GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-01-25 18:18:30, GGRNA.v2 : RefSeq release 97 (Nov, 2019)

LOCUS       NM_001202684            3189 bp    mRNA    linear   PLN 14-FEB-2019
DEFINITION  Arabidopsis thaliana Argonaute family protein (AGO4), mRNA.
ACCESSION   NM_001202684
VERSION     NM_001202684.1
DBLINK      BioProject: PRJNA116
            BioSample: SAMN03081427
KEYWORDS    RefSeq.
SOURCE      Arabidopsis thaliana (thale cress)
  ORGANISM  Arabidopsis thaliana
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliophyta; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Brassicales; Brassicaceae;
            Camelineae; Arabidopsis.
REFERENCE   1  (bases 1 to 3189)
  AUTHORS   Lin,X., Kaul,S., Rounsley,S., Shea,T.P., Benito,M.I., Town,C.D.,
            Fujii,C.Y., Mason,T., Bowman,C.L., Barnstead,M., Feldblyum,T.V.,
            Buell,C.R., Ketchum,K.A., Lee,J., Ronning,C.M., Koo,H.L.,
            Moffat,K.S., Cronin,L.A., Shen,M., Pai,G., Van Aken,S., Umayam,L.,
            Tallon,L.J., Gill,J.E., Adams,M.D., Carrera,A.J., Creasy,T.H.,
            Goodman,H.M., Somerville,C.R., Copenhaver,G.P., Preuss,D.,
            Nierman,W.C., White,O., Eisen,J.A., Salzberg,S.L., Fraser,C.M. and
            Venter,J.C.
  TITLE     Sequence and analysis of chromosome 2 of the plant Arabidopsis
            thaliana
  JOURNAL   Nature 402 (6763), 761-768 (1999)
   PUBMED   10617197
REFERENCE   2  (bases 1 to 3189)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (14-FEB-2019) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 3189)
  AUTHORS   Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
            Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
            Vaughn,M. and Town,C.D.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute,
            9704 Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Protein update by submitter
REFERENCE   4  (bases 1 to 3189)
  AUTHORS   Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E.
  CONSRTM   TAIR
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2011) Department of Plant Biology, Carnegie
            Institution, 260 Panama Street, Stanford, CA, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by TAIR and Araport.
            This record is derived from an annotated genomic sequence
            (NC_003071).
FEATURES             Location/Qualifiers
     source          1..3189
                     /organism="Arabidopsis thaliana"
                     /mol_type="mRNA"
                     /db_xref="taxon:3702"
                     /chromosome="2"
                     /ecotype="Columbia"
     gene            1..3189
                     /gene="AGO4"
                     /locus_tag="AT2G27040"
                     /gene_synonym="ARGONAUTE 4; OCP11; OVEREXPRESSOR OF
                     CATIONIC PEROXIDASE 11; T20P8.9; T20P8_9"
                     /note="AGO4 is a member of a class of PAZ/PIWI domain
                     containing proteins involved in siRNA mediated gene
                     silencing.Loss of function mutations have reduced site
                     specific CpNpG and CpHpH methylation and increased
                     susceptibility to bacterial pathogens."
                     /db_xref="Araport:AT2G27040"
                     /db_xref="GeneID:817246"
                     /db_xref="TAIR:AT2G27040"
     CDS             154..2928
                     /gene="AGO4"
                     /locus_tag="AT2G27040"
                     /gene_synonym="ARGONAUTE 4; OCP11; OVEREXPRESSOR OF
                     CATIONIC PEROXIDASE 11; T20P8.9; T20P8_9"
                     /note="ARGONAUTE 4 (AGO4); CONTAINS InterPro DOMAIN/s:
                     Domain of unknown function DUF1785 (InterPro:IPR014811),
                     Stem cell self-renewal protein Piwi (InterPro:IPR003165),
                     Argonaute/Dicer protein, PAZ (InterPro:IPR003100),
                     Polynucleotidyl transferase, ribonuclease H fold
                     (InterPro:IPR012337); BEST Arabidopsis thaliana protein
                     match is: Argonaute family protein (TAIR:AT5G21150.1)."
                     /codon_start=1
                     /product="Argonaute family protein"
                     /protein_id="NP_001189613.1"
                     /db_xref="Araport:AT2G27040"
                     /db_xref="GeneID:817246"
                     /db_xref="TAIR:AT2G27040"
                     /translation="
MDSTNGNGADLESANGANGSGVTEALPPPPPVIPPNVEPVRVKTELAEKKGPVRVPMARKGFGTRGQKIPLLTNHFKVDVANLQGHFFHYSVALFYDDGRPVEQKGVGRKILDKVHQTYHSDLDGKEFAYDGEKTLFTYGALPSNKMDFSVVLEEVSATRANGNGSPNGNESPSDGDRKRLRRPNRSKNFRVEISYAAKIPLQALANAMRGQESENSQEAIRVLDIILRQHAARQGCLLVRQSFFHNDPTNCEPVGGNILGCRGFHSSFRTTQGGMSLNMDVTTTMIIKPGPVVDFLIANQNARDPYSIDWSKAKRTLKNLRVKVSPSGQEFKITGLSDKPCREQTFELKKRNPNENGEFETTEVTVADYFRDTRHIDLQYSADLPCINVGKPKRPTYIPLELCALVPLQRYTKALTTFQRSALVEKSRQKPQERMTVLSKALKVSNYDAEPLLRSCGISISSNFTQVEGRVLPAPKLKMGCGSETFPRNGRWNFNNKEFVEPTKIQRWVVVNFSARCNVRQVVDDLIKIGGSKGIEIASPFQVFEEGNQFRRAPPMIRVENMFKDIQSKLPGVPQFILCVLPDKKNSDLYGPWKKKNLTEFGIVTQCMAPTRQPNDQYLTNLLLKINAKLGGLNSMLSVERTPAFTVISKVPTIILGMDVSHGSPGQSDVPSIAAVVSSREWPLISKYRASVRTQPSKAEMIESLVKKNGTEDDGIIKELLVDFYTSSNKRKPEHIIIFRDGVSESQFNQVLNIELDQIIEACKLLDANWNPKFLLLVAQKNHHTKFFQPTSPENVPPGTIIDNKICHPKNNDFYLCAHAGMIGTTRPTHYHVLYDEIGFSADELQELVHSLSYVYQRSTSAISVVAPICYAHLAAAQLGTFMKFEDQSETSSSHGGITAPGPISVAQLPRLKDNVANSMFFC"
     misc_feature    286..2925
                     /gene="AGO4"
                     /locus_tag="AT2G27040"
                     /gene_synonym="ARGONAUTE 4; OCP11; OVEREXPRESSOR OF
                     CATIONIC PEROXIDASE 11; T20P8.9; T20P8_9"
                     /note="protein argonaute; Provisional; Region: PLN03202"
                     /db_xref="CDD:215631"
     misc_feature    328..837
                     /gene="AGO4"
                     /locus_tag="AT2G27040"
                     /gene_synonym="ARGONAUTE 4; OCP11; OVEREXPRESSOR OF
                     CATIONIC PEROXIDASE 11; T20P8.9; T20P8_9"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:293095"
     misc_feature    871..1020
                     /gene="AGO4"
                     /locus_tag="AT2G27040"
                     /gene_synonym="ARGONAUTE 4; OCP11; OVEREXPRESSOR OF
                     CATIONIC PEROXIDASE 11; T20P8.9; T20P8_9"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:285861"
     misc_feature    1069..1419
                     /gene="AGO4"
                     /locus_tag="AT2G27040"
                     /gene_synonym="ARGONAUTE 4; OCP11; OVEREXPRESSOR OF
                     CATIONIC PEROXIDASE 11; T20P8.9; T20P8_9"
                     /note="PAZ domain; Region: PAZ; pfam02170"
                     /db_xref="CDD:280352"
     misc_feature    order(1147..1149,1192..1194,1252..1254,1264..1266,
                     1321..1323,1342..1344,1348..1350)
                     /gene="AGO4"
                     /locus_tag="AT2G27040"
                     /gene_synonym="ARGONAUTE 4; OCP11; OVEREXPRESSOR OF
                     CATIONIC PEROXIDASE 11; T20P8.9; T20P8_9"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1507..2790
                     /gene="AGO4"
                     /locus_tag="AT2G27040"
                     /gene_synonym="ARGONAUTE 4; OCP11; OVEREXPRESSOR OF
                     CATIONIC PEROXIDASE 11; T20P8.9; T20P8_9"
                     /note="Piwi_ago-like: PIWI domain, Argonaute-like
                     subfamily. Argonaute is the central component of the
                     RNA-induced silencing complex (RISC) and related
                     complexes. The PIWI domain is the C-terminal portion of
                     Argonaute and consists of two subdomains, one of...;
                     Region: Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1924..1926,1936..1938,1972..1983,2008..2010,
                     2017..2019,2029..2031,2041..2043)
                     /gene="AGO4"
                     /locus_tag="AT2G27040"
                     /gene_synonym="ARGONAUTE 4; OCP11; OVEREXPRESSOR OF
                     CATIONIC PEROXIDASE 11; T20P8.9; T20P8_9"
                     /note="5' RNA guide strand anchoring site; other site"
                     /db_xref="CDD:240015"
     misc_feature    order(2131..2133,2137..2139,2377..2379,2773..2775)
                     /gene="AGO4"
                     /locus_tag="AT2G27040"
                     /gene_synonym="ARGONAUTE 4; OCP11; OVEREXPRESSOR OF
                     CATIONIC PEROXIDASE 11; T20P8.9; T20P8_9"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
tctcaggtcggagctaaattttgagagtaaaataaaaaagcaaaagagagaaattgaaaaaaaaagaaagaaaaataatcctctcttgtttcggctagggtttcgtttttgtttcatcgataaactcaaaggtgatgattttagggtcttgagatggattcaacaaatggtaacggagctgatcttgaatcagcaaatggggcaaacgggagtggggttactgaggcattaccacctcctccaccagttatacctccaaatgtggaaccagttcgtgttaaaactgaacttgctgagaagaaggggccagttcgagttcctatggctcgaaaaggatttggaacaaggggccaaaagatccccttgttaacaaatcatttcaaagtcgatgtggctaatcttcagggtcatttcttccactacagtgtggctctattctatgatgatggtcgtcctgttgaacaaaagggtgttggaagaaaaatccttgacaaggtgcatcagacttaccattctgatctggatggtaaagagtttgcttatgacggtgagaagacgttgtttacatatggagctttgcctagtaacaagatggatttttctgtggtgcttgaggaagtatctgctacaagggctaatggaaacggaagccccaatgggaatgaaagtccaagtgatggtgataggaaaagactgcgtaggcctaaccggtccaaaaactttagagtggagatcagctatgcggccaaaattcctcttcaagctcttgctaatgcaatgcggggacaagaatcagagaattcccaggaggcaatacgggttcttgatatcatattgaggcaacatgctgctagacaaggttgcttgcttgttcgacagtcttttttccacaatgatccaaccaactgtgaaccagttggtggtaacatcttaggatgtaggggatttcactccagtttcagaacaacgcagggtggcatgtcacttaatatggatgttacaaccaccatgatcatcaagcctggtccagtggttgatttcctaattgctaaccaaaatgctagggacccttattcgattgactggtctaaggctaaacgaacccttaagaacctaagggtaaaggtcagcccctcaggccaagaattcaagataaccggattgagtgacaagccttgcagggaacaaacgtttgaattgaagaaaaggaacccaaatgaaaatggagagttcgaaactactgaagttacagttgctgactacttccgcgatacaaggcatattgatttgcaatattctgcggatttgccttgcatcaatgttgggaagccaaagcgacccacttacattcctctcgagctctgcgcgttggttccacttcagaggtacacaaaagcacttaccacgttccaaagatctgcccttgttgagaaatccagacagaaaccccaagagaggatgactgttctgtccaaagctctgaaagttagcaactatgatgcggaaccactcctgcgatcctgtggcatttcgatcagctccaactttactcaggtggagggtcgtgttctaccagctcccaagctgaaaatgggatgtggatctgaaacctttcccagaaatggtcgctggaacttcaacaacaaggaatttgttgagcccaccaaaattcaacgatgggttgttgtcaatttctctgctcgctgtaatgtacgtcaagttgttgatgatctgataaaaattggaggatcaaaaggaattgaaattgcttctccctttcaagtgtttgaggagggtaatcaattccgccgtgctcctcctatgattcgtgttgagaacatgtttaaggacatccaatcgaaactccctggtgtcccacaattcatactatgtgtgctccctgacaaaaagaacagtgatctctatggtccatggaagaaaaaaaacttaactgaatttggcattgttactcaatgcatggctccaacgcggcaacctaatgatcagtatcttactaacttacttctgaagattaatgcaaagcttggaggcctgaactcaatgttaagtgtagagcgtacacctgcgttcactgtgatttctaaggttccaaccattatccttgggatggatgtttcacatggatctcctggacagtctgatgtcccgtccatcgctgctgtggtgagttctagggagtggccactgatatccaaatatagagcatctgttcggacacagccttctaaggctgagatgattgagtcccttgtcaagaaaaatggaactgaagacgatggcattatcaaggagttgctggtagatttctacaccagctcgaataagagaaaaccagagcatatcataattttcagggatggtgtgagtgaatctcaattcaatcaggttctgaatattgaacttgatcagatcatcgaggcttgcaagctcttagacgcaaattggaacccaaagttccttttgttggtggctcaaaagaatcatcataccaagttcttccagccaacgtctcctgaaaatgttcctccagggacaatcattgacaacaaaatatgtcacccaaagaacaatgatttctacctctgtgctcacgctggaatgattggaactacccgcccaactcactaccacgtcctgtatgatgagattggtttttcagctgacgaacttcaggaacttgtccactcgctctcctatgtgtaccaaagaagcaccagtgccatttctgttgttgcgccgatctgctatgctcacttggcagctgctcagcttgggacgttcatgaagtttgaagatcagtctgagacatcatcaagccatggtggtatcacagctccaggaccaatctctgttgcacagctcccaagactcaaagacaacgtcgccaactccatgttcttctgttaaatgagcagccctacttggctcagtaagtaagtagtagttcaataggctatctgactttcagcttaggatctctctcggccttgaagccaggcatcgacactaaggcttggaatgttttttgtgactattatcgccagccttgtttgcctgttggggtttgaatatgcttttgtcccccttaacaattcggttgtttaattaaagacttattgtagtgaatatctaagttcaggaagttacccttttgtctaaatcgttctt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]