2025-07-08 15:22:40, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NM_001271038 2527 bp mRNA linear ROD 28-MAR-2024 DEFINITION Rattus norvegicus homeo box D3 (Hoxd3), mRNA. ACCESSION NM_001271038 XM_213633 VERSION NM_001271038.1 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 2527) AUTHORS Yang,X., Zhou,Y., Barcarse,E.A. and O'Gorman,S. TITLE Altered neuronal lineages in the facial ganglia of Hoxa2 mutant mice JOURNAL Dev Biol 314 (1), 171-188 (2008) PUBMED 18164701 REFERENCE 2 (bases 1 to 2527) AUTHORS Boudreau,N.J. and Varner,J.A. TITLE The homeobox transcription factor Hox D3 promotes integrin alpha5beta1 expression and function during angiogenesis JOURNAL J Biol Chem 279 (6), 4862-4868 (2004) PUBMED 14610084 REFERENCE 3 (bases 1 to 2527) AUTHORS Taniguchi,Y., Sato,M., Tanaka,O., Sekiguchi,M., Inoko,H. and Kimura,M. TITLE HOXD3 regulates expression of JAGGED1, a ligand for Notch receptors JOURNAL Nucleic Acids Res Suppl (1), 43-44 (2001) PUBMED 12836255 REFERENCE 4 (bases 1 to 2527) AUTHORS Manley,N.R. and Capecchi,M.R. TITLE Hox group 3 paralogs regulate the development and migration of the thymus, thyroid, and parathyroid glands JOURNAL Dev Biol 195 (1), 1-15 (1998) PUBMED 9520319 REFERENCE 5 (bases 1 to 2527) AUTHORS Manley,N.R. and Capecchi,M.R. TITLE Hox group 3 paralogous genes act synergistically in the formation of somitic and neural crest-derived structures JOURNAL Dev Biol 192 (2), 274-288 (1997) PUBMED 9441667 REFERENCE 6 (bases 1 to 2527) AUTHORS Taniguchi,Y., Komatsu,N. and Moriuchi,T. TITLE Overexpression of the HOX4A (HOXD3) homeobox gene in human erythroleukemia HEL cells results in altered adhesive properties JOURNAL Blood 85 (10), 2786-2794 (1995) PUBMED 7742539 REFERENCE 7 (bases 1 to 2527) AUTHORS Condie,B.G. and Capecchi,M.R. TITLE Mice with targeted disruptions in the paralogous genes hoxa-3 and hoxd-3 reveal synergistic interactions JOURNAL Nature 370 (6487), 304-307 (1994) PUBMED 7913519 REMARK Erratum:[Nature 1994 Oct 6;371(6497):537] REFERENCE 8 (bases 1 to 2527) AUTHORS Condie,B.G. and Capecchi,M.R. TITLE Mice homozygous for a targeted disruption of Hoxd-3 (Hox-4.1) exhibit anterior transformations of the first and second cervical vertebrae, the atlas and the axis JOURNAL Development 119 (3), 579-595 (1993) PUBMED 7910549 REFERENCE 9 (bases 1 to 2527) AUTHORS Chung,S.Y., Dai,P.H., Lei,J., Riviere,M., Levan,G., Szpirer,J. and Szpirer,C. TITLE Chromosomal assignment of seven rat homeobox genes to rat chromosomes 3, 4, 7, and 10 JOURNAL Mamm Genome 4 (9), 537-540 (1993) PUBMED 7906969 REFERENCE 10 (bases 1 to 2527) AUTHORS Falzon,M. and Chung,S.Y. TITLE The expression of rat homeobox-containing genes is developmentally regulated and tissue specific JOURNAL Development 103 (3), 601-610 (1988) PUBMED 2907739 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JAXUCZ010000003.1. On Aug 28, 2012 this sequence version replaced XM_213633.6. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## RNAseq introns :: single sample supports all introns SAMN17050764 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on conservation, longest protein ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-298 JAXUCZ010000003.1 80046126-80046423 299-922 JAXUCZ010000003.1 80053704-80054327 923-2527 JAXUCZ010000003.1 80056096-80057700 FEATURES Location/Qualifiers source 1..2527 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN" /db_xref="taxon:10116" /chromosome="3" /map="3q23" gene 1..2527 /gene="Hoxd3" /gene_synonym="Hox4r6" /note="homeo box D3" /db_xref="GeneID:288152" /db_xref="RGD:1588601" exon 1..298 /gene="Hoxd3" /gene_synonym="Hox4r6" /inference="alignment:Splign:2.1.0" exon 299..922 /gene="Hoxd3" /gene_synonym="Hox4r6" /inference="alignment:Splign:2.1.0" misc_feature 376..378 /gene="Hoxd3" /gene_synonym="Hox4r6" /note="upstream in-frame stop codon" CDS 382..1680 /gene="Hoxd3" /gene_synonym="Hox4r6" /note="homeobox protein R6; Homeobox gene D3" /codon_start=1 /product="homeobox protein Hox-D3" /protein_id="NP_001257967.1" /db_xref="GeneID:288152" /db_xref="RGD:1588601" /translation="
MLFEQGQQALELPECTMQKAAYYENPGLFGGYGYSKATDAYGYSTPHQPYPPPAAANSLDSDYPSSACSIQSSAPLRAPAHKGAELNGSCMRPGTGNSQGGGGGNQPPGLNSEQQPPQPPPPPPTLPPSSPTNPGSGVPAKKTKGGPNASSSSSTISKQIFPWMKESRQNSKQKNSCATSGENCEDKSPPGPASKRVRTAYTSAQLVELEKEFHFNRYLCRPRRVEMANLLNLTERQIKIWFQNRRMKYKKDQKAKGILHSPAGQSPERSPPLGGAAGHVAYSGQLPPVPGLAYDAPSPPAFAKSQPNMYGLAAYTAPLSSCLPQQKRYAAPEFEPHPMASNGGGFASANLQGSPVYVGGNFVDSMAPASGPVFNLGHLSHPSSASVDYSCAAQIPGNHHHGPCDPHPTYTDLSAHHTSQGRLPEAPKLTHL"
misc_feature 964..1134 /gene="Hoxd3" /gene_synonym="Hox4r6" /note="Region: Homeodomain; pfam00046" /db_xref="CDD:459649" misc_feature 1486..1671 /gene="Hoxd3" /gene_synonym="Hox4r6" /note="Domain of unknown function (DUF4074); Region: DUF4074; pfam13293" /db_xref="CDD:463833" exon 923..2527 /gene="Hoxd3" /gene_synonym="Hox4r6" /inference="alignment:Splign:2.1.0" ORIGIN
gccgctttgggcctgggagccgaccggcgggcgggtggaccgaccagcgagcagcgcaggcgaagccagcttggggactacaaactcgttcctccagcgtttattggtagttgaacctcagcctggttccgttctaccgggaattccgtgtactctggtatatggccgagtctgcaagcgcgcaagaccagggttgggacactgttgtctgcagacaaagggggaaggctagctctgccccccactggcgcccactctgagaccgaggacaccaggtttatgataaattgggatccaggttacctggagcttggaaactggcccagctctctcaagattagcagacactggccttggtggagaaggagacagtggtagtcaatgttatttgagcagggtcagcaggccctggagcttcctgagtgcaccatgcagaaggctgcatactatgagaacccaggactctttggaggctatggatacagcaaagccactgatgcatatggctatagcactcctcatcaaccctacccaccccctgctgctgccaactccctggacagtgattacccaagttctgcctgctccatccagagttctgcacctcttcgagccccagcccacaaaggagcggaactcaacggtagctgcatgcggcctggcactgggaacagccagggtgggggtggaggcaaccaacctcctggcctgaactcagagcagcagccaccgcaacctccccctccaccacccaccctgcccccatcctcacccaccaatcccggaagcggagtgcctgccaagaagaccaagggtgggcccaatgcttctagctcttcctctaccatcagcaagcagatcttcccctggatgaaggaatcccgacagaactcaaagcagaagaacagctgtgccacttcaggagagaactgcgaggacaagagcccaccgggcccggcatccaagagggtgcgcacggcgtacacgagtgctcagctggtagagctggagaaggagttccacttcaaccgctacctgtgccggccgcgccgcgtggagatggctaacctgctgaacctcaccgaacgccagatcaagatctggttccagaaccgtcgcatgaagtacaagaaggaccagaaggccaagggcatcctgcattctcccgcaggccagtccccggagcgcagcccacctcttggaggagcggcgggccacgtggcctactccggccagctgccgcccgtgcccggcctggcctacgacgcaccctcgccgccggctttcgctaaatcgcagcccaatatgtacggcctggccgcctacacggcgcctctcagtagctgcctgccgcagcagaagcgttacgcggcgcccgagttcgagccccaccccatggcgagcaacggcggcggcttcgccagcgccaacctgcagggcagcccggtgtacgtaggtggcaacttcgtcgactccatggcgcccgcgtccgggccggtcttcaatctgggtcacctctcgcacccgtcttcggccagcgtggactacagctgcgccgcgcaaatccctggcaaccatcaccacggaccgtgcgaccctcatcccacctacacagatctctcggctcaccacacgtctcagggacgcctgcccgaggcccccaaactgacacatctgtagcggttgccgccggcctggcgcaattacctctctggttttggtggcaggggtggtggcggggcggggcccgaaaggcagtttaggggaacccccctccctgatctggcctggcagatgccacacgagtttcgggcttccagcggccgaggctgacgcgactgggcctcccctccaggcgtgtcctcctttgggtgactcgctataaatcagccgcaaggatcctcccctgtaaacctgacagtgccataaactgcggaccgagggactctaatctggtaatggtgtccctaaggtaagtcctagacctatccgtggcgtgtcctgaagagagggactagagcctggagaaccccgggcctggcccttctgtctagcttagtttcagagaccttaatttataatgctccttcccttcctgtaaagattgcatcggactaaacaatctgtatttattatttgaagcgagtaatttcgtttccctgattatttatcctagtcttaatgtatttatgtgtatatttgtagaattctgcagccgggcctaggtactcgctcccaggccttttggggggggggcatatttcatctctttagtccccttggtctgaactagttgagagaatagtcttgaacagttgtaaccgtggctggtgtctgtagttgttgtaaaggactgagatcacaaatggtccttcatgggtagagtcaggcagcccggtggcatagcgcgactcaagcgagtcgtttctcaacagccgaagccctcaccactcgacacagcttactgatttcaaattgtctggtactatttgaacaaacatttagaataaaacatttttttcagttg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]