GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-07-07 06:33:36, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       NM_001271038            2527 bp    mRNA    linear   ROD 28-MAR-2024
DEFINITION  Rattus norvegicus homeo box D3 (Hoxd3), mRNA.
ACCESSION   NM_001271038 XM_213633
VERSION     NM_001271038.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 2527)
  AUTHORS   Yang,X., Zhou,Y., Barcarse,E.A. and O'Gorman,S.
  TITLE     Altered neuronal lineages in the facial ganglia of Hoxa2 mutant
            mice
  JOURNAL   Dev Biol 314 (1), 171-188 (2008)
   PUBMED   18164701
REFERENCE   2  (bases 1 to 2527)
  AUTHORS   Boudreau,N.J. and Varner,J.A.
  TITLE     The homeobox transcription factor Hox D3 promotes integrin
            alpha5beta1 expression and function during angiogenesis
  JOURNAL   J Biol Chem 279 (6), 4862-4868 (2004)
   PUBMED   14610084
REFERENCE   3  (bases 1 to 2527)
  AUTHORS   Taniguchi,Y., Sato,M., Tanaka,O., Sekiguchi,M., Inoko,H. and
            Kimura,M.
  TITLE     HOXD3 regulates expression of JAGGED1, a ligand for Notch receptors
  JOURNAL   Nucleic Acids Res Suppl (1), 43-44 (2001)
   PUBMED   12836255
REFERENCE   4  (bases 1 to 2527)
  AUTHORS   Manley,N.R. and Capecchi,M.R.
  TITLE     Hox group 3 paralogs regulate the development and migration of the
            thymus, thyroid, and parathyroid glands
  JOURNAL   Dev Biol 195 (1), 1-15 (1998)
   PUBMED   9520319
REFERENCE   5  (bases 1 to 2527)
  AUTHORS   Manley,N.R. and Capecchi,M.R.
  TITLE     Hox group 3 paralogous genes act synergistically in the formation
            of somitic and neural crest-derived structures
  JOURNAL   Dev Biol 192 (2), 274-288 (1997)
   PUBMED   9441667
REFERENCE   6  (bases 1 to 2527)
  AUTHORS   Taniguchi,Y., Komatsu,N. and Moriuchi,T.
  TITLE     Overexpression of the HOX4A (HOXD3) homeobox gene in human
            erythroleukemia HEL cells results in altered adhesive properties
  JOURNAL   Blood 85 (10), 2786-2794 (1995)
   PUBMED   7742539
REFERENCE   7  (bases 1 to 2527)
  AUTHORS   Condie,B.G. and Capecchi,M.R.
  TITLE     Mice with targeted disruptions in the paralogous genes hoxa-3 and
            hoxd-3 reveal synergistic interactions
  JOURNAL   Nature 370 (6487), 304-307 (1994)
   PUBMED   7913519
  REMARK    Erratum:[Nature 1994 Oct 6;371(6497):537]
REFERENCE   8  (bases 1 to 2527)
  AUTHORS   Condie,B.G. and Capecchi,M.R.
  TITLE     Mice homozygous for a targeted disruption of Hoxd-3 (Hox-4.1)
            exhibit anterior transformations of the first and second cervical
            vertebrae, the atlas and the axis
  JOURNAL   Development 119 (3), 579-595 (1993)
   PUBMED   7910549
REFERENCE   9  (bases 1 to 2527)
  AUTHORS   Chung,S.Y., Dai,P.H., Lei,J., Riviere,M., Levan,G., Szpirer,J. and
            Szpirer,C.
  TITLE     Chromosomal assignment of seven rat homeobox genes to rat
            chromosomes 3, 4, 7, and 10
  JOURNAL   Mamm Genome 4 (9), 537-540 (1993)
   PUBMED   7906969
REFERENCE   10 (bases 1 to 2527)
  AUTHORS   Falzon,M. and Chung,S.Y.
  TITLE     The expression of rat homeobox-containing genes is developmentally
            regulated and tissue specific
  JOURNAL   Development 103 (3), 601-610 (1988)
   PUBMED   2907739
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JAXUCZ010000003.1.
            
            On Aug 28, 2012 this sequence version replaced XM_213633.6.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            RNAseq introns :: single sample supports all introns SAMN17050764
                              [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on conservation, longest protein
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-298               JAXUCZ010000003.1  80046126-80046423
            299-922             JAXUCZ010000003.1  80053704-80054327
            923-2527            JAXUCZ010000003.1  80056096-80057700
FEATURES             Location/Qualifiers
     source          1..2527
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="3"
                     /map="3q23"
     gene            1..2527
                     /gene="Hoxd3"
                     /gene_synonym="Hox4r6"
                     /note="homeo box D3"
                     /db_xref="GeneID:288152"
                     /db_xref="RGD:1588601"
     exon            1..298
                     /gene="Hoxd3"
                     /gene_synonym="Hox4r6"
                     /inference="alignment:Splign:2.1.0"
     exon            299..922
                     /gene="Hoxd3"
                     /gene_synonym="Hox4r6"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    376..378
                     /gene="Hoxd3"
                     /gene_synonym="Hox4r6"
                     /note="upstream in-frame stop codon"
     CDS             382..1680
                     /gene="Hoxd3"
                     /gene_synonym="Hox4r6"
                     /note="homeobox protein R6; Homeobox gene D3"
                     /codon_start=1
                     /product="homeobox protein Hox-D3"
                     /protein_id="NP_001257967.1"
                     /db_xref="GeneID:288152"
                     /db_xref="RGD:1588601"
                     /translation="
MLFEQGQQALELPECTMQKAAYYENPGLFGGYGYSKATDAYGYSTPHQPYPPPAAANSLDSDYPSSACSIQSSAPLRAPAHKGAELNGSCMRPGTGNSQGGGGGNQPPGLNSEQQPPQPPPPPPTLPPSSPTNPGSGVPAKKTKGGPNASSSSSTISKQIFPWMKESRQNSKQKNSCATSGENCEDKSPPGPASKRVRTAYTSAQLVELEKEFHFNRYLCRPRRVEMANLLNLTERQIKIWFQNRRMKYKKDQKAKGILHSPAGQSPERSPPLGGAAGHVAYSGQLPPVPGLAYDAPSPPAFAKSQPNMYGLAAYTAPLSSCLPQQKRYAAPEFEPHPMASNGGGFASANLQGSPVYVGGNFVDSMAPASGPVFNLGHLSHPSSASVDYSCAAQIPGNHHHGPCDPHPTYTDLSAHHTSQGRLPEAPKLTHL"
     misc_feature    964..1134
                     /gene="Hoxd3"
                     /gene_synonym="Hox4r6"
                     /note="Region: Homeodomain; pfam00046"
                     /db_xref="CDD:459649"
     misc_feature    1486..1671
                     /gene="Hoxd3"
                     /gene_synonym="Hox4r6"
                     /note="Domain of unknown function (DUF4074); Region:
                     DUF4074; pfam13293"
                     /db_xref="CDD:463833"
     exon            923..2527
                     /gene="Hoxd3"
                     /gene_synonym="Hox4r6"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
gccgctttgggcctgggagccgaccggcgggcgggtggaccgaccagcgagcagcgcaggcgaagccagcttggggactacaaactcgttcctccagcgtttattggtagttgaacctcagcctggttccgttctaccgggaattccgtgtactctggtatatggccgagtctgcaagcgcgcaagaccagggttgggacactgttgtctgcagacaaagggggaaggctagctctgccccccactggcgcccactctgagaccgaggacaccaggtttatgataaattgggatccaggttacctggagcttggaaactggcccagctctctcaagattagcagacactggccttggtggagaaggagacagtggtagtcaatgttatttgagcagggtcagcaggccctggagcttcctgagtgcaccatgcagaaggctgcatactatgagaacccaggactctttggaggctatggatacagcaaagccactgatgcatatggctatagcactcctcatcaaccctacccaccccctgctgctgccaactccctggacagtgattacccaagttctgcctgctccatccagagttctgcacctcttcgagccccagcccacaaaggagcggaactcaacggtagctgcatgcggcctggcactgggaacagccagggtgggggtggaggcaaccaacctcctggcctgaactcagagcagcagccaccgcaacctccccctccaccacccaccctgcccccatcctcacccaccaatcccggaagcggagtgcctgccaagaagaccaagggtgggcccaatgcttctagctcttcctctaccatcagcaagcagatcttcccctggatgaaggaatcccgacagaactcaaagcagaagaacagctgtgccacttcaggagagaactgcgaggacaagagcccaccgggcccggcatccaagagggtgcgcacggcgtacacgagtgctcagctggtagagctggagaaggagttccacttcaaccgctacctgtgccggccgcgccgcgtggagatggctaacctgctgaacctcaccgaacgccagatcaagatctggttccagaaccgtcgcatgaagtacaagaaggaccagaaggccaagggcatcctgcattctcccgcaggccagtccccggagcgcagcccacctcttggaggagcggcgggccacgtggcctactccggccagctgccgcccgtgcccggcctggcctacgacgcaccctcgccgccggctttcgctaaatcgcagcccaatatgtacggcctggccgcctacacggcgcctctcagtagctgcctgccgcagcagaagcgttacgcggcgcccgagttcgagccccaccccatggcgagcaacggcggcggcttcgccagcgccaacctgcagggcagcccggtgtacgtaggtggcaacttcgtcgactccatggcgcccgcgtccgggccggtcttcaatctgggtcacctctcgcacccgtcttcggccagcgtggactacagctgcgccgcgcaaatccctggcaaccatcaccacggaccgtgcgaccctcatcccacctacacagatctctcggctcaccacacgtctcagggacgcctgcccgaggcccccaaactgacacatctgtagcggttgccgccggcctggcgcaattacctctctggttttggtggcaggggtggtggcggggcggggcccgaaaggcagtttaggggaacccccctccctgatctggcctggcagatgccacacgagtttcgggcttccagcggccgaggctgacgcgactgggcctcccctccaggcgtgtcctcctttgggtgactcgctataaatcagccgcaaggatcctcccctgtaaacctgacagtgccataaactgcggaccgagggactctaatctggtaatggtgtccctaaggtaagtcctagacctatccgtggcgtgtcctgaagagagggactagagcctggagaaccccgggcctggcccttctgtctagcttagtttcagagaccttaatttataatgctccttcccttcctgtaaagattgcatcggactaaacaatctgtatttattatttgaagcgagtaatttcgtttccctgattatttatcctagtcttaatgtatttatgtgtatatttgtagaattctgcagccgggcctaggtactcgctcccaggccttttggggggggggcatatttcatctctttagtccccttggtctgaactagttgagagaatagtcttgaacagttgtaaccgtggctggtgtctgtagttgttgtaaaggactgagatcacaaatggtccttcatgggtagagtcaggcagcccggtggcatagcgcgactcaagcgagtcgtttctcaacagccgaagccctcaccactcgacacagcttactgatttcaaattgtctggtactatttgaacaaacatttagaataaaacatttttttcagttg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]