GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-10-17 16:07:27, GGRNA.v2 : RefSeq release 207 (Jul, 2021)

LOCUS       NM_001271193            3150 bp    mRNA    linear   ROD 03-FEB-2021
DEFINITION  Rattus norvegicus argonaute RISC catalytic component 3 (Ago3),
            mRNA.
ACCESSION   NM_001271193 XM_001058231
VERSION     NM_001271193.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 3150)
  AUTHORS   Park MS, Phan HD, Busch F, Hinckley SH, Brackbill JA, Wysocki VH
            and Nakanishi K.
  TITLE     Human Argonaute3 has slicer activity
  JOURNAL   Nucleic Acids Res 45 (20), 11867-11877 (2017)
   PUBMED   29040713
REFERENCE   2  (bases 1 to 3150)
  AUTHORS   Sun S, Ma J, Zhang Q, Wang Q, Zhou L, Bai F, Hu H, Chang P, Yu J
            and Gao B.
  TITLE     Argonaute proteins in cardiac tissue contribute to the heart injury
            during viral myocarditis
  JOURNAL   Cardiovasc Pathol 25 (2), 120-126 (2016)
   PUBMED   26764146
REFERENCE   3  (bases 1 to 3150)
  AUTHORS   Hu Q, Tanasa B, Trabucchi M, Li W, Zhang J, Ohgi KA, Rose DW, Glass
            CK and Rosenfeld MG.
  TITLE     DICER- and AGO3-dependent generation of retinoic acid-induced DR2
            Alu RNAs regulates human stem cell proliferation
  JOURNAL   Nat Struct Mol Biol 19 (11), 1168-1175 (2012)
   PUBMED   23064648
REFERENCE   4  (bases 1 to 3150)
  AUTHORS   Gu S, Jin L, Huang Y, Zhang F and Kay MA.
  TITLE     Slicing-independent RISC activation requires the argonaute PAZ
            domain
  JOURNAL   Curr Biol 22 (16), 1536-1542 (2012)
   PUBMED   22795694
REFERENCE   5  (bases 1 to 3150)
  AUTHORS   Modzelewski AJ, Holmes RJ, Hilz S, Grimson A and Cohen PE.
  TITLE     AGO4 regulates entry into meiosis and influences silencing of sex
            chromosomes in the male mouse germline
  JOURNAL   Dev Cell 23 (2), 251-264 (2012)
   PUBMED   22863743
REFERENCE   6  (bases 1 to 3150)
  AUTHORS   Yoda M, Kawamata T, Paroo Z, Ye X, Iwasaki S, Liu Q and Tomari Y.
  TITLE     ATP-dependent human RISC assembly pathways
  JOURNAL   Nat Struct Mol Biol 17 (1), 17-23 (2010)
   PUBMED   19966796
REFERENCE   7  (bases 1 to 3150)
  AUTHORS   Ghosh D, Lippert D, Krokhin O, Cortens JP and Wilkins JA.
  TITLE     Defining the membrane proteome of NK cells
  JOURNAL   J Mass Spectrom 45 (1), 1-25 (2010)
   PUBMED   19946888
REFERENCE   8  (bases 1 to 3150)
  AUTHORS   Chi SW, Zang JB, Mele A and Darnell RB.
  TITLE     Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps
  JOURNAL   Nature 460 (7254), 479-486 (2009)
   PUBMED   19536157
REFERENCE   9  (bases 1 to 3150)
  AUTHORS   Wu L, Fan J and Belasco JG.
  TITLE     Importance of translation and nonnucleolytic ago proteins for
            on-target RNA interference
  JOURNAL   Curr Biol 18 (17), 1327-1332 (2008)
   PUBMED   18771919
REFERENCE   10 (bases 1 to 3150)
  AUTHORS   Meister G, Landthaler M, Patkaniowska A, Dorsett Y, Teng G and
            Tuschl T.
  TITLE     Human Argonaute2 mediates RNA cleavage targeted by miRNAs and
            siRNAs
  JOURNAL   Mol Cell 15 (2), 185-197 (2004)
   PUBMED   15260970
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JACYVU010000162.1.
            On Sep 6, 2012 this sequence version replaced XM_001058231.3.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            RNAseq introns :: mixed/partial sample support SAMD00132261,
                              SAMD00132262 [ECO:0000350]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-270               JACYVU010000162.1  53263260-53263529   c
            271-442             JACYVU010000162.1  53251134-53251305   c
            443-563             JACYVU010000162.1  53242649-53242769   c
            564-772             JACYVU010000162.1  53240580-53240788   c
            773-909             JACYVU010000162.1  53239551-53239687   c
            910-1044            JACYVU010000162.1  53218140-53218274   c
            1045-1132           JACYVU010000162.1  53213223-53213310   c
            1133-1280           JACYVU010000162.1  53212961-53213108   c
            1281-1400           JACYVU010000162.1  53211644-53211763   c
            1401-1523           JACYVU010000162.1  53210324-53210446   c
            1524-1657           JACYVU010000162.1  53209509-53209642   c
            1658-1842           JACYVU010000162.1  53207638-53207822   c
            1843-2002           JACYVU010000162.1  53201603-53201762   c
            2003-2093           JACYVU010000162.1  53199969-53200059   c
            2094-2288           JACYVU010000162.1  53197073-53197267   c
            2289-2423           JACYVU010000162.1  53196226-53196360   c
            2424-2525           JACYVU010000162.1  53194277-53194378   c
            2526-2725           JACYVU010000162.1  53192441-53192640   c
            2726-3150           JACYVU010000162.1  53191274-53191698   c
FEATURES             Location/Qualifiers
     source          1..3150
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="5"
                     /map="5q36"
     gene            1..3150
                     /gene="Ago3"
                     /gene_synonym="Eif2c3"
                     /note="argonaute RISC catalytic component 3"
                     /db_xref="GeneID:313593"
                     /db_xref="RGD:1309163"
     exon            1..270
                     /gene="Ago3"
                     /gene_synonym="Eif2c3"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    249..251
                     /gene="Ago3"
                     /gene_synonym="Eif2c3"
                     /note="upstream in-frame stop codon"
     CDS             252..2834
                     /gene="Ago3"
                     /gene_synonym="Eif2c3"
                     /EC_number="3.1.26.n2"
                     /note="eukaryotic translation initiation factor 2C, 3;
                     argonaute 3, RISC catalytic component"
                     /codon_start=1
                     /product="protein argonaute-3"
                     /protein_id="NP_001258122.1"
                     /db_xref="GeneID:313593"
                     /db_xref="RGD:1309163"
                     /translation="
MEIGSAGPIGAQPLLIVPRRPGYGTMGKPIKLLANCFQVEIPKIDVYLYEVDIKPDKCPRRVNREVVDSMVQHFKVTIFGDRRPVYDGKRSLYTANPLPVATTGVDLDVTLPGEGGKDRPFKVSVKFVSRVSWHLLHEVLTGRTLPEPLELDKPISTNPVHAVDVVLRHLPSMKYTPVGRSFFSAPEGYDHPLGGGREVWFGFHQSVRPAMWKMMLNIDVSATAFYKAQPVIQFMCEVLDIHNIDEQPRPLTDSHRVKFTKEIKGLKVEVTHCGTMRRKYRVCNVTRRPASHQTFPLQLENGQTVERTVAQYFREKYTLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVRSANYETDPFVQEFQFKVRDEMAHVTGRVLPAPMLQYGGRNRTVATPSHGVWDMRGKQFHTGVEIKMWAIACFATQRQCREEILKGFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVIKTSPQTLSNLCLKINVKLGGINNILVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPSRYCATVRVQRPRQEIIQDLASMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFRQVLYYELLAIREACISLEKDYQPGITYIVVQKRHHTRLFCADRTERVGRSGNIPAGTTVDTDITHPYEFDFYLCSHAGIQGTSRPSHYHVLWDDNCFTADELQLLTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHVSGQSNGRDPQALAKAVQIHQDTLRTMYFA"
     misc_feature    468..752
                     /gene="Ago3"
                     /gene_synonym="Eif2c3"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:406799"
     misc_feature    780..932
                     /gene="Ago3"
                     /gene_synonym="Eif2c3"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:400854"
     misc_feature    933..1295
                     /gene="Ago3"
                     /gene_synonym="Eif2c3"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    1428..2705
                     /gene="Ago3"
                     /gene_synonym="Eif2c3"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     exon            271..442
                     /gene="Ago3"
                     /gene_synonym="Eif2c3"
                     /inference="alignment:Splign:2.1.0"
     exon            443..563
                     /gene="Ago3"
                     /gene_synonym="Eif2c3"
                     /inference="alignment:Splign:2.1.0"
     exon            564..772
                     /gene="Ago3"
                     /gene_synonym="Eif2c3"
                     /inference="alignment:Splign:2.1.0"
     exon            773..909
                     /gene="Ago3"
                     /gene_synonym="Eif2c3"
                     /inference="alignment:Splign:2.1.0"
     exon            910..1044
                     /gene="Ago3"
                     /gene_synonym="Eif2c3"
                     /inference="alignment:Splign:2.1.0"
     exon            1045..1132
                     /gene="Ago3"
                     /gene_synonym="Eif2c3"
                     /inference="alignment:Splign:2.1.0"
     exon            1133..1280
                     /gene="Ago3"
                     /gene_synonym="Eif2c3"
                     /inference="alignment:Splign:2.1.0"
     exon            1281..1400
                     /gene="Ago3"
                     /gene_synonym="Eif2c3"
                     /inference="alignment:Splign:2.1.0"
     exon            1401..1523
                     /gene="Ago3"
                     /gene_synonym="Eif2c3"
                     /inference="alignment:Splign:2.1.0"
     exon            1524..1657
                     /gene="Ago3"
                     /gene_synonym="Eif2c3"
                     /inference="alignment:Splign:2.1.0"
     exon            1658..1842
                     /gene="Ago3"
                     /gene_synonym="Eif2c3"
                     /inference="alignment:Splign:2.1.0"
     exon            1843..2002
                     /gene="Ago3"
                     /gene_synonym="Eif2c3"
                     /inference="alignment:Splign:2.1.0"
     exon            2003..2093
                     /gene="Ago3"
                     /gene_synonym="Eif2c3"
                     /inference="alignment:Splign:2.1.0"
     exon            2094..2288
                     /gene="Ago3"
                     /gene_synonym="Eif2c3"
                     /inference="alignment:Splign:2.1.0"
     exon            2289..2423
                     /gene="Ago3"
                     /gene_synonym="Eif2c3"
                     /inference="alignment:Splign:2.1.0"
     exon            2424..2525
                     /gene="Ago3"
                     /gene_synonym="Eif2c3"
                     /inference="alignment:Splign:2.1.0"
     exon            2526..2725
                     /gene="Ago3"
                     /gene_synonym="Eif2c3"
                     /inference="alignment:Splign:2.1.0"
     exon            2726..3150
                     /gene="Ago3"
                     /gene_synonym="Eif2c3"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
gacccgggagagcgaaaagcggcggcggcggggcggctggagggtcccggaggtgcgcgcgtcagcagctgtaggcgacgcaagttccggacccggcttcagcgtcctcacctcaggactgtcgccgctcttaccttgctgctgactgtctccggacagtgcctcttctgcctggagctttcagagggcgtccgctcctcacctctgtggtggcacctttctcttgtgaagcactccccacagctccatgaatggaaatcggctccgcaggacccattggggcccagcccctactcatagtgcccagaagacctgggtatggcactatgggcaaacccattaaactgttggctaactgttttcaagttgaaatcccaaagatcgatgtctacctctatgaggtcgacatcaaacccgacaagtgtcctcgaagagtgaacagagaagtagttgactcaatggttcagcattttaaagtgactatatttggagaccgtagaccagtttatgatggaaaaagaagcctttacacagccaatccacttcctgtggcaactactggggtagatttagatgttactttacctggggaaggtggaaaagatcgccctttcaaggtgtcagtgaagtttgtgtccagagtcagttggcacctactacatgaagttctgactggtcggactttgcctgagccactggaattagacaagccaatcagcactaacccggtccatgccgttgatgtggtgctccgacatctgccctctatgaaatatacgcctgtggggcgctcctttttctcagctccagaaggatacgaccaccctcttggagggggcagggaagtatggtttggattccatcaatctgttcggcctgccatgtggaaaatgatgctcaatattgatgtttctgccactgccttttacaaagcacagcctgtcattcagttcatgtgtgaagttcttgacattcacaacatcgatgagcaacccagacccctgaccgattctcatcgggtaaaattcactaaggagataaaaggtctgaaggttgaagtgactcattgtggaacaatgagacggaaataccgtgtctgtaatgtaacaagaaggcctgccagccaccaaacatttcctttacagctagaaaatggccaaactgtggagagaactgtagctcagtatttccgagaaaagtacacacttcagctgaagtacccacaccttccctgtctgcaagtggggcaggagcagaagcatacatacctgccactagaagtctgtaatattgtggctggacagaggtgtatcaagaaactaacagacaatcagacttctactatgattaaggcaacagcaagatctgcaccagatagacaagaggaaattagcagattggtaagaagtgcaaattatgaaacagatccatttgttcaggagtttcagtttaaagtgcgggatgagatggcccatgtgaccggtcgagtactgccagcacctatgctccagtatggaggacggaaccggacagtagcaacaccaagccacggagtatgggacatgagaggaaaacagttccacacaggagttgaaatcaaaatgtgggctatcgcttgctttgccacacagaggcagtgcagagaagaaatactgaaaggattcacagaccagcttcggaagatctccaaggatgcagggatgcccatccagggtcagccatgtttctgcaaatacgcacagggggcagacagcgtggagcccatgttccggcatctcaagaatacctactcaggactgcagctcattatcgtcatcctgcctgggaagacgccggtatatgcggaggtgaagcgtgtaggagacacacttttgggtatggccacacagtgtgtgcaagtcaagaatgtaataaaaacatctcctcaaactctttcaaacttgtgcctaaagatcaatgttaaacttggaggaatcaataatattcttgtacctcatcaaagaccttctgtgttccagcaaccagtgatcttcctgggcgcagatgtcacacacccgcctgctggtgacgggaagaagccttccattgctgctgttgtaggcagtatggatgcccatccaagcagatactgtgccacagtgagagttcagagaccccgacaggaaatcatccaggacttggcctccatggtccgggaactgctcatccaattttacaagtcaacccgattcaaacctactcggatcatcttttatcgggatggtgtttccgaaggacagtttagacaggtattatattatgagctcctggcaattcgagaagcctgtatcagtttggaaaaagactatcaacctggaataacctacattgtcgttcagaagagacatcatacgcgattgttctgtgctgatagaacagaaagggtgggaagaagcggcaacatcccagctggaaccacagtggatacagacatcactcacccgtatgaattcgacttttatctctgcagccatgctggaatacagggaaccagccgtccttctcactatcacgttctgtgggatgacaactgcttcactgcggatgaactgcagctgctgacctaccagctctgccacacctacgtgcgctgtaccaggtccgtgtcgatccctgcaccagcgtactatgctcacctggtggcgttcagagccaggtaccatctggtggacaaggagcatgacagtgctgaaggaagccatgtgtcaggacagagcaatggacgagatccacaagctcttgccaaggctgtccagattcaccaagataccttacgcacaatgtacttcgcttagcaagtccaagtgatctccgagaggaagagctggagctcgtatgtttccagtggactcagttcactggggaggcctccagccgcacagaagccaatactatgtaggggtctggaccttacgttgatccgaggaaaaatgtttactctgtcaaagaacacagcactgttgtataccagggagccagcccgctgcttttttgcagtgtcctgtagaagaagcatcacggttgttcgttctcacttcttacagtctaaccccattaatacctttacctcaagttgcttagcggcacaaccgtctctgcaaaaaaagtaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]