GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-01-25 18:29:44, GGRNA.v2 : RefSeq release 97 (Nov, 2019)

LOCUS       NM_001202869            4628 bp    mRNA    linear   PLN 14-FEB-2019
DEFINITION  Arabidopsis thaliana dicer-like 2 (DCL2), mRNA.
ACCESSION   NM_001202869
VERSION     NM_001202869.2
DBLINK      BioProject: PRJNA116
            BioSample: SAMN03081427
KEYWORDS    RefSeq.
SOURCE      Arabidopsis thaliana (thale cress)
  ORGANISM  Arabidopsis thaliana
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliophyta; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Brassicales; Brassicaceae;
            Camelineae; Arabidopsis.
REFERENCE   1  (bases 1 to 4628)
  AUTHORS   Salanoubat,M., Lemcke,K., Rieger,M., Ansorge,W., Unseld,M.,
            Fartmann,B., Valle,G., Blocker,H., Perez-Alonso,M., Obermaier,B.,
            Delseny,M., Boutry,M., Grivell,L.A., Mache,R., Puigdomenech,P., De
            Simone,V., Choisne,N., Artiguenave,F., Robert,C., Brottier,P.,
            Wincker,P., Cattolico,L., Weissenbach,J., Saurin,W., Quetier,F.,
            Schafer,M., Muller-Auer,S., Gabel,C., Fuchs,M., Benes,V.,
            Wurmbach,E., Drzonek,H., Erfle,H., Jordan,N., Bangert,S.,
            Wiedelmann,R., Kranz,H., Voss,H., Holland,R., Brandt,P.,
            Nyakatura,G., Vezzi,A., D'Angelo,M., Pallavicini,A., Toppo,S.,
            Simionati,B., Conrad,A., Hornischer,K., Kauer,G., Lohnert,T.H.,
            Nordsiek,G., Reichelt,J., Scharfe,M., Schon,O., Bargues,M.,
            Terol,J., Climent,J., Navarro,P., Collado,C., Perez-Perez,A.,
            Ottenwalder,B., Duchemin,D., Cooke,R., Laudie,M., Berger-Llauro,C.,
            Purnelle,B., Masuy,D., de Haan,M., Maarse,A.C., Alcaraz,J.P.,
            Cottet,A., Casacuberta,E., Monfort,A., Argiriou,A., flores,M.,
            Liguori,R., Vitale,D., Mannhaupt,G., Haase,D., Schoof,H., Rudd,S.,
            Zaccaria,P., Mewes,H.W., Mayer,K.F., Kaul,S., Town,C.D., Koo,H.L.,
            Tallon,L.J., Jenkins,J., Rooney,T., Rizzo,M., Walts,A.,
            Utterback,T., Fujii,C.Y., Shea,T.P., Creasy,T.H., Haas,B.,
            Maiti,R., Wu,D., Peterson,J., Van Aken,S., Pai,G., Militscher,J.,
            Sellers,P., Gill,J.E., Feldblyum,T.V., Preuss,D., Lin,X.,
            Nierman,W.C., Salzberg,S.L., White,O., Venter,J.C., Fraser,C.M.,
            Kaneko,T., Nakamura,Y., Sato,S., Kato,T., Asamizu,E., Sasamoto,S.,
            Kimura,T., Idesawa,K., Kawashima,K., Kishida,Y., Kiyokawa,C.,
            Kohara,M., Matsumoto,M., Matsuno,A., Muraki,A., Nakayama,S.,
            Nakazaki,N., Shinpo,S., Takeuchi,C., Wada,T., Watanabe,A.,
            Yamada,M., Yasuda,M. and Tabata,S.
  CONSRTM   European Union Chromosome 3 Arabidopsis Sequencing Consortium;
            Institute for Genomic Research; Kazusa DNA Research Institute
  TITLE     Sequence and analysis of chromosome 3 of the plant Arabidopsis
            thaliana
  JOURNAL   Nature 408 (6814), 820-822 (2000)
   PUBMED   11130713
REFERENCE   2  (bases 1 to 4628)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (14-FEB-2019) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 4628)
  AUTHORS   Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
            Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
            Vaughn,M. and Town,C.D.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute,
            9704 Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Protein update by submitter
REFERENCE   4  (bases 1 to 4628)
  AUTHORS   Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E.
  CONSRTM   TAIR
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2011) Department of Plant Biology, Carnegie
            Institution, 260 Panama Street, Stanford, CA, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by TAIR and Araport.
            This record is derived from an annotated genomic sequence
            (NC_003074).
            On Sep 12, 2016 this sequence version replaced NM_001202869.1.
FEATURES             Location/Qualifiers
     source          1..4628
                     /organism="Arabidopsis thaliana"
                     /mol_type="mRNA"
                     /db_xref="taxon:3702"
                     /chromosome="3"
                     /ecotype="Columbia"
     gene            1..4628
                     /gene="DCL2"
                     /locus_tag="AT3G03300"
                     /gene_synonym="ATDCL2; dicer-like 2; DICER-LIKE 2;
                     T17B22.28"
                     /note="Encodes a Dicer-like protein that functions in the
                     antiviral silencing response in turnip-crinkle
                     virus-infected plants but not in TMV or
                     CMV-strain-Y-infected plants. Involved in the production
                     of ta-siRNAs. Partially antagonizes the production of
                     miRNAs by DCL1. Substitutes for DCL4 to produce viral
                     siRNA when DCL4 is missing or inhibited. Able to produce
                     siRNAs but not miRNAs."
                     /db_xref="Araport:AT3G03300"
                     /db_xref="GeneID:821300"
                     /db_xref="TAIR:AT3G03300"
     CDS             322..4488
                     /gene="DCL2"
                     /locus_tag="AT3G03300"
                     /gene_synonym="ATDCL2; dicer-like 2; DICER-LIKE 2;
                     T17B22.28"
                     /note="dicer-like 2 (DCL2); FUNCTIONS IN: in 7 functions;
                     INVOLVED IN: defense response to virus, maintenance of DNA
                     methylation, production of ta-siRNAs involved in RNA
                     interference; LOCATED IN: intracellular; EXPRESSED IN: 22
                     plant structures; EXPRESSED DURING: 13 growth stages;
                     CONTAINS InterPro DOMAIN/s: DNA/RNA helicase, DEAD/DEAH
                     box type, N-terminal (InterPro:IPR011545), Double-stranded
                     RNA-binding (InterPro:IPR001159), Argonaute/Dicer protein,
                     PAZ (InterPro:IPR003100), Ribonuclease III
                     (InterPro:IPR000999), DEAD-like helicase, N-terminal
                     (InterPro:IPR014001), DNA/RNA helicase, C-terminal
                     (InterPro:IPR001650), Dicer double-stranded RNA-binding
                     fold (InterPro:IPR005034), Helicase, superfamily 1/2,
                     ATP-binding domain (InterPro:IPR014021); BEST Arabidopsis
                     thaliana protein match is: dicer-like 4
                     (TAIR:AT5G20320.1)."
                     /codon_start=1
                     /product="dicer-like 2"
                     /protein_id="NP_001189798.1"
                     /db_xref="GeneID:821300"
                     /db_xref="TAIR:AT3G03300"
                     /db_xref="Araport:AT3G03300"
                     /translation="
MTMDADAMETETTDQVSASPLHFARSYQVEALEKAIKQNTIVFLETGSGKTLIAIMLLRSYAYLFRKPSPCFCVFLVPQVVLVTQQAEALKMHTDLKVGMYWGDMGVDFWDSSTWKQEVDKYEVLVMTPAILLDALRHSFLSLSMIKVLIVDECHHAGGKHPYACIMREFYHKELNSGTSNVPRIFGMTASLVKTKGENLDSYWKKIHELETLMNSKVYTCENESVLAGFVPFSTPSFKYYQHIKIPSPKRASLVEKLERLTIKHRLSLGTLDLNSSTVDSVEKRLLRISSTLTYCLDDLGILLAQKAAQSLSASQNDSFLWGELNMFSVALVKKFCSDASQEFLAEIPQGLNWSVANINGNAEAGLLTLKTVCLIETLLGYSSLENIRCIIFVDRVITAIVLESLLAEILPNCNNWKTKYVAGNNSGLQNQTRKKQNEIVEDFRRGLVNIIVATSILEEGLDVQSCNLVIRFDPASNICSFIQSRGRARMQNSDYLMMVESGDLLTQSRLMKYLSGGKRMREESLDHSLVPCPPLPDDSDEPLFRVESTGATVTLSSSVSLIYHYCSRLPSDEYFKPAPRFDVNKDQGSCTLYLPKSCPVKEVKAEANNKVLKQAVCLKACIQLHKVGALSDHLVPDMVVAETVSQKLEKIQYNTEQPCYFPPELVSQFSAQPETTYHFYLIRMKPNSPRNFHLNDVLLGTRVVLEDDIGNTSFRLEDHRGTIAVTLSYVGAFHLTQEEVLFCRRFQITLFRVLLDHSVENLMEALNGLHLRDGVALDYLLVPSTHSHETSLIDWEVIRSVNLTSHEVLEKHENCSTNGASRILHTKDGLFCTCVVQNALVYTPHNGYVYCTKGVLNNLNGNSLLTKRNSGDQTYIEYYEERHGIQLNFVDEPLLNGRHIFTLHSYLHMAKKKKEKEHDREFVELPPELCHVILSPISVDMIYSYTFIPSVMQRIESLLIAYNLKKSIPKVNIPTIKVLEAITTKKCEDQFHLESLETLGDSFLKYAVCQQLFQHCHTHHEGLLSTKKDGMISNVMLCQFGCQQKLQGFIRDECFEPKGWMVPGQSSAAYSLVNDTLPESRNIYVASRRNLKRKSVADVVESLIGAYLSEGGELAALMFMNWVGIKVDFTTTKIQRDSPIQAEKLVNVGYMESLLNYSFEDKSLLVEALTHGSYMMPEIPRCYQRLEFLGDSVLDYLITKHLYDKYPCLSPGLLTDMRSASVNNECYALVAVKANLHKHILYASHHLHKHISRTVSEFEQSSLQSTFGWESDISFPKVLGDVIESLAGAIFVDSGYNKEVVFASIKPLLGCMITPETVKLHPVRELTELCQKWQFELSKAKDFDSFTVEVKAKEMSFAHTAKASDKKMAKKLAYKEVLNLLKNSLDY"
     misc_feature    433..897
                     /gene="DCL2"
                     /locus_tag="AT3G03300"
                     /gene_synonym="ATDCL2; dicer-like 2; DICER-LIKE 2;
                     T17B22.28"
                     /note="DEAD-like helicases superfamily. A diverse family
                     of proteins involved in ATP-dependent RNA or DNA
                     unwinding. This domain contains the ATP-binding region;
                     Region: DEXDc; cd00046"
                     /db_xref="CDD:238005"
     misc_feature    460..474
                     /gene="DCL2"
                     /locus_tag="AT3G03300"
                     /gene_synonym="ATDCL2; dicer-like 2; DICER-LIKE 2;
                     T17B22.28"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:238005"
     misc_feature    775..786
                     /gene="DCL2"
                     /locus_tag="AT3G03300"
                     /gene_synonym="ATDCL2; dicer-like 2; DICER-LIKE 2;
                     T17B22.28"
                     /note="putative Mg++ binding site [ion binding]; other
                     site"
                     /db_xref="CDD:238005"
     misc_feature    1465..1788
                     /gene="DCL2"
                     /locus_tag="AT3G03300"
                     /gene_synonym="ATDCL2; dicer-like 2; DICER-LIKE 2;
                     T17B22.28"
                     /note="Helicase conserved C-terminal domain; Region:
                     Helicase_C; pfam00271"
                     /db_xref="CDD:278689"
     misc_feature    order(1504..1515,1588..1593,1684..1692)
                     /gene="DCL2"
                     /locus_tag="AT3G03300"
                     /gene_synonym="ATDCL2; dicer-like 2; DICER-LIKE 2;
                     T17B22.28"
                     /note="nucleotide binding region [chemical binding]; other
                     site"
                     /db_xref="CDD:238034"
     misc_feature    1999..2232
                     /gene="DCL2"
                     /locus_tag="AT3G03300"
                     /gene_synonym="ATDCL2; dicer-like 2; DICER-LIKE 2;
                     T17B22.28"
                     /note="Dicer dimerization domain; Region: Dicer_dimer;
                     pfam03368"
                     /db_xref="CDD:281376"
     misc_feature    2740..3132
                     /gene="DCL2"
                     /locus_tag="AT3G03300"
                     /gene_synonym="ATDCL2; dicer-like 2; DICER-LIKE 2;
                     T17B22.28"
                     /note="PAZ domain, CAF_like subfamily. CAF (for carpel
                     factory) is a plant homolog of Dicer. CAF has been
                     implicated in flower morphogenesis and in early
                     Arabidopsis development and might function through
                     posttranscriptional regulation of specific mRNA...;
                     Region: PAZ_CAF_like; cd02844"
                     /db_xref="CDD:239210"
     misc_feature    order(2872..2874,2947..2949,2959..2961,3013..3015,
                     3091..3093,3097..3099)
                     /gene="DCL2"
                     /locus_tag="AT3G03300"
                     /gene_synonym="ATDCL2; dicer-like 2; DICER-LIKE 2;
                     T17B22.28"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239210"
     misc_feature    3259..3690
                     /gene="DCL2"
                     /locus_tag="AT3G03300"
                     /gene_synonym="ATDCL2; dicer-like 2; DICER-LIKE 2;
                     T17B22.28"
                     /note="RIBOc. Ribonuclease III C terminal domain. This
                     group consists of eukaryotic, bacterial and archeal
                     ribonuclease III (RNAse III) proteins. RNAse III is a
                     double stranded RNA-specific endonuclease. Prokaryotic
                     RNAse III is important in...; Region: RIBOc; cd00593"
                     /db_xref="CDD:238333"
     misc_feature    order(3304..3309,3316..3321,3328..3330,3337..3342,
                     3349..3354,3358..3366,3394..3396,3646..3648,3673..3675)
                     /gene="DCL2"
                     /locus_tag="AT3G03300"
                     /gene_synonym="ATDCL2; dicer-like 2; DICER-LIKE 2;
                     T17B22.28"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238333"
     misc_feature    order(3304..3306,3313..3315,3325..3327,3616..3618,
                     3625..3627)
                     /gene="DCL2"
                     /locus_tag="AT3G03300"
                     /gene_synonym="ATDCL2; dicer-like 2; DICER-LIKE 2;
                     T17B22.28"
                     /note="active site"
                     /db_xref="CDD:238333"
     misc_feature    order(3313..3315,3616..3618,3625..3627)
                     /gene="DCL2"
                     /locus_tag="AT3G03300"
                     /gene_synonym="ATDCL2; dicer-like 2; DICER-LIKE 2;
                     T17B22.28"
                     /note="metal binding site [ion binding]; metal-binding
                     site"
                     /db_xref="CDD:238333"
     misc_feature    3772..4473
                     /gene="DCL2"
                     /locus_tag="AT3G03300"
                     /gene_synonym="ATDCL2; dicer-like 2; DICER-LIKE 2;
                     T17B22.28"
                     /note="dsRNA-specific ribonuclease [Transcription];
                     Region: Rnc; COG0571"
                     /db_xref="CDD:223644"
     misc_feature    3811..4275
                     /gene="DCL2"
                     /locus_tag="AT3G03300"
                     /gene_synonym="ATDCL2; dicer-like 2; DICER-LIKE 2;
                     T17B22.28"
                     /note="RIBOc. Ribonuclease III C terminal domain. This
                     group consists of eukaryotic, bacterial and archeal
                     ribonuclease III (RNAse III) proteins. RNAse III is a
                     double stranded RNA-specific endonuclease. Prokaryotic
                     RNAse III is important in...; Region: RIBOc; cd00593"
                     /db_xref="CDD:238333"
     misc_feature    order(3874..3879,3886..3891,3898..3900,3907..3912,
                     3919..3924,3928..3936,3964..3966,4195..4197,4228..4230)
                     /gene="DCL2"
                     /locus_tag="AT3G03300"
                     /gene_synonym="ATDCL2; dicer-like 2; DICER-LIKE 2;
                     T17B22.28"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238333"
     misc_feature    order(3874..3876,3883..3885,3895..3897,4165..4167,
                     4174..4176)
                     /gene="DCL2"
                     /locus_tag="AT3G03300"
                     /gene_synonym="ATDCL2; dicer-like 2; DICER-LIKE 2;
                     T17B22.28"
                     /note="active site"
                     /db_xref="CDD:238333"
     misc_feature    order(3883..3885,4165..4167,4174..4176)
                     /gene="DCL2"
                     /locus_tag="AT3G03300"
                     /gene_synonym="ATDCL2; dicer-like 2; DICER-LIKE 2;
                     T17B22.28"
                     /note="metal binding site [ion binding]; metal-binding
                     site"
                     /db_xref="CDD:238333"
     misc_feature    order(4285..4287,4303..4308,4414..4425,4432..4434)
                     /gene="DCL2"
                     /locus_tag="AT3G03300"
                     /gene_synonym="ATDCL2; dicer-like 2; DICER-LIKE 2;
                     T17B22.28"
                     /note="dsRNA binding site [nucleotide binding]; other
                     site"
                     /db_xref="CDD:238007"
     misc_feature    4288..4470
                     /gene="DCL2"
                     /locus_tag="AT3G03300"
                     /gene_synonym="ATDCL2; dicer-like 2; DICER-LIKE 2;
                     T17B22.28"
                     /note="Double-stranded RNA binding motif; Region: DSRM;
                     smart00358"
                     /db_xref="CDD:214634"
ORIGIN      
gcgaaagcttctgtcatagtctcacagtcacaacaaaacagtcaatcccccaaagaattatggtagcagtcaataatcccataaataatcttcttcaacagtttttttctcttaaatttttgtttcgaaaaccgctcactacttcttaatcgaaatgactgactgagagctttagcttttgatcgttcgtcttcgtgattcctttcttcttcttctctccgctactgtctgtacctgaaactactgtcctcgatcgctgctttgtctttcgagattaaaaagttaggtttttttttcgtaaatctactgtatatgttttagatgaccatggatgctgatgcgatggaaactgagaccactgatcaagtctctgcttctcctctacattttgccagaagttatcaggtagaggcacttgagaaagctatcaagcagaacactattgtcttcttggagactggttctggcaagacccttattgctattatgcttcttcgtagctatgcctaccttttccgcaagccttcaccatgcttctgtgtcttcttggttcctcaagtggttcttgtcactcagcaagcagaagccctgaagatgcatactgatctaaaagttggtatgtattggggagacatgggggtggacttttgggattcttcaacatggaaacaagaagttgataaatatgaggttctggtgatgacccctgccattttgctcgacgcgttgaggcatagttttctgagcttgagcatgatcaaggttctaatagttgatgagtgtcatcatgcagggggaaagcacccttatgcttgtatcatgagggagttctatcataaggagttaaattctggaacttccaatgttccacggatatttgggatgactgcttcacttgtgaaaacaaagggtgaaaatctggatagctactggaaaaaaattcatgaactcgaaactctaatgaattcaaaggtctatacctgtgagaatgagtctgtgctggctgggtttgtccccttttctacaccaagcttcaagtattaccagcacataaaaataccaagtcccaaacgagcaagcttggtagagaagctagaaagactaacgataaagcatcgcttatcccttggaaccttggatctcaactcctctactgttgattctgtagagaagagactgttgaggataagttcaactctaacatattgtttggatgatctcggaattttgctggcccagaaggctgctcagtcattgtcagccagtcagaatgactctttcttgtggggcgaactaaatatgtttagcgtggccttggtaaaaaaattctgctctgatgcttcacaggagtttttggctgagatacctcaaggtcttaattggagtgttgcaaacataaatggaaatgcggaggcaggtctcctaactttaaaaactgtctgcctcattgagactcttcttggttatagctccttggagaacatacggtgcatcatttttgtggatagggtgataacagccatcgttctggaatcccttttggctgagattcttccaaactgtaataactggaaaaccaagtacgttgcaggaaataactctggtctgcaaaatcaaactcggaagaagcaaaatgaaattgtggaagacttccggagaggcttggttaacatcattgtagcaacatctattctagaggagggtctagatgttcaaagttgcaacctggttatcagatttgaccctgcatccaacatttgcagtttcatacagtctcgtgggcgtgctagaatgcaaaattcagattatttgatgatggtggaaagcggagatctgttaacacaatctcgattaatgaaatatctttctggtgggaaaagaatgcgcgaagagtctttggatcattctcttgttccctgtccacctcttccagatgattcagatgaaccactcttccgtgtcgaaagtactggagcaactgtaactcttagctcaagcgtcagcttaatatatcattactgctcaaggcttccttcagatgagtacttcaaaccagcccctagatttgatgtaaacaaggatcaggggagttgcaccctttaccttcctaagagttgcccagtaaaagaagttaaagctgaagcaaataataaagtgttaaaacaagctgtctgtcttaaagcttgcattcaactgcacaaagttggagctctaagtgatcatcttgtgcctgacatggttgtggcggaaactgtctcacaaaaactcgagaaaatccaatataacacagagcagccatgttacttccccccagagctagtctcccagttttcagcacagccggagacaacataccacttctacttaataagaatgaagccaaactctccaagaaattttcatttaaacgatgttttactaggcaccagagttgtgcttgaagatgacattgggaacacaagcttccggttggaagatcataggggtacaatagctgtgacattgagttatgtgggagcttttcaccttacacaagaagaggtccttttctgtagaagatttcagataactctattccgagttcttttagatcacagtgtggaaaatttgatggaggcattgaatggattgcatctcagagatggggtggcacttgattatctactagttccatccactcattcacatgaaacatctcttattgattgggaagtgatcagatccgtgaatctaacttctcatgaggttttggaaaaacacgaaaattgttctaccaacggtgcttctcgcattctacacacaaaagacggcttgttttgtacttgtgtcgtacaaaatgcattggtttacacaccacataatggatacgtctactgcacaaaaggtgttctcaacaatctaaacggaaattcattattgaccaagagaaattctggcgatcagacttacattgagtactacgaggaaaggcatgggattcaattaaattttgtggatgaacctcttctaaatggaagacacattttcacgttgcatagttatcttcacatggccaagaagaagaaggagaaagagcatgacagggaatttgttgaactacctcctgagctttgtcatgtcattttgtccccaatatcagttgatatgatctattcatatacttttatcccatctgttatgcaacgcattgaatctttgcttatagcatacaacctgaagaaaagcatcccaaaagtcaatattccaaccattaaggttttggaagctattacgacaaagaagtgcgaagatcagttccacttggaatcactagaaactcttggtgactcttttctgaaatatgctgtttgtcagcaactattccaacactgtcatactcaccatgagggtcttcttagcacgaagaaagatggaatgatttcaaatgtcatgctctgccaatttggatgtcagcagaaacttcagggatttatccgcgatgagtgttttgaacccaaaggttggatggttccaggtcaatcatctgcagcttattcacttgtaaacgatactctacccgagtctagaaacatatacgttgctagtaggaggaatctgaaacgcaagagtgtggccgatgttgtagaatcattaattggagcatatctcagcgagggaggtgaacttgcagctttgatgttcatgaattgggttggaataaaggtcgactttacaactacgaagatccagagagattccccaatacaagcagagaagcttgtgaatgtaggttatatggagtcgctgttgaattacagttttgaggataagtctcttctagttgaagcattgactcatggttcatacatgatgcctgaaattccaagatgctatcagcggttggagttcctcggtgactctgtattggattatctcataaccaagcatctatacgacaaatatccttgtctgtcccctggactattaaccgacatgcgatcagcttctgttaacaatgaatgttatgccctagtggcggtgaaagcaaacctgcacaaacacatcctgtacgcctctcatcatctccataagcacatctctagaactgtcagtgagtttgaacagtcttctttgcaatccactttcggatgggaatccgatatatcttttccaaaggttcttggagatgtgatagaatctctagcaggcgcgatatttgttgactcaggttacaacaaggaagtagtgtttgcaagtattaaaccacttttgggttgtatgataactccagagactgtcaagttgcatcctgtgagagagttgacagaattatgtcagaagtggcagttcgagttgagtaaagctaaagatttcgattctttcacggttgaggtgaaagctaaggagatgagttttgctcacacagcaaaggcctctgataagaaaatggccaagaaattggcttacaaagaagtcttgaacttacttaagaacagcctggactactaaatttctttttcttgtcaactttattgcattcattcatgataataattgtcttagataacttacattactcttgattaatatttgataaatttatttattttttgtttctttcttctctccattgtgaattatttaataac
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]