcttcacaatatccttatacccgcgaacctcatgagcatacaagaggcttgtatggaaatgatagatcaagactttttccaatattatcacctttacacgggcaaagagcgcagttttccccgaattacgtttacgatttggaacttcgtcattcccgtcaacttcaactgcaacaccaagaacacgaaacagatctttacggaaaatctaaacgcattcgaaccgcgtatactagcattcagttacttgaacttgaaaaagagtttcaaaataatcgttatctttcgagattacggagaatccagatagctgctattctcgatctaacagaaaaacaagttaaaatatggtttcaaaatcgacgtgtaaaatggaaaaaagataagaaaggatatagctattcccctactggaagtccgcaatctccagaataactaccggttttctttctcaaaagttcttctgcatctttcaaaacgaagatatttttttataaaaacaaacgatattaaaatgatttcccatagtcattttataatatgtacataaaaattcatcaataatttattcatcttttacgacatttttttgtttatctttgtatactgaaactttattttcaggtgaagcgtaagttgttccgaattc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]