GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:29:37, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NM_001244539            1237 bp    mRNA    linear   MAM 14-AUG-2017
DEFINITION  Sus scrofa claudin 1 (CLDN1), mRNA.
ACCESSION   NM_001244539 XM_003358749
VERSION     NM_001244539.1
KEYWORDS    RefSeq.
SOURCE      Sus scrofa (pig)
  ORGANISM  Sus scrofa
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Cetartiodactyla; Suina; Suidae;
            Sus.
REFERENCE   1  (bases 1 to 1237)
  AUTHORS   Amoozadeh Y, Dan Q, Anwer S, Huang HH, Barbieri V, Waheed F,
            Maishan M and Szaszi K.
  TITLE     Tumor Necrosis Factor-alpha Increases Claudin-1, 4, and 7
            Expression in Tubular Cells: Role in Permeability Changes
  JOURNAL   J. Cell. Physiol. 232 (8), 2210-2220 (2017)
   PUBMED   27966776
  REMARK    GeneRIF: Tumor necrosis factor-alpha increases claudin-1, 4, and 7
            expression in renal tubular cells, altering permeability and
            transepithelial electrical resistance.
REFERENCE   2  (bases 1 to 1237)
  AUTHORS   Uenishi H, Eguchi-Ogawa T, Shinkai H, Okumura N, Suzuki K, Toki D,
            Hamasima N and Awata T.
  TITLE     PEDE (Pig EST Data Explorer) has been expanded into Pig Expression
            Data Explorer, including 10 147 porcine full-length cDNA sequences
  JOURNAL   Nucleic Acids Res. 35 (DATABASE ISSUE), D650-D653 (2007)
   PUBMED   17145712
REFERENCE   3  (bases 1 to 1237)
  AUTHORS   Uenishi H, Eguchi T, Suzuki K, Sawazaki T, Toki D, Shinkai H,
            Okumura N, Hamasima N and Awata T.
  TITLE     PEDE (Pig EST Data Explorer): construction of a database for ESTs
            derived from porcine full-length cDNA libraries
  JOURNAL   Nucleic Acids Res. 32 (DATABASE ISSUE), D484-D488 (2004)
   PUBMED   14681463
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AK343301.1.
            On Sep 18, 2011 this sequence version replaced XM_003358749.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK343301.1, CN158684.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA1969400, SAMEA1969720
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1237              AK343301.1         1-1237
FEATURES             Location/Qualifiers
     source          1..1237
                     /organism="Sus scrofa"
                     /mol_type="mRNA"
                     /db_xref="taxon:9823"
                     /chromosome="13"
     gene            1..1237
                     /gene="CLDN1"
                     /gene_synonym="claudin1"
                     /note="claudin 1"
                     /db_xref="GeneID:100625166"
     misc_feature    216..218
                     /gene="CLDN1"
                     /gene_synonym="claudin1"
                     /note="upstream in-frame stop codon"
     CDS             228..863
                     /gene="CLDN1"
                     /gene_synonym="claudin1"
                     /note="claudin-1 protein"
                     /codon_start=1
                     /product="claudin-1"
                     /protein_id="NP_001231468.1"
                     /db_xref="GeneID:100625166"
                     /translation="
MANAGLQLLGFILAFLGWIGSIVSTALPQWKIYSYAGDNIVTAQAIYEGLWMSCVSQSTGQIQCKVFDSLLNLNTTLQATRALMVIGILLGLIAIFVATVGMKCMKCMEDDEVQKMRMAVIGGVIFLISGLAILVATAWYGNRIVQEFYDPMTPVNARYEFGQALFTGWAAASLCLLGGALLCCSCPRKTTSYPTPRPYPKPSPSSGKDYV"
     misc_feature    240..746
                     /gene="CLDN1"
                     /gene_synonym="claudin1"
                     /note="PMP-22/EMP/MP20/Claudin family; Region:
                     PMP22_Claudin; pfam00822"
                     /db_xref="CDD:250157"
ORIGIN      
gtggctccgcgtctcagtcccgacccgggagcagcagcagcagcttcttgcttctcaacttcagcgcccacccggccttagacctgcacccctcgcatctccagctgcggcgcagggagccgagctccgcgcagtaacttcctccgcgcggctcctccacccccgggagtcccgggtgcgcacctgcaaactccgccttgtgcacctgcggcccttgagccagagctatggccaacgcggggctgcagctgctgggcttcatcctggccttcctgggctggatcggctccatcgtcagcaccgcactgcctcagtggaagatttactcctacgctggtgacaacattgtgacggcccaggccatctacgaggggctgtggatgtcctgcgtgtcgcagagcaccgggcagatccagtgcaaagtcttcgactccttgctgaatctgaacaccactttgcaagcaacccgtgccttgatggtaattggcatcctgctgggactaatagccatctttgtggccactgttggcatgaagtgtatgaagtgcatggaagatgatgaggtgcagaagatgcggatggctgtcattgggggagtgatctttcttatttcaggtctggctatcttagttgccacagcatggtatggtaacagaattgttcaagaattctatgaccccatgaccccagtcaatgccagatatgaatttggtcaggctctcttcactggctgggctgctgcttctctctgccttctgggaggtgccctactttgctgctcctgcccccgaaaaacaacatcttacccaacaccaaggccctatccaaaaccttcgccttccagtgggaaagactacgtgtgacacagaatctaaaggacaaaaccgtgtgggaacaaccagaaaatggacattgaaatactgtcattgacactgagatcttcgacttttgactgttagagtctgaactgtggtataaccaaaaaaaacattattttttaaaatacccattgctaaaaatgacatggtcttattttatctcctttcctcaatacaggagggaagccattttcatgtgtattactgcttcccactgagtaatcatctcgaatgtggggagagggcggtccttaaatatatatagatatgtacatatacatgttttttctataaaaaattagtaaaagctcttattctctttatgttggcataagcatacttaaaatatacctaaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]