2025-07-10 15:54:20, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NM_001192014 738 bp mRNA linear ROD 01-APR-2024 DEFINITION Rattus norvegicus notochord homeobox (Noto), mRNA. ACCESSION NM_001192014 XM_578357 VERSION NM_001192014.1 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 738) AUTHORS Alten,L., Schuster-Gossler,K., Beckers,A., Groos,S., Ulmer,B., Hegermann,J., Ochs,M. and Gossler,A. TITLE Differential regulation of node formation, nodal ciliogenesis and cilia positioning by Noto and Foxj1 JOURNAL Development 139 (7), 1276-1284 (2012) PUBMED 22357932 REFERENCE 2 (bases 1 to 738) AUTHORS Vidigal,J.A., Morkel,M., Wittler,L., Brouwer-Lehmitz,A., Grote,P., Macura,K. and Herrmann,B.G. TITLE An inducible RNA interference system for the functional dissection of mouse embryogenesis JOURNAL Nucleic Acids Res 38 (11), e122 (2010) PUBMED 20350929 REFERENCE 3 (bases 1 to 738) AUTHORS Zizic Mitrecic,M., Mitrecic,D., Pochet,R., Kostovic-Knezevic,L. and Gajovic,S. TITLE The mouse gene Noto is expressed in the tail bud and essential for its morphogenesis JOURNAL Cells Tissues Organs 192 (2), 85-92 (2010) PUBMED 20197654 REFERENCE 4 (bases 1 to 738) AUTHORS Beckers,A., Alten,L., Viebahn,C., Andre,P. and Gossler,A. TITLE The mouse homeobox gene Noto regulates node morphogenesis, notochordal ciliogenesis, and left right patterning JOURNAL Proc Natl Acad Sci U S A 104 (40), 15765-15770 (2007) PUBMED 17884984 REMARK Erratum:[Proc Natl Acad Sci U S A. 2007 Oct 30;104(44):17554] REFERENCE 5 (bases 1 to 738) AUTHORS Abdelkhalek,H.B., Beckers,A., Schuster-Gossler,K., Pavlova,M.N., Burkhardt,H., Lickert,H., Rossant,J., Reinhardt,R., Schalkwyk,L.C., Muller,I., Herrmann,B.G., Ceolin,M., Rivera-Pomar,R. and Gossler,A. TITLE The mouse homeobox gene Not is required for caudal notochord development and affected by the truncate mutation JOURNAL Genes Dev 18 (14), 1725-1736 (2004) PUBMED 15231714 REFERENCE 6 (bases 1 to 738) AUTHORS Mitrecic,D., Kostovic-Knezevic,L. and Gajovic,S. TITLE Morphological features of tail bud development in truncate mouse mutants JOURNAL Cells Tissues Organs 178 (1), 23-32 (2004) PUBMED 15550757 REFERENCE 7 (bases 1 to 738) AUTHORS Dietrich,S., Schubert,F.R. and Gruss,P. TITLE Altered Pax gene expression in murine notochord mutants: the notochord is required to initiate and maintain ventral identity in the somite JOURNAL Mech Dev 44 (2-3), 189-207 (1993) PUBMED 8155581 REFERENCE 8 (bases 1 to 738) AUTHORS THEILER,K. TITLE Anatomy and development of the 'truncate' (boneless) mutation in the mouse JOURNAL Am J Anat 104, 319-343 (1959) PUBMED 13837681 COMMENT INFERRED REFSEQ: This record is predicted by genome sequence analysis and is not yet supported by experimental evidence. The reference sequence was derived from JAXUCZ010000004.1. On Jul 17, 2010 this sequence version replaced XM_578357.1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. ##Evidence-Data-START## RNAseq introns :: single sample supports all introns SAMEA5760389, SAMEA5760434 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-379 JAXUCZ010000004.1 119518663-119519041 380-591 JAXUCZ010000004.1 119520022-119520233 592-738 JAXUCZ010000004.1 119522756-119522902 FEATURES Location/Qualifiers source 1..738 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN" /db_xref="taxon:10116" /chromosome="4" /map="4q34" gene 1..738 /gene="Noto" /gene_synonym="RGD1562910" /note="notochord homeobox" /db_xref="GeneID:502857" /db_xref="RGD:1562910" CDS 1..738 /gene="Noto" /gene_synonym="RGD1562910" /note="notochord homolog" /codon_start=1 /product="homeobox protein notochord" /protein_id="NP_001178943.1" /db_xref="GeneID:502857" /db_xref="RGD:1562910" /translation="
MSSPVPQPASSGTQVQPGDLGPCPVAVSPVVPNHLARGRLESSFSVEAILARPETREHSATSLPLSTCTSLNFGSVSQYQVLPWVCSTGTWLPTYLSVGIYPMCSMSCMPGLNVTHLFCQQGLRLTGSELPSCLGPLKRAPTVNLQDHNTERHQKRVRTMFSEQQLGELEKVFAKQHNLVGKERAQLAARLHLTENQVRIWFQNRRVKYQKQQKLKSPPPDAMEEPSNSSEGNVRNEDAEAGVGS"
misc_feature 463..633 /gene="Noto" /gene_synonym="RGD1562910" /note="Region: Homeodomain; pfam00046" /db_xref="CDD:459649" exon 1..379 /gene="Noto" /gene_synonym="RGD1562910" /inference="alignment:Splign:2.1.0" exon 380..591 /gene="Noto" /gene_synonym="RGD1562910" /inference="alignment:Splign:2.1.0" exon 592..738 /gene="Noto" /gene_synonym="RGD1562910" /inference="alignment:Splign:2.1.0" ORIGIN
atgtccagcccagtgccccagcctgcttcctcaggcactcaggtccagcccggggacttgggaccctgtccggtggctgtttccccagtagtcccgaaccacctagctcggggacgcctggagtcctccttctctgttgaggccatcctggcgagacccgagactcgtgagcactctgccacgtctctgccgctctctacctgcaccagtctgaactttggctctgtgtcacagtaccaggtcctgccctgggtgtgctccacggggacttggctgcccacctacctgagcgtaggcatctacccgatgtgctccatgtcctgcatgcccggattgaatgtgactcacctcttctgccaacagggcctcagactcacagggtcagagctaccttcctgtctaggccctctgaaacgggcacccactgtgaaccttcaggaccacaataccgagagacaccaaaagagggttcgcacaatgtttagcgagcagcagctgggagagttggagaaggtatttgcaaagcagcacaacctggtggggaaggagagagcccagttggctgccaggctgcacttgacagagaaccaggtaaggatctggttccagaatcgcagggtaaagtatcaaaagcagcaaaaactgaagtcacctccccctgatgccatggaggagccctccaacagctcagagggcaacgtccggaatgaagacgctgaggcaggagttggcagttaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]