LOCUS       NM_001182488             939 bp    mRNA    linear   PLN 17-DEC-2024
DEFINITION  Saccharomyces cerevisiae S288C cytochrome-b5 reductase (PGA3),
            partial mRNA.
ACCESSION   NM_001182488
VERSION     NM_001182488.1
DBLINK      BioProject: PRJNA128
KEYWORDS    RefSeq.
SOURCE      Saccharomyces cerevisiae S288C
  ORGANISM  Saccharomyces cerevisiae S288C
            Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina;
            Saccharomycetes; Saccharomycetales; Saccharomycetaceae;
            Saccharomyces.
REFERENCE   1  (bases 1 to 939)
  AUTHORS   Engel,S.R., Wong,E.D., Nash,R.S., Aleksander,S., Alexander,M.,
            Douglass,E., Karra,K., Miyasato,S.R., Simison,M., Skrzypek,M.S.,
            Weng,S. and Cherry,J.M.
  TITLE     New data and collaborations at the Saccharomyces Genome Database:
            updated reference genome, alleles, and the Alliance of Genome
            Resources
  JOURNAL   Genetics 220 (4) (2022)
   PUBMED   34897464
REFERENCE   2  (bases 1 to 939)
  AUTHORS   Bowman,S., Churcher,C., Badcock,K., Brown,D., Chillingworth,T.,
            Connor,R., Dedman,K., Devlin,K., Gentles,S., Hamlin,N., Hunt,S.,
            Jagels,K., Lye,G., Moule,S., Odell,C., Pearson,D., Rajandream,M.,
            Rice,P., Skelton,J., Walsh,S., Whitehead,S. and Barrell,B.
  TITLE     The nucleotide sequence of Saccharomyces cerevisiae chromosome XIII
  JOURNAL   Nature 387 (6632 SUPPL), 90-93 (1997)
   PUBMED   9169872
REFERENCE   3  (bases 1 to 939)
  AUTHORS   Goffeau,A., Barrell,B.G., Bussey,H., Davis,R.W., Dujon,B.,
            Feldmann,H., Galibert,F., Hoheisel,J.D., Jacq,C., Johnston,M.,
            Louis,E.J., Mewes,H.W., Murakami,Y., Philippsen,P., Tettelin,H. and
            Oliver,S.G.
  TITLE     Life with 6000 genes
  JOURNAL   Science 274 (5287), 546 (1996)
   PUBMED   8849441
REFERENCE   4  (bases 1 to 939)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (17-DEC-2024) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   5  (bases 1 to 939)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (04-MAY-2012) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
  REMARK    Protein update by submitter
REFERENCE   6  (bases 1 to 939)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (31-MAR-2011) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
  REMARK    Sequence update by submitter
REFERENCE   7  (bases 1 to 939)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (14-DEC-2009) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by SGD. This record
            is derived from an annotated genomic sequence (NC_001145).
            
            ##Genome-Annotation-Data-START##
            Annotation Provider :: SGD
            Annotation Status   :: Full Annotation
            Annotation Version  :: R64-4-1
            URL                 :: http://www.yeastgenome.org/
            ##Genome-Annotation-Data-END##
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..939
                     /organism="Saccharomyces cerevisiae S288C"
                     /mol_type="mRNA"
                     /strain="S288C"
                     /db_xref="taxon:559292"
                     /chromosome="XIII"
     gene            <1..>939
                     /gene="PGA3"
                     /locus_tag="YML125C"
                     /gene_synonym="NQR1"
                     /db_xref="GeneID:854914"
     CDS             1..939
                     /gene="PGA3"
                     /locus_tag="YML125C"
                     /gene_synonym="NQR1"
                     /EC_number="1.6.2.2"
                     /experiment="EXISTENCE:direct assay:GO:0005783 endoplasmic
                     reticulum [PMID:26928762|PMID:14562095]"
                     /experiment="EXISTENCE:direct assay:GO:0005886 plasma
                     membrane [PMID:19239415]"
                     /experiment="EXISTENCE:mutant phenotype:GO:0004128
                     cytochrome-b5 reductase activity, acting on NAD(P)H
                     [PMID:19239415]"
                     /experiment="EXISTENCE:mutant phenotype:GO:0015031 protein
                     transport [PMID:16943325]"
                     /note="Putative cytochrome b5 reductase, localized to the
                     plasma membrane; may be involved in regulation of
                     lifespan; required for maturation of Gas1p and Pho8p,
                     proposed to be involved in protein trafficking; PGA3 has a
                     paralog, AIM33, that arose from the whole genome
                     duplication"
                     /codon_start=1
                     /product="cytochrome-b5 reductase"
                     /protein_id="NP_013581.1"
                     /db_xref="GeneID:854914"
                     /db_xref="SGD:S000004594"
                     /translation="

MSKEDIEGTNILDEPVHGIYIPAALFVVGVAITTYMSGELKILWSLPILFMIIFVRAYSAYKRRRSLYPDRWTSLELEDQTIISKNTALYRFKLKTRLESLDIPAGHHVAVRVPIDGKQEVRYYNPISSKLESGYLDLVVKAYVDGKVSKYFAGLNSGDTVDFKGPIGTLNYEPNSSKHLGIVAGGSGITPVLQILNEIITVPEDLTKVSLLYANETENDILLKDELDEMAEKYPHFQVHYVVHYPSDRWTGDVGYITKDQMNRYLPEYSEDNRLLICGPDGMNNLALQYAKELGWKVNSTRSSGDDQVFVF"

     misc_feature    223..936
                     /gene="PGA3"
                     /locus_tag="YML125C"
                     /gene_synonym="NQR1"
                     /note="Cytochrome b5 reductase catalyzes the reduction of
                     2 molecules of cytochrome b5 using NADH as an electron
                     donor. Like ferredoxin reductases, these proteins have an
                     N-terminal FAD binding subdomain and a C-terminal NADH
                     binding subdomain, separated by a...; Region:
                     cyt_b5_reduct_like; cd06183"
                     /db_xref="CDD:99780"
     misc_feature    order(322..324,364..375,415..423,427..429,433..447,
                     559..561,568..573,934..936)
                     /gene="PGA3"
                     /locus_tag="YML125C"
                     /gene_synonym="NQR1"
                     /note="FAD binding pocket [chemical binding]; other site"
                     /db_xref="CDD:99780"
     misc_feature    order(364..366,370..375)
                     /gene="PGA3"
                     /locus_tag="YML125C"
                     /gene_synonym="NQR1"
                     /note="FAD binding motif [chemical binding]; other site"
                     /db_xref="CDD:99780"
     misc_feature    order(421..423,427..429,559..564,640..648,730..732,
                     766..768,835..849)
                     /gene="PGA3"
                     /locus_tag="YML125C"
                     /gene_synonym="NQR1"
                     /note="NAD binding pocket [chemical binding]; other site"
                     /db_xref="CDD:99780"
     misc_feature    order(436..438,445..447,454..456,472..474,496..498,
                     502..504)
                     /gene="PGA3"
                     /locus_tag="YML125C"
                     /gene_synonym="NQR1"
                     /note="phosphate binding motif [ion binding]; other site"
                     /db_xref="CDD:99780"
     misc_feature    order(544..546,556..567,571..573)
                     /gene="PGA3"
                     /locus_tag="YML125C"
                     /gene_synonym="NQR1"
                     /note="beta-alpha-beta structure motif; other site"
                     /db_xref="CDD:99780"
ORIGIN      

atgtcaaaagaagacatagaaggaactaacattctagacgaacctgtccacgggatctatattcctgccgcgctattcgttgttggtgttgcaatcaccacgtatatgtctggtgaattgaaaatcctgtggagtttacccattctcttcatgatcatcttcgtcagagcatactctgcctacaaaagaagaagatcactgtatccagataggtggacttcgttagaattggaagatcaaaccataatttccaagaataccgccctgtatcgttttaagttgaagacaagactggaaagcttggacattcccgctggtcatcatgttgctgtacgcgttccaattgacggcaaacaagaggtcagatactataatccgatcagttctaaactagaaagtggatacttggatttggtggtgaaagcatacgttgatggtaaagtctccaaatatttcgctggcttaaattctggtgacaccgtggatttcaaggggccaataggtactttgaactacgaaccaaattcctccaagcatttaggtatcgtagccggtggttctggtatcacgccagtcctacagatcttgaatgaaatcatcaccgttcctgaagatttgacgaaagtctccctgctatatgccaatgagactgaaaatgacattctattgaaggacgaactggatgagatggccgaaaaatacccacatttccaggtccattacgtggtacactatccatccgacagatggaccggagatgtcggctacatcaccaaggaccagatgaacaggtatctgccggaatattcggaggataacagactcttgatctgtggacctgatggaatgaacaacttggcccttcaatacgctaaagaactgggctggaaggtcaattcaacgagaagttctggcgacgatcaagtcttcgtcttttaa

//