GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-07 23:17:50, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NM_001194562            1062 bp    mRNA    linear   PRI 21-DEC-2019
DEFINITION  Macaca mulatta claudin 3 (CLDN3), mRNA.
ACCESSION   NM_001194562 XM_001112442
VERSION     NM_001194562.2
KEYWORDS    RefSeq.
SOURCE      Macaca mulatta (Rhesus monkey)
  ORGANISM  Macaca mulatta
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Cercopithecidae; Cercopithecinae; Macaca.
REFERENCE   1  (bases 1 to 1062)
  AUTHORS   Zimin AV, Cornish AS, Maudhoo MD, Gibbs RM, Zhang X, Pandey S,
            Meehan DT, Wipfler K, Bosinger SE, Johnson ZP, Tharp GK, Marcais G,
            Roberts M, Ferguson B, Fox HS, Treangen T, Salzberg SL, Yorke JA
            and Norgren RB Jr.
  TITLE     A new rhesus macaque assembly and annotation for next-generation
            sequencing analyses
  JOURNAL   Biol. Direct 9 (1), 20 (2014)
   PUBMED   25319552
  REMARK    Publication Status: Online-Only
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from
            QNVO02000311.1.
            On Dec 18, 2019 this sequence version replaced NM_001194562.1.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            ##Evidence-Data-START##
            Transcript is intronless :: JV635963.1, SRR5038768.208010.1
                                        [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1062              QNVO02000311.1     484560-485621
FEATURES             Location/Qualifiers
     source          1..1062
                     /organism="Macaca mulatta"
                     /mol_type="mRNA"
                     /db_xref="taxon:9544"
                     /chromosome="3"
                     /map="3"
     gene            1..1062
                     /gene="CLDN3"
                     /gene_synonym="claudin-3"
                     /note="claudin 3"
                     /db_xref="GeneID:716771"
                     /db_xref="VGNC:VGNC:71250"
     exon            1..1062
                     /gene="CLDN3"
                     /gene_synonym="claudin-3"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    118..120
                     /gene="CLDN3"
                     /gene_synonym="claudin-3"
                     /note="upstream in-frame stop codon"
     CDS             379..1041
                     /gene="CLDN3"
                     /gene_synonym="claudin-3"
                     /codon_start=1
                     /product="claudin-3"
                     /protein_id="NP_001181491.1"
                     /db_xref="GeneID:716771"
                     /db_xref="VGNC:VGNC:71250"
                     /translation="
MSMGLEITGTALAVLGWLGTIVCCALPMWRVTAFIGSNIITSQTIWEGLWMNCVVQSTGQMQCKVYDSLLALPQDLQAARALIVVAILLAAFGLLVALVGAQCTNCVQDDTAKAKITIVAGVLFLLAALLTLVPVSWSANTIIREFYNPVVPEAQKREMGTSLYVGWAAAALQLLGGALLCCSCPPREKKYMPTKVVYSAPRSTGPGASMGTAYDRKDYV"
     misc_feature    385..879
                     /gene="CLDN3"
                     /gene_synonym="claudin-3"
                     /note="PMP-22/EMP/MP20/Claudin family; Region:
                     PMP22_Claudin; cl21598"
                     /db_xref="CDD:328820"
ORIGIN      
gtccttcctcccagaacgctcggtgaaggtgggaggcaggggccacgtcactgtccccaggccctggagagcgctgctccgcccctcccgcccccaacggagcgctgggcacttagctaagacgcaccggccccagcccagggccagcccagtcgccgccgcccgcccgcaaagccacaggcaggtgcaggcgcagcctcggcgcgagtgtgtggagccgagccgttagcgcgcgccgtcggtgagtcagtccgtccgtccgtccgtccgtccgtctgtccgtcggggcgccgcagctcccaccaggcccagcggccccggcccctcgtctccccgcacccggagccacccggtggagtgggctttgccgcggcagccatgtccatgggcctggagatcacgggcaccgcgctggccgtgctgggctggctgggcaccatcgtgtgctgcgcgctgcccatgtggcgcgtgacggccttcatcggcagcaacatcatcacgtcgcagaccatctgggagggcctgtggatgaactgcgtggtgcagagcaccggccagatgcagtgcaaggtgtacgactcgctgctggcgctgccgcaggacctgcaggcggcccgcgccctcatcgtggtggccatcctgctggccgccttcgggctgctagtggcgctggtgggcgcccagtgcaccaactgcgtgcaggacgacacggccaaggccaagatcactatcgtggcgggcgtgctgttccttctggccgccctgctcaccctcgtgccggtgtcctggtccgccaacaccattatccgggaattctacaaccccgtggtgcctgaggcgcagaagcgcgagatgggcacgagcctgtacgtgggctgggcggccgcggcgctgcagctgctggggggcgcgctgctctgttgctcgtgccccccacgcgagaagaagtacatgcccaccaaggtcgtctactccgcgccgcgctccaccggcccgggagccagcatgggcacagcctacgaccgcaaggactatgtctaagggacagacgcagggagaccc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]