GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 04:53:23, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NM_001282387            2470 bp    mRNA    linear   PRI 16-FEB-2020
DEFINITION  Homo sapiens isocitrate dehydrogenase (NADP(+)) 1 (IDH1),
            transcript variant 3, mRNA.
ACCESSION   NM_001282387 XM_005246523
VERSION     NM_001282387.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2470)
  AUTHORS   Joo B, Han K, Ahn SS, Choi YS, Chang JH, Kang SG, Kim SH, Zhou J
            and Lee SK.
  TITLE     Amide proton transfer imaging might predict survival and IDH
            mutation status in high-grade glioma
  JOURNAL   Eur Radiol 29 (12), 6643-6652 (2019)
   PUBMED   31175415
  REMARK    GeneRIF: High APT signal was a significant predictor of poor
            prognosis in HGG. APT data showed significant incremental
            prognostic value over clinical prognostic factors and molecular
            markers and may also predict IDH mutation status.
REFERENCE   2  (bases 1 to 2470)
  AUTHORS   Jia ZX, Chao HY, Liu J, Cai XH, Qin W, Wu P and Lu XZ.
  TITLE     [Coexisting Mutations in IDH1/2-Mutated Acute Myeloid Leukemia]
  JOURNAL   Zhongguo Shi Yan Xue Ye Xue Za Zhi 27 (5), 1440-1448 (2019)
   PUBMED   31607296
  REMARK    GeneRIF: More than 95% acute myeloid leukemia patients with IDH1/2
            mutation commonly show additional mutations
REFERENCE   3  (bases 1 to 2470)
  AUTHORS   Zhang Y, Lv W, Li Q, Wang Q, Ru Y, Xiong X, Yan F, Pan T, Lin W and
            Li X.
  TITLE     IDH2 compensates for IDH1 mutation to maintain cell survival under
            hypoxic conditions in IDH1mutant tumor cells
  JOURNAL   Mol Med Rep 20 (2), 1893-1900 (2019)
   PUBMED   31257503
  REMARK    GeneRIF: The present study showed for the first time, to the best
            of our knowledge, that IDH2 plays a compensatory role in
            maintaining reductive carboxylationdependent lipogenesis and
            proliferation in IDH1 R132H tumor cells. Therefore, IDH2 could
            serve as a potential antitumor target for IDH1mutant tumors, which
            may provide a new strategy for treatment.
REFERENCE   4  (bases 1 to 2470)
  AUTHORS   Weenink B, van Brakel M, Wijers R, Sillevis Smitt PAE, French PJ
            and Debets R.
  TITLE     Lack of B and T cell reactivity towards IDH1(R132H) in blood and
            tumor tissue from LGG patients
  JOURNAL   J. Neurooncol. 144 (1), 79-87 (2019)
   PUBMED   31240524
  REMARK    GeneRIF: IDH1(R132H) mutation is associated with loss of B and T
            cell reactivity in gliomas.
REFERENCE   5  (bases 1 to 2470)
  AUTHORS   Kim GH, Choi SY, Oh TI, Kan SY, Kang H, Lee S, Oh T, Ko HM and Lim
            JH.
  TITLE     IDH1(R132H) Causes Resistance to HDAC Inhibitors by Increasing
            NANOG in Glioblastoma Cells
  JOURNAL   Int J Mol Sci 20 (11), E2679 (2019)
   PUBMED   31151327
  REMARK    GeneRIF: IDH1(R132H) and its synthetic oncometabolite, R-2HG,
            significantly increase NANOG expression by activating its proximal
            promoter region, resulting in increased histone deacetylase
            inhibitors resistance in Glioblastoma Cells.
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 2470)
  AUTHORS   Nekrutenko A, Hillis DM, Patton JC, Bradley RD and Baker RJ.
  TITLE     Cytosolic isocitrate dehydrogenase in humans, mice, and voles and
            phylogenetic analysis of the enzyme family
  JOURNAL   Mol. Biol. Evol. 15 (12), 1674-1684 (1998)
   PUBMED   9866202
REFERENCE   7  (bases 1 to 2470)
  AUTHORS   Belfiore F and Iannello S.
  TITLE     Fatty acid synthesis from glutamate in the adipose tissue of normal
            subjects and obese patients: an enzyme study
  JOURNAL   Biochem. Mol. Med. 54 (1), 19-25 (1995)
   PUBMED   7551812
REFERENCE   8  (bases 1 to 2470)
  AUTHORS   Narahara,K., Kimura,S., Kikkawa,K., Takahashi,Y., Wakita,Y.,
            Kasai,R., Nagai,S., Nishibayashi,Y. and Kimoto,H.
  TITLE     Probable assignment of soluble isocitrate dehydrogenase (IDH1) to
            2q33.3
  JOURNAL   Hum. Genet. 71 (1), 37-40 (1985)
   PUBMED   3861566
REFERENCE   9  (bases 1 to 2470)
  AUTHORS   Creagan,R.P., Carritt,B., Chen,S., Kucherlapati,R., McMorris,F.A.,
            Ricciuti,F., Tan,Y.H., Tischfield,J.A. and Ruddle,F.H.
  TITLE     Chromosome assignments of genes in man using mouse-human somatic
            cell hybrids: Cytoplasmic isocitrate dehydrogenase (IDH 1) and
            malate dehydrogenase (MDH 1) to chromosomes 2
  JOURNAL   Am. J. Hum. Genet. 26 (5), 604-613 (1974)
   PUBMED   4422176
REFERENCE   10 (bases 1 to 2470)
  AUTHORS   Henderson,N.S.
  TITLE     Intracellular location and genetic control of isozymes of
            NADP-dependent isocitrate dehydrogenase and malate dehydrogenase
  JOURNAL   Ann. N. Y. Acad. Sci. 151 (1), 429-440 (1968)
   PUBMED   4388365
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DR158630.1, BC012846.1 and
            N21575.1.
            This sequence is a reference standard in the RefSeqGene project.
            On Sep 5, 2013 this sequence version replaced XM_005246523.1.
            
            Summary: Isocitrate dehydrogenases catalyze the oxidative
            decarboxylation of isocitrate to 2-oxoglutarate. These enzymes
            belong to two distinct subclasses, one of which utilizes NAD(+) as
            the electron acceptor and the other NADP(+). Five isocitrate
            dehydrogenases have been reported: three NAD(+)-dependent
            isocitrate dehydrogenases, which localize to the mitochondrial
            matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of
            which is mitochondrial and the other predominantly cytosolic. Each
            NADP(+)-dependent isozyme is a homodimer. The protein encoded by
            this gene is the NADP(+)-dependent isocitrate dehydrogenase found
            in the cytoplasm and peroxisomes. It contains the PTS-1 peroxisomal
            targeting signal sequence. The presence of this enzyme in
            peroxisomes suggests roles in the regeneration of NADPH for
            intraperoxisomal reductions, such as the conversion of 2,
            4-dienoyl-CoAs to 3-enoyl-CoAs, as well as in peroxisomal reactions
            that consume 2-oxoglutarate, namely the alpha-hydroxylation of
            phytanic acid. The cytoplasmic enzyme serves a significant role in
            cytoplasmic NADPH production. Alternatively spliced transcript
            variants encoding the same protein have been found for this gene.
            [provided by RefSeq, Sep 2013].
            
            Transcript Variant: This variant (3) has an alternate 5' UTR exon,
            compared to variant 1. Variants 1, 2 and 3 encode the same protein.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR1803612.36649.1, BC012846.1
                                           [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMEA1965299, SAMEA1966682
                                           [ECO:0000350]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-117               DR158630.1         1-117
            118-2422            BC012846.1         1-2305
            2423-2470           N21575.1           1-48                c
FEATURES             Location/Qualifiers
     source          1..2470
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="2"
                     /map="2q34"
     gene            1..2470
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /note="isocitrate dehydrogenase (NADP(+)) 1"
                     /db_xref="GeneID:3417"
                     /db_xref="HGNC:HGNC:5382"
                     /db_xref="MIM:147700"
     exon            1..273
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /inference="alignment:Splign:2.1.0"
     variation       5
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1223643814"
     variation       6
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:35585619"
     variation       13..26
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="ga"
                     /replace="gaaggaggtaccga"
                     /db_xref="dbSNP:1291172827"
     variation       13
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1014210110"
     variation       16..17
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1323745577"
     variation       18
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1223252186"
     variation       21
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:965950143"
     variation       28
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1489891942"
     variation       33
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189891775"
     variation       47
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1234591108"
     variation       49
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1289038229"
     variation       52
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1035270550"
     variation       57
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1052951709"
     variation       62
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:999719290"
     variation       67
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1163868546"
     variation       70
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:902670400"
     variation       73
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1310382350"
     variation       75
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538360925"
     variation       85
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1011427456"
     variation       93
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:563367302"
     variation       95
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:932743996"
     variation       101
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1049726465"
     variation       103
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1291380841"
     variation       105
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543687633"
     variation       108
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538695310"
     variation       116
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:79062167"
     variation       121
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1274949158"
     variation       128
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:976701505"
     variation       130
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1187287201"
     variation       131
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1230928912"
     variation       132
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1488260834"
     variation       133
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:923229590"
     variation       139
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1245392228"
     variation       145
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1446269942"
     variation       158
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:961624276"
     variation       160
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1384294551"
     variation       163
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1442167645"
     variation       170
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1169155266"
     variation       171
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1215925318"
     variation       179
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547002679"
     variation       191
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771102147"
     variation       195
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1409927401"
     variation       196
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:908771380"
     variation       217
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1336194571"
     variation       219
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1361238667"
     variation       220
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1453912680"
     variation       221
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1040248886"
     variation       222
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1314628575"
     variation       236
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1380867115"
     variation       238
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1230631558"
     variation       243..245
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:149743342"
     variation       243
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:940557209"
     variation       250
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:879171854"
     variation       259
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1308707464"
     exon            274..347
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /inference="alignment:Splign:2.1.0"
     variation       275
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1441282168"
     variation       276
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:916297399"
     variation       282
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:144856461"
     variation       283
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1053403461"
     variation       300
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1460552941"
     variation       308
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1268275515"
     variation       310
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:77588323"
     variation       313
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:960345380"
     variation       315
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1000115308"
     variation       323
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1432878298"
     variation       324
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1321205127"
     misc_feature    325..327
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /note="upstream in-frame stop codon"
     variation       325
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:530522219"
     variation       335
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1035301766"
     variation       338
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978355689"
     variation       339
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1190406936"
     variation       340
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1049567341"
     variation       343
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1481064898"
     variation       347
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:932751143"
     exon            348..485
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /inference="alignment:Splign:2.1.0"
     variation       348
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1161624965"
     variation       352
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:756393190"
     variation       354
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1055979464"
     variation       357
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:750612823"
     CDS             364..1608
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /EC_number="1.1.1.42"
                     /note="oxalosuccinate decarboxylase; NADP-dependent
                     isocitrate dehydrogenase, cytosolic; NADP-dependent
                     isocitrate dehydrogenase, peroxisomal; epididymis
                     secretory protein Li 26; epididymis luminal protein 216;
                     isocitrate dehydrogenase (NADP(+)) 1, cytosolic;
                     NADP(+)-specific ICDH; isocitrate dehydrogenase 1 (NADP+),
                     soluble; epididymis secretory sperm binding protein"
                     /codon_start=1
                     /product="isocitrate dehydrogenase [NADP] cytoplasmic"
                     /protein_id="NP_001269316.1"
                     /db_xref="CCDS:CCDS2381.1"
                     /db_xref="GeneID:3417"
                     /db_xref="HGNC:HGNC:5382"
                     /db_xref="MIM:147700"
                     /translation="
MSKKISGGSVVEMQGDEMTRIIWELIKEKLIFPYVELDLHSYDLGIENRDATNDQVTKDAAEAIKKHNVGVKCATITPDEKRVEEFKLKQMWKSPNGTIRNILGGTVFREAIICKNIPRLVSGWVKPIIIGRHAYGDQYRATDFVVPGPGKVEITYTPSDGTQKVTYLVHNFEEGGGVAMGMYNQDKSIEDFAHSSFQMALSKGWPLYLSTKNTILKKYDGRFKDIFQEIYDKQYKSQFEAQKIWYEHRLIDDMVAQAMKSEGGFIWACKNYDGDVQSDSVAQGYGSLGMMTSVLVCPDGKTVEAEAAHGTVTRHYRMYQKGQETSTNPIASIFAWTRGLAHRAKLDNNKELAFFANALEEVSIETIEAGFMTKDLAACIKGLPNVQRSDYLNTFEFMDKLGENLKIKLAQAKL"
     misc_feature    364..1596
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /note="isocitrate dehydrogenase; Provisional; Region:
                     PTZ00435"
                     /db_xref="CDD:240417"
     misc_feature    367..369
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N-acetylserine. {ECO:0000244|PubMed:22814378};
                     propagated from UniProtKB/Swiss-Prot (O75874.2);
                     acetylation site"
     misc_feature    487..489
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphotyrosine. {ECO:0000244|PubMed:24275569};
                     propagated from UniProtKB/Swiss-Prot (O75874.2);
                     phosphorylation site"
     misc_feature    604..606
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-acetyllysine. {ECO:0000250|UniProtKB:O88844};
                     propagated from UniProtKB/Swiss-Prot (O75874.2);
                     acetylation site"
     misc_feature    643..663
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O75874.2);
                     Region: Substrate binding. {ECO:0000244|PDB:1T0L,
                     ECO:0000269|PubMed:15173171}"
     misc_feature    739..741
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-succinyllysine. {ECO:0000250|UniProtKB:O88844};
                     propagated from UniProtKB/Swiss-Prot (O75874.2); modified
                     site"
     misc_feature    778..780
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Critical for catalysis; propagated from
                     UniProtKB/Swiss-Prot (O75874.2); other site"
     misc_feature    997..999
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Critical for catalysis; propagated from
                     UniProtKB/Swiss-Prot (O75874.2); other site"
     misc_feature    1033..1035
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-acetyllysine. {ECO:0000250|UniProtKB:O88844};
                     propagated from UniProtKB/Swiss-Prot (O75874.2);
                     acetylation site"
     misc_feature    1060..1062
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-acetyllysine. {ECO:0000250|UniProtKB:O88844};
                     propagated from UniProtKB/Swiss-Prot (O75874.2);
                     acetylation site"
     misc_feature    1090..1092
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-acetyllysine. {ECO:0000250|UniProtKB:O88844};
                     propagated from UniProtKB/Swiss-Prot (O75874.2);
                     acetylation site"
     misc_feature    1324..1326
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-acetyllysine. {ECO:0000244|PubMed:19608861};
                     propagated from UniProtKB/Swiss-Prot (O75874.2);
                     acetylation site"
     misc_feature    1528..1530
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine. {ECO:0000250|UniProtKB:O88844};
                     propagated from UniProtKB/Swiss-Prot (O75874.2);
                     phosphorylation site"
     misc_feature    1561..1563
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-succinyllysine. {ECO:0000250|UniProtKB:O88844};
                     propagated from UniProtKB/Swiss-Prot (O75874.2); modified
                     site"
     variation       365
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767633282"
     variation       366
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761830115"
     variation       367
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751591193"
     variation       370..376
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="aaaa"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:754375602"
     variation       373
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:764523200"
     variation       375
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1456490934"
     variation       378
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763504710"
     variation       379
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141118556"
     variation       381
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1001692730"
     variation       384
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756262551"
     variation       385
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369048275"
     variation       387
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759315203"
     variation       397
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1248893111"
     variation       401
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1045831045"
     variation       402
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:946096480"
     variation       404
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1231034122"
     variation       406..434
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="gga"
                     /replace="ggagatgaaatgacacgaatcatttggga"
                     /db_xref="dbSNP:1395903055"
     variation       407
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776449775"
     variation       408
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1297452511"
     variation       409
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:192514135"
     variation       411
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1336705159"
     variation       418
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:11554138"
     variation       420
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1321669350"
     variation       421
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:912110895"
     variation       422
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201258988"
     variation       427
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170747681"
     variation       432
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:535551892"
     variation       433
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:866116784"
     variation       442
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1173024019"
     variation       451
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1478965604"
     variation       453
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1431581254"
     variation       454
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244968146"
     variation       457
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142923780"
     variation       460
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:555882127"
     variation       464
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253479303"
     variation       465
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753580953"
     variation       466
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781398075"
     variation       467
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757444051"
     variation       472
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751649071"
     variation       475
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374907791"
     variation       477
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1212548122"
     variation       484
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1273619819"
     exon            486..777
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /inference="alignment:Splign:2.1.0"
     variation       488
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747226100"
     variation       491
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777761062"
     variation       495
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1357237390"
     variation       504
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1553603130"
     variation       505
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1172899722"
     variation       508
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758524291"
     variation       509
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765848107"
     variation       514..529
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="gccaccaacgaccaag"
                     /db_xref="dbSNP:1183258938"
     variation       515
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1390836979"
     variation       516
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1214051569"
     variation       522
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200305649"
     variation       523
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754316078"
     variation       527
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1414016845"
     variation       529
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1235684362"
     variation       541
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1274559877"
     variation       544
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1473943942"
     variation       547
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144593536"
     variation       548
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:760287259"
     variation       560
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111834611"
     variation       563
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1465733605"
     variation       564
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1270625981"
     variation       565
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772900658"
     variation       571
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1206867982"
     variation       573
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1316446586"
     variation       574
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:73070954"
     variation       576
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372625136"
     variation       582
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1254990610"
     variation       589
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1376614580"
     variation       590
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761344510"
     variation       596
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1005225555"
     variation       597
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773792199"
     variation       600
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1245911068"
     variation       602
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201790850"
     variation       606
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368642313"
     variation       608
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775186249"
     variation       609
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:575483212"
     variation       610
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:565065820"
     variation       615
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1349971974"
     variation       617
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778083499"
     variation       618
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1412197312"
     variation       621
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1403237068"
     variation       624
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1412694034"
     variation       625
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1215616500"
     variation       627
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758622511"
     variation       631
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1450522576"
     variation       634
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1250401568"
     variation       635
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1187254009"
     variation       636
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:887664727"
     variation       637
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1048933669"
     variation       640
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748255418"
     variation       644
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1323545008"
     variation       645
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779126307"
     variation       649
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:755612585"
     variation       656
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1228832554"
     variation       657
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147684527"
     variation       660
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142883642"
     variation       661
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777129475"
     variation       664
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:762588599"
     variation       668
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1226814453"
     variation       672
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554273142"
     variation       675
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761440376"
     variation       677
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1210349032"
     variation       678
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11554137"
     variation       680
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1168869530"
     variation       681
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763562621"
     variation       682
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375658806"
     variation       685
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1167187408"
     variation       687
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199905024"
     variation       689
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1428437794"
     variation       691
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775517144"
     variation       694
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769575550"
     variation       697
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148542200"
     variation       701
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772485166"
     variation       704
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1179650996"
     variation       712
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748380012"
     variation       715
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371567806"
     variation       716
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1458009455"
     variation       717
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768836031"
     variation       718
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747419787"
     variation       719
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780642190"
     variation       721
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1412157898"
     variation       728
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756511163"
     variation       729
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142572024"
     variation       729
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1559362299"
     variation       730
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781531255"
     variation       736
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756942230"
     variation       737
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1344345261"
     variation       742
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:751189315"
     variation       744
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1411285888"
     variation       746
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1408229360"
     variation       747..757
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace=""
                     /replace="catcataggtc"
                     /db_xref="dbSNP:753058442"
     variation       747
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763685036"
     variation       750
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1341118194"
     variation       751
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762479277"
     variation       752
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1461843626"
     variation       756
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1360222257"
     variation       757
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:121913499"
     variation       758
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:121913500"
     variation       768
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752078425"
     variation       771
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1347854729"
     variation       772
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765230533"
     variation       775
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1197487126"
     exon            778..883
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /inference="alignment:Splign:2.1.0"
     variation       779..781
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="aca"
                     /replace="acaca"
                     /db_xref="dbSNP:1309773432"
     variation       781
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1341959637"
     variation       782
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866070733"
     variation       788
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1315254690"
     variation       798
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200875728"
     variation       802
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766372640"
     variation       807
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760579117"
     variation       808
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:773076468"
     variation       809
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764425733"
     variation       811
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1382900335"
     variation       813..816
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:776463533"
     variation       818
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1458601350"
     variation       819
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145324788"
     variation       820
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765488909"
     variation       824
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1324286770"
     variation       828
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1246222821"
     variation       831
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775678660"
     variation       835
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769739538"
     variation       837
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1190464303"
     variation       839
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1290536550"
     variation       841
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:912400006"
     variation       843
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368904931"
     variation       844
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148190775"
     variation       847
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1357997760"
     variation       856
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197355900"
     variation       860
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771358905"
     variation       864
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747384833"
     variation       871
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1445574837"
     variation       872
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:930048865"
     variation       883
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:908547141"
     exon            884..1061
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /inference="alignment:Splign:2.1.0"
     variation       885
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:773611901"
     variation       886..895
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="ggtggtg"
                     /replace="ggtggtggtg"
                     /db_xref="dbSNP:1313507537"
     variation       887
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772304188"
     variation       888
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748499158"
     variation       893
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149205273"
     variation       895
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34218846"
     variation       900
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748821411"
     variation       901
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374474539"
     variation       905
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750362869"
     variation       906
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201547733"
     variation       909
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781132701"
     variation       910
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757031960"
     variation       911
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34599179"
     variation       920
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1319931352"
     variation       921
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781365220"
     variation       926
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:951645776"
     variation       927
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1307910651"
     variation       928
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:62193615"
     variation       929..930
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:778615377"
     variation       930
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1237412838"
     variation       931
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1553602798"
     variation       940
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439688831"
     variation       943
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753981193"
     variation       947
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1212370067"
     variation       950..951
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:756798008"
     variation       956
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374340555"
     variation       958
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1422685682"
     variation       961
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370342586"
     variation       962..965
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="ct"
                     /replace="ctct"
                     /db_xref="dbSNP:1559360463"
     variation       963..969
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="tct"
                     /replace="tctgtct"
                     /db_xref="dbSNP:1170377110"
     variation       964
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1406219039"
     variation       966
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773617210"
     variation       967
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772594297"
     variation       971
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762089749"
     variation       974
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774721532"
     variation       983
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768250871"
     variation       985
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:587778402"
     variation       986
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186787509"
     variation       990
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:182693596"
     variation       1004
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745329811"
     variation       1011
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377538429"
     variation       1013
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1203067725"
     variation       1018
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1329954955"
     variation       1019
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1010898370"
     variation       1022
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142801125"
     variation       1026
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1376728272"
     variation       1027
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751364381"
     variation       1028
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:587778401"
     variation       1049
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1454421100"
     variation       1053
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1212008456"
     variation       1054
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755237893"
     variation       1055
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1336036996"
     variation       1057
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1435132546"
     variation       1060
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:754042652"
     variation       1061
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1156412643"
     exon            1062..1213
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /inference="alignment:Splign:2.1.0"
     variation       1062
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:922495564"
     variation       1064
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1559359835"
     variation       1066
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1324084517"
     variation       1067
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1245106255"
     variation       1069
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746931121"
     variation       1071
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150747919"
     variation       1072
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1467289783"
     variation       1074
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758215808"
     variation       1077
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747900297"
     variation       1080
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1225024415"
     variation       1081
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175568871"
     variation       1089
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377075054"
     variation       1090
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1005721363"
     variation       1091
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1165352490"
     variation       1094
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756272474"
     variation       1099
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373048968"
     variation       1101
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1309166180"
     variation       1102
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1293383694"
     variation       1103
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:969824858"
     variation       1110
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1459710990"
     variation       1113
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767630531"
     variation       1116
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139287550"
     variation       1117
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752130008"
     variation       1119
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764654685"
     variation       1120
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201394139"
     variation       1129
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775936968"
     variation       1130
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765037248"
     variation       1132
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:906253224"
     variation       1134
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1046055605"
     variation       1143
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1427936380"
     variation       1151
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759217866"
     variation       1153
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1031894546"
     variation       1154
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776041038"
     variation       1159
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199793362"
     variation       1161
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1309988275"
     variation       1162
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:999038001"
     variation       1171
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1559359775"
     variation       1181
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369039979"
     variation       1183
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773167891"
     variation       1184..1191
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="gtg"
                     /replace="gtgacgtg"
                     /db_xref="dbSNP:1203737070"
     variation       1188
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374900600"
     variation       1189
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747951792"
     variation       1195
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201822210"
     variation       1196
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756395116"
     variation       1197
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369424896"
     variation       1198
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781222279"
     variation       1199
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200372440"
     variation       1202
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757389021"
     variation       1203..1206
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="tg"
                     /replace="tgtg"
                     /db_xref="dbSNP:1376003740"
     variation       1206
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751525590"
     exon            1214..1354
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /inference="alignment:Splign:2.1.0"
     variation       1214
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1386075261"
     variation       1215
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755404974"
     variation       1218
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:754088842"
     variation       1221..1227
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="ctctc"
                     /replace="ctctctc"
                     /db_xref="dbSNP:1559359182"
     variation       1229
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1442458731"
     variation       1230
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1158077492"
     variation       1231
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1032066742"
     variation       1235
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141630472"
     variation       1238
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:62193614"
     variation       1239
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750002102"
     variation       1241
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1460436510"
     variation       1242
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1248089921"
     variation       1243
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766985383"
     variation       1246
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370928521"
     variation       1248
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1259830625"
     variation       1256
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201477228"
     variation       1257
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188499120"
     variation       1260
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1360629446"
     variation       1262
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762820641"
     variation       1266
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775133036"
     variation       1267
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1050004267"
     variation       1268
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1222364475"
     variation       1272
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771247780"
     variation       1274
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:567401796"
     variation       1275
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747198657"
     variation       1276
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384045653"
     variation       1279
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1383003569"
     variation       1280
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:138458978"
     variation       1286
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1424987452"
     variation       1287
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1386874132"
     variation       1289
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1161502711"
     variation       1290
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772297042"
     variation       1291
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773327968"
     variation       1297
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1472789241"
     variation       1302
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:267599174"
     variation       1303
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1040177874"
     variation       1304
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779481497"
     variation       1306
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755385980"
     variation       1309
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:767852664"
     variation       1312
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754290687"
     variation       1313
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1294399146"
     variation       1315
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1323843602"
     variation       1316
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377475055"
     variation       1321
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202210066"
     variation       1322
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199915613"
     variation       1324
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1359322778"
     variation       1326
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1271309574"
     variation       1327
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113732076"
     variation       1336
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:940962759"
     variation       1337
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1229651962"
     variation       1338
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148160119"
     variation       1339
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185564694"
     variation       1343
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767109945"
     variation       1346
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1367760888"
     variation       1347
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1301027101"
     variation       1352
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1423819877"
     variation       1353
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761315922"
     exon            1355..1517
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /inference="alignment:Splign:2.1.0"
     variation       1361..1365
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="tttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:1559358832"
     variation       1361
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1175270965"
     variation       1366
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763478345"
     variation       1368
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758405875"
     variation       1370..1380
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="gg"
                     /replace="ggaccagaggg"
                     /db_xref="dbSNP:1238151281"
     variation       1374
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1233802277"
     variation       1377
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:752595957"
     variation       1378
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1436545190"
     variation       1384
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1204326719"
     variation       1385
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765179388"
     variation       1386
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1457470932"
     variation       1398
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1261418985"
     variation       1400
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759413310"
     variation       1405
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1559358811"
     variation       1407
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200718328"
     variation       1414
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1351761015"
     variation       1415
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776513405"
     variation       1421
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762126667"
     variation       1422
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1335049297"
     variation       1423
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:536880332"
     variation       1430
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768596300"
     variation       1435
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:766547920"
     variation       1437
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1335568356"
     variation       1438
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762867621"
     variation       1439
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:775893896"
     variation       1444
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1160632942"
     variation       1450
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770226824"
     variation       1453
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372711897"
     variation       1457
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:781533021"
     variation       1458
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756940135"
     variation       1461
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746615557"
     variation       1462
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777431979"
     variation       1463
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200591678"
     variation       1469
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752187592"
     variation       1472
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1221821161"
     variation       1478
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765282142"
     variation       1481
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754957038"
     variation       1482
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369234651"
     variation       1483
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201267625"
     variation       1488
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1380577068"
     variation       1492
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775128585"
     variation       1496
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766246232"
     variation       1497
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1559358745"
     variation       1501
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1274565022"
     variation       1502..1512
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="tta"
                     /replace="ttaaaggttta"
                     /db_xref="dbSNP:1399247565"
     variation       1504..1506
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:763043045"
     variation       1504
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:762143982"
     variation       1509..1518
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="tttacccaat"
                     /replace="tttacccaatttacccaat"
                     /db_xref="dbSNP:771971686"
     variation       1512
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141895800"
     variation       1514
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764338499"
     variation       1515
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762954264"
     variation       1516
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775623666"
     variation       1517
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373781889"
     exon            1518..2460
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /inference="alignment:Splign:2.1.0"
     variation       1518
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760963029"
     variation       1525
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1168592559"
     variation       1526
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:566072712"
     variation       1528
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1559357963"
     variation       1539
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1430194405"
     variation       1540
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:949202811"
     variation       1545
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771692756"
     variation       1557
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479298087"
     variation       1558
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747809723"
     variation       1559
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778615461"
     variation       1565
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768304856"
     variation       1568
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1231130403"
     variation       1576
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1197417192"
     variation       1585
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1323632637"
     variation       1604..1606
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:759303223"
     variation       1606
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277209814"
     variation       1607
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1189105025"
     variation       1608
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3778"
     variation       1612
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1409461747"
     variation       1614
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748768472"
     variation       1621
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780146398"
     variation       1622
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114939378"
     variation       1623
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:750251172"
     variation       1627
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1376103125"
     variation       1629
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1379047285"
     variation       1633
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781009655"
     variation       1648
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1446040635"
     variation       1653
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1406936770"
     variation       1654
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:758597026"
     variation       1658
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200122564"
     variation       1659
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1386760235"
     variation       1660
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1434503912"
     variation       1666
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:898541295"
     variation       1678
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768957576"
     variation       1683
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1300173494"
     variation       1685
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:924919814"
     variation       1686..1687
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:532947500"
     variation       1705
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1017014356"
     variation       1708
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1308414229"
     variation       1715
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:185188955"
     variation       1724
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112722672"
     variation       1734..1736
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="t"
                     /replace="tat"
                     /db_xref="dbSNP:1180186593"
     variation       1739..1751
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="ttt"
                     /replace="tttctataagttt"
                     /db_xref="dbSNP:1292147907"
     variation       1742
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:942920825"
     variation       1744
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749424817"
     variation       1759
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277701462"
     variation       1762
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78539882"
     variation       1763
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:939574523"
     variation       1767
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:533578934"
     variation       1773
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1234322511"
     variation       1797
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:987355895"
     variation       1804
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1177522453"
     variation       1805
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235856154"
     variation       1808..1813
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="ttttt"
                     /replace="tttttt"
                     /db_xref="dbSNP:1446935199"
     variation       1810
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:879006105"
     variation       1812
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1296938567"
     variation       1819..1832
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="ttttatttt"
                     /replace="ttttattttatttt"
                     /db_xref="dbSNP:781093485"
     variation       1824
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256526151"
     variation       1828
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1164782718"
     variation       1834
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:951524177"
     variation       1837
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1404015847"
     variation       1841
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:945823245"
     variation       1848
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1355384591"
     variation       1851
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1463092791"
     variation       1853
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:914339913"
     variation       1854
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1026161482"
     variation       1855
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1385091809"
     variation       1859
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1454454950"
     variation       1865
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1315717170"
     variation       1872
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1307155310"
     variation       1877
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:974161372"
     variation       1886
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:962689565"
     variation       1890
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:989880854"
     variation       1902
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:564140008"
     variation       1903
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369898908"
     variation       1911
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1255533341"
     variation       1921
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1413136844"
     variation       1922
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1002112016"
     variation       1932..1934
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1237450581"
     variation       1932
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1404716364"
     variation       1944
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1044416"
     variation       1950
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188602327"
     variation       1953
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1024835650"
     variation       1954
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1419613218"
     variation       1956
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1168811614"
     variation       1968
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1013825698"
     variation       1970
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:892271979"
     variation       1971
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1470382932"
     variation       1982
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1334707712"
     variation       1990
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358557269"
     variation       1993..1994
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1445768213"
     variation       1997
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1052633407"
     variation       1998
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1340906424"
     variation       2001
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1217615777"
     variation       2002
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:561722525"
     variation       2003
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1325029408"
     variation       2008
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:903554070"
     variation       2012
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:955432039"
     variation       2014
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1277325909"
     variation       2020
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1441148950"
     variation       2026
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1025485119"
     variation       2029
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1477732592"
     variation       2032
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746228832"
     variation       2044
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1431772417"
     variation       2045
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1480793268"
     variation       2047
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:942953302"
     variation       2048
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:912805443"
     variation       2057
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1051324031"
     variation       2060
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1412623561"
     variation       2070
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:930154253"
     variation       2073
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1443929447"
     variation       2078
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1256585503"
     variation       2084
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1016996054"
     variation       2090
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346948232"
     variation       2094
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:918722617"
     variation       2096
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1273659998"
     variation       2100
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:6730955"
     variation       2104
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1288028081"
     variation       2113
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:962761862"
     variation       2117
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1034960549"
     variation       2150
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868063665"
     variation       2154
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1488150838"
     variation       2158
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1242438333"
     variation       2161
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:902730824"
     variation       2166
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1271525828"
     variation       2178
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1490564315"
     variation       2180
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1351421540"
     variation       2183
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198433245"
     variation       2184
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1245001122"
     variation       2187
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1471225034"
     variation       2189
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1160224940"
     variation       2190
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150906753"
     variation       2204..2205
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:946898642"
     variation       2205
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1419037302"
     variation       2208
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:575807296"
     variation       2209
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:180928167"
     variation       2212
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1399972153"
     variation       2213
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1328815216"
     variation       2218
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1359219186"
     variation       2220
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:557950423"
     variation       2228
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1310611958"
     variation       2229
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1054220798"
     variation       2236
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1025326669"
     variation       2247..2251
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="tct"
                     /replace="tctct"
                     /db_xref="dbSNP:1357519142"
     variation       2248
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:16841606"
     variation       2254
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1209438285"
     variation       2268
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:910894698"
     variation       2270
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1439622948"
     variation       2278
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1400793687"
     variation       2279
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1182547762"
     variation       2280
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:747993945"
     variation       2281
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:15343"
     variation       2284
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:576632204"
     variation       2287
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1412355048"
     variation       2292
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1050717334"
     variation       2296
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:956750465"
     variation       2312
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:557788219"
     variation       2315
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:15344"
     variation       2322
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:933665801"
     variation       2326
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1161161024"
     variation       2328
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1458256907"
     variation       2335
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1030824528"
     variation       2337
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1388204062"
     variation       2346
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:369225330"
     variation       2352
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1000654976"
     variation       2355..2361
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="ttt"
                     /replace="tttattt"
                     /db_xref="dbSNP:1368879878"
     variation       2358
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:903585214"
     variation       2359
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1331347182"
     variation       2375
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1039416637"
     variation       2376
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1445144908"
     variation       2379..2381
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1174922504"
     variation       2384
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1006574647"
     variation       2390
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1265266964"
     variation       2398..2400
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="aaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1341446269"
     variation       2408..2409
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1244596033"
     variation       2410
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1264068340"
     regulatory      2435..2440
                     /regulatory_class="polyA_signal_sequence"
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
     variation       2445
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:972655973"
     variation       2446
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1199543499"
     variation       2448
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:890772668"
     variation       2456
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:909688227"
     variation       2458
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1051784850"
     polyA_site      2460
                     /gene="IDH1"
                     /gene_synonym="HEL-216; HEL-S-26; IDCD; IDH; IDP; IDPC;
                     PICD"
ORIGIN      
cgtggagacctggaaggaggtaccgatccagccttgattgcagccctcttgcacaacggccataaggacgggtgcaggccaagagcaaggacatgcaaaccccaagacctgctaacgggcggcgaagcgggggcacgccctcgcacacgcagagataaattgtgctcccatgacctttatttggaaagtgcctgcgggcctaaaattggcctttgtcccaccgagtacactcagcactgtactttaaaccggataaactgggctgtctggcaggcgataaactacattcagttgagtctgcaagactgggaggaactggggtgataagaaatctattcactgtcaaggtttattgaagtcaaaatgtccaaaaaaatcagtggcggttctgtggtagagatgcaaggagatgaaatgacacgaatcatttgggaattgattaaagagaaactcatttttccctacgtggaattggatctacatagctatgatttaggcatagagaatcgtgatgccaccaacgaccaagtcaccaaggatgctgcagaagctataaagaagcataatgttggcgtcaaatgtgccactatcactcctgatgagaagagggttgaggagttcaagttgaaacaaatgtggaaatcaccaaatggcaccatacgaaatattctgggtggcacggtcttcagagaagccattatctgcaaaaatatcccccggcttgtgagtggatgggtaaaacctatcatcataggtcgtcatgcttatggggatcaatacagagcaactgattttgttgttcctgggcctggaaaagtagagataacctacacaccaagtgacggaacccaaaaggtgacatacctggtacataactttgaagaaggtggtggtgttgccatggggatgtataatcaagataagtcaattgaagattttgcacacagttccttccaaatggctctgtctaagggttggcctttgtatctgagcaccaaaaacactattctgaagaaatatgatgggcgttttaaagacatctttcaggagatatatgacaagcagtacaagtcccagtttgaagctcaaaagatctggtatgagcataggctcatcgacgacatggtggcccaagctatgaaatcagagggaggcttcatctgggcctgtaaaaactatgatggtgacgtgcagtcggactctgtggcccaagggtatggctctctcggcatgatgaccagcgtgctggtttgtccagatggcaagacagtagaagcagaggctgcccacgggactgtaacccgtcactaccgcatgtaccagaaaggacaggagacgtccaccaatcccattgcttccatttttgcctggaccagagggttagcccacagagcaaagcttgataacaataaagagcttgccttctttgcaaatgctttggaagaagtctctattgagacaattgaggctggcttcatgaccaaggacttggctgcttgcattaaaggtttacccaatgtgcaacgttctgactacttgaatacatttgagttcatggataaacttggagaaaacttgaagatcaaactagctcaggccaaactttaagttcatacctgagctaagaaggataattgtcttttggtaactaggtctacaggtttacatttttctgtgttacactcaaggataaaggcaaaatcaattttgtaatttgtttagaagccagagtttatcttttctataagtttacagcctttttcttatatatacagttattgccacctttgtgaacatggcaagggacttttttacaatttttattttattttctagtaccagcctaggaattcggttagtactcatttgtattcactgtcactttttctcatgttctaattataaatgaccaaaatcaagattgctcaaaagggtaaatgatagccacagtattgctccctaaaatatgcataaagtagaaattcactgccttcccctcctgtccatgaccttgggcacagggaagttctggtgtcatagatatcccgttttgtgaggtagagctgtgcattaaacttgcacatgactggaacgaagtatgagtgcaactcaaatgtgttgaagatactgcagtcatttttgtaaagaccttgctgaatgtttccaatagactaaatactgtttaggccgcaggagagtttggaatccggaataaatactacctggaggtttgtcctctccatttttctctttctcctcctggcctggcctgaatattatactactctaaatagcatatttcatccaagtgcaataatgtaagctgaatcttttttggacttctgctggcctgttttatttcttttatataaatgtgatttctcagaaattgatattaaacactatcttatcttctcctgaactgttgattttaattaaaattaagtgctaattaccattaaaaaaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]