GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-01-24 04:52:58, GGRNA.v2 : RefSeq release 203 (Nov, 2020)

LOCUS       NM_001287364             636 bp    mRNA    linear   MAM 25-DEC-2015
DEFINITION  Tupaia chinensis claudin 1 (CLDN1), mRNA.
ACCESSION   NM_001287364 XM_006156720
VERSION     NM_001287364.1
KEYWORDS    RefSeq.
SOURCE      Tupaia chinensis (Chinese tree shrew)
  ORGANISM  Tupaia chinensis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Scandentia; Tupaiidae;
            Tupaia.
REFERENCE   1  (bases 1 to 636)
  AUTHORS   Yan H, Zhong G, Xu G, He W, Jing Z, Gao Z, Huang Y, Qi Y, Peng B,
            Wang H, Fu L, Song M, Chen P, Gao W, Ren B, Sun Y, Cai T, Feng X,
            Sui J and Li W.
  TITLE     Sodium taurocholate cotransporting polypeptide is a functional
            receptor for human hepatitis B and D virus
  JOURNAL   Elife 1, E00049 (2012)
   PUBMED   23150796
  REMARK    Erratum:[Elife. 2014;3:e05570]
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 636)
  AUTHORS   Tong Y, Zhu Y, Xia X, Liu Y, Feng Y, Hua X, Chen Z, Ding H, Gao L,
            Wang Y, Feitelson MA, Zhao P and Qi ZT.
  TITLE     Tupaia CD81, SR-BI, claudin-1, and occludin support hepatitis C
            virus infection
  JOURNAL   J. Virol. 85 (6), 2793-2802 (2011)
   PUBMED   21177818
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from EF584564.1.
            On Dec 12, 2013 this sequence version replaced XM_006156720.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: EF584564.1, JU124006.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00794552, SAMN01085955
                                           [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..636
                     /organism="Tupaia chinensis"
                     /mol_type="mRNA"
                     /db_xref="taxon:246437"
     gene            1..636
                     /gene="CLDN1"
                     /gene_synonym="Claudin-1"
                     /note="claudin 1"
                     /db_xref="GeneID:102488870"
     CDS             1..636
                     /gene="CLDN1"
                     /gene_synonym="Claudin-1"
                     /note="claudin-1 antigen"
                     /codon_start=1
                     /product="claudin-1"
                     /protein_id="NP_001274293.1"
                     /db_xref="GeneID:102488870"
                     /translation="
MANAGLQLLGFILAFVGWIGAIVSTALPQWKIYSYAGDNIVTAQAIYEGLWMSCVSQSTGQIQCKVFDSLLNLNSTLQATRALMVVGILLGLIAIFVATIGMKCMKCMEDDEVQKMRMAVFGGMIFLIAGLVILVATAWYSHRIVQEFYDPMTPVNARYEFGQALFTGWAAASLCLLGGALLCCSCPRKTSSYPTPRPYPKPAPSSGKDYV"
     misc_feature    13..519
                     /gene="CLDN1"
                     /gene_synonym="Claudin-1"
                     /note="PMP-22/EMP/MP20/Claudin family; Region:
                     PMP22_Claudin; pfam00822"
                     /db_xref="CDD:250157"
ORIGIN      
atggccaacgcggggctgcagctgttgggctttatcctggccttcgtgggctggatcggcgctatcgtcagcaccgccttgccccagtggaagatctactcctatgccggcgacaacatcgtcacggcccaggccatctacgagggactgtggatgtcctgcgtgtcgcagagcaccgggcagatccagtgcaaagtcttcgactctttgctgaatctgaacagtactttgcaagcaacccgtgctttgatggtagttggcatcttgctgggactcatagcgatctttgtggccacgattggcatgaaatgcatgaagtgcatggaagacgatgaggttcagaagatgcggatggctgtctttgggggcatgatatttctcattgcaggtctggtgattttagtagccactgcatggtatagccacagaatagttcaagagttctatgaccccatgaccccagtcaatgccaggtatgagtttggtcaggctcttttcactggctgggctgctgcttctctgtgccttctgggaggtgccctactttgctgctcttgtccccgaaaaacaagctcttacccaacaccacggccctatccaaaacctgcaccttccagcgggaaagactacgtgtga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]