GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:39:02, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NM_001193829             654 bp    mRNA    linear   PRI 12-DEC-2019
DEFINITION  Macaca mulatta claudin 9 (CLDN9), mRNA.
ACCESSION   NM_001193829 XM_001088610
VERSION     NM_001193829.2
KEYWORDS    RefSeq.
SOURCE      Macaca mulatta (Rhesus monkey)
  ORGANISM  Macaca mulatta
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Cercopithecidae; Cercopithecinae; Macaca.
REFERENCE   1  (bases 1 to 654)
  AUTHORS   Yan G, Zhang G, Fang X, Zhang Y, Li C, Ling F, Cooper DN, Li Q, Li
            Y, van Gool AJ, Du H, Chen J, Chen R, Zhang P, Huang Z, Thompson
            JR, Meng Y, Bai Y, Wang J, Zhuo M, Wang T, Huang Y, Wei L, Li J,
            Wang Z, Hu H, Yang P, Le L, Stenson PD, Li B, Liu X, Ball EV, An N,
            Huang Q, Zhang Y, Fan W, Zhang X, Li Y, Wang W, Katze MG, Su B,
            Nielsen R, Yang H, Wang J, Wang X and Wang J.
  TITLE     Genome sequencing and comparison of two nonhuman primate animal
            models, the cynomolgus and Chinese rhesus macaques
  JOURNAL   Nat. Biotechnol. 29 (11), 1019-1023 (2011)
   PUBMED   22002653
  REMARK    Publication Status: Online-Only
COMMENT     INFERRED REFSEQ: This record is predicted by genome sequence
            analysis and is not yet supported by experimental evidence. The
            reference sequence was derived from QNVO02000290.1.
            On Dec 12, 2019 this sequence version replaced NM_001193829.1.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-654               QNVO02000290.1     27410709-27411362   c
FEATURES             Location/Qualifiers
     source          1..654
                     /organism="Macaca mulatta"
                     /mol_type="mRNA"
                     /db_xref="taxon:9544"
                     /chromosome="20"
                     /map="20"
     gene            1..654
                     /gene="CLDN9"
                     /gene_synonym="Claudin-9"
                     /note="claudin 9"
                     /db_xref="GeneID:699721"
     CDS             1..654
                     /gene="CLDN9"
                     /gene_synonym="Claudin-9"
                     /codon_start=1
                     /product="claudin-9"
                     /protein_id="NP_001180758.1"
                     /db_xref="GeneID:699721"
                     /translation="
MASTGLELLGMTLAVLGWLGTLVSCALPLWKVTAFIGNSIVVAQVVWEGLWMSCVVQSTGQMQCKVYDSLLALPQDLQAARALCVIALLLALLGLLLAITGAQCTTCVEDEGAKARIMLTAGVILLLAGILVLIPVCWTAHAIIQDFYNPLVAEALKRELGASLYLGWAAAALLMLGGGLLCCTCPPPQVERPRGPRLGYSIPSRSGASGLDKRDYV"
     misc_feature    10..453
                     /gene="CLDN9"
                     /gene_synonym="Claudin-9"
                     /note="PMP-22/EMP/MP20/Claudin family; Region:
                     PMP22_Claudin; cl21598"
                     /db_xref="CDD:328820"
     exon            1..654
                     /gene="CLDN9"
                     /gene_synonym="Claudin-9"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
atggcttcgactggcttagaactgctgggcatgaccctggctgtgctgggctggctggggaccctggtgtcctgtgccctgcccctgtggaaggtgaccgccttcatcggcaacagcatcgtagtggcccaggtggtgtgggaggggctgtggatgtcctgcgtggtgcagagcacgggccagatgcagtgcaaggtgtacgactcgctgctggcactgccacaggacctgcaggctgcacgtgccctctgtgtcatcgccctcctgctggccctgcttggcctcctgttggccatcacaggtgcccagtgtaccacatgtgtggaggatgaaggtgccaaggcccgtatcatgctcaccgcgggagtcatcctcctcctcgctggcatcctggtgctcatccctgtgtgctggacggcgcacgccatcatccaggacttctacaaccccctggtggctgaggccctcaagcgggagctgggagcctccctctacctgggctgggcggcagccgcactgcttatgctgggcggggggctcctctgctgcacgtgccccccgccccaggtcgagcggccccgtggaccgaggctgggctactccatcccctcccgctcaggcgcgtctggactggacaagagggactacgtgtga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]