GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-10-17 16:27:06, GGRNA.v2 : RefSeq release 207 (Jul, 2021)

LOCUS       NM_001169115            4470 bp    mRNA    linear   ROD 23-FEB-2021
DEFINITION  Rattus norvegicus trafficking protein particle complex subunit 11
            (Trappc11), mRNA.
ACCESSION   NM_001169115 XM_001059837 XM_224848
VERSION     NM_001169115.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 4470)
  AUTHORS   Matalonga L, Bravo M, Serra-Peinado C, Garcia-Pelegri E, Ugarteburu
            O, Vidal S, Llambrich M, Quintana E, Fuster-Jorge P, Gonzalez-Bravo
            MN, Beltran S, Dopazo J, Garcia-Garcia F, Foulquier F, Matthijs G,
            Mills P, Ribes A, Egea G, Briones P, Tort F and Giros M.
  TITLE     Mutations in TRAPPC11 are associated with a congenital disorder of
            glycosylation
  JOURNAL   Hum Mutat 38 (2), 148-151 (2017)
   PUBMED   27862579
REFERENCE   2  (bases 1 to 4470)
  AUTHORS   Scrivens PJ, Noueihed B, Shahrzad N, Hul S, Brunet S and Sacher M.
  TITLE     C4orf41 and TTC-15 are mammalian TRAPP components with a role at an
            early stage in ER-to-Golgi trafficking
  JOURNAL   Mol Biol Cell 22 (12), 2083-2093 (2011)
   PUBMED   21525244
REFERENCE   3  (bases 1 to 4470)
  AUTHORS   Wendler F, Gillingham AK, Sinka R, Rosa-Ferreira C, Gordon DE,
            Franch-Marro X, Peden AA, Vincent JP and Munro S.
  TITLE     A genome-wide RNA interference screen identifies two novel
            components of the metazoan secretory pathway
  JOURNAL   EMBO J 29 (2), 304-314 (2010)
   PUBMED   19942856
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JACYVU010000282.1.
            On or before Dec 16, 2009 this sequence version replaced
            XM_224848.4, XM_001059837.1.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            ##Evidence-Data-START##
            RNAseq introns :: single sample supports all introns SAMD00132261,
                              SAMD00132262 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-249               JACYVU010000282.1  8535212-8535460
            250-475             JACYVU010000282.1  8537882-8538107
            476-645             JACYVU010000282.1  8539084-8539253
            646-716             JACYVU010000282.1  8540752-8540822
            717-831             JACYVU010000282.1  8541739-8541853
            832-931             JACYVU010000282.1  8543866-8543965
            932-1005            JACYVU010000282.1  8544286-8544359
            1006-1102           JACYVU010000282.1  8545517-8545613
            1103-1236           JACYVU010000282.1  8548494-8548627
            1237-1384           JACYVU010000282.1  8551860-8552007
            1385-1478           JACYVU010000282.1  8553712-8553805
            1479-1558           JACYVU010000282.1  8554439-8554518
            1559-1637           JACYVU010000282.1  8554610-8554688
            1638-1692           JACYVU010000282.1  8554764-8554818
            1693-1838           JACYVU010000282.1  8555140-8555285
            1839-1900           JACYVU010000282.1  8555915-8555976
            1901-2033           JACYVU010000282.1  8556069-8556201
            2034-2164           JACYVU010000282.1  8557424-8557554
            2165-2320           JACYVU010000282.1  8558816-8558971
            2321-2508           JACYVU010000282.1  8560721-8560908
            2509-2657           JACYVU010000282.1  8561013-8561161
            2658-2779           JACYVU010000282.1  8563038-8563159
            2780-2899           JACYVU010000282.1  8563624-8563743
            2900-2965           JACYVU010000282.1  8565325-8565390
            2966-3122           JACYVU010000282.1  8565492-8565648
            3123-3234           JACYVU010000282.1  8568412-8568523
            3235-3326           JACYVU010000282.1  8571067-8571158
            3327-3460           JACYVU010000282.1  8572845-8572978
            3461-3628           JACYVU010000282.1  8575229-8575396
            3629-4470           JACYVU010000282.1  8580524-8581365
FEATURES             Location/Qualifiers
     source          1..4470
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="16"
                     /map="16q11"
     gene            1..4470
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /note="trafficking protein particle complex subunit 11"
                     /db_xref="GeneID:290746"
                     /db_xref="RGD:1309765"
     exon            1..249
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    185..187
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /note="upstream in-frame stop codon"
     exon            250..475
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /inference="alignment:Splign:2.1.0"
     CDS             272..3673
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /note="trafficking protein particle complex 11"
                     /codon_start=1
                     /product="trafficking protein particle complex subunit 11"
                     /protein_id="NP_001162586.1"
                     /db_xref="GeneID:290746"
                     /db_xref="RGD:1309765"
                     /translation="
MSPTQWDFPVELCCRPMAFVTLTGLDVVYNAVHRAVWDAFCANRRADRVPISFKVLPGDHEYPKCRSKRTSYEWYIPKGILKTGWMNKHLNLVPALVVVFYELDWDEPQWKEKQSECATRVEIVRQSLQGRNTKVAVVLIQKKTPLPPGEDIIASERAAALCNVCELSGKSLFVLPHTDHLVGYIIRLENAFYEHAQTYYYTEIRRVKSHKEFLNKTTHQLLFVRHQFKIAFFSELKQDTQNALKNYRTAYNLVHELRAHETNILEIKTMAGFINYKICRLCFQHNTPLDAIAQFRKHIDLCKKKIGSAELSFEHAAWMSKQFQAFGDLFDEAIKLGLTAIQTQNPGFYYQQAAYYAQERKQHAKALCNHDAAVVYPSPDPLETPTGVLDFYGQRPWRQGILSFDLSDPEKEKAGILAIQLKERSVVHSEMIITLLSNAVAQFKKYKCPRMKSHLMVQMGEEYYYAKDYTKALKLLDYVMCDYRSEAWWTLLTSILTTALKCSYLMAQLKDYITYSLELLGRASTLKDDQKSRIEKNLMNVLMNESPDPEPDCDALAVKTAQKLWADRVSLAGSNVFTIGVQDFVPFVQCKAKFHAPSFHVDVPVQFDVYLKADCPHPIRFSKLCVSFNNQGYNQFCVLEEASKASEVLENLTQGKMCLVPGKTRKLLFKFVAKTEDVGKKIEITSVDLFLGSESGRCVVLSWQGGGGDAASSQEALQAARSFKRRPKLPDDEVHWDSIIVQASTMIISRVPNISVHLRHEPPALMNEMYCLVVTVQSQEKSQIRDVKLTAGLKPGQDANLTQKTHVTLHGAELCDESYPALLTDIPVGDLNPGEQLEKTVYVRCGTVGSRMFLVYVSYLINTTVEGKGIMCKCHKDETVTIETVFPFDVAVRFVSTKFEHLERVYADIPFLLMTDILSASPWALTIVSSELQLAPSMAAMDHLESQIDKVVLQTGESASECFCLRCPSAGNLEGGVATGHYIISWKRSSGMENIPAISTIITLPHVIVENIPLHVNADLPSFGRVRESLPVRYHLQNKTDLVQDVEISVEPSDAFMFSGLKQIRLRILPGTKQEMLYNFYPLMAGYQQLPSLNINLLRFPNFTNQLLRRFIPTSIFVKPQGRLLEDTSIAAA"
     misc_feature    1058..1837
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /note="Foie gras liver health family 1; Region:
                     Foie-gras_1; pfam11817"
                     /db_xref="CDD:288650"
     misc_feature    3377..3556
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /note="Gryzun, putative Golgi trafficking; Region:
                     Gryzun-like; pfam12742"
                     /db_xref="CDD:289511"
     exon            476..645
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /inference="alignment:Splign:2.1.0"
     exon            646..716
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /inference="alignment:Splign:2.1.0"
     exon            717..831
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /inference="alignment:Splign:2.1.0"
     exon            832..931
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /inference="alignment:Splign:2.1.0"
     exon            932..1005
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /inference="alignment:Splign:2.1.0"
     exon            1006..1102
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /inference="alignment:Splign:2.1.0"
     exon            1103..1236
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /inference="alignment:Splign:2.1.0"
     exon            1237..1384
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /inference="alignment:Splign:2.1.0"
     exon            1385..1478
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /inference="alignment:Splign:2.1.0"
     exon            1479..1558
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /inference="alignment:Splign:2.1.0"
     exon            1559..1637
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /inference="alignment:Splign:2.1.0"
     exon            1638..1692
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /inference="alignment:Splign:2.1.0"
     exon            1693..1838
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /inference="alignment:Splign:2.1.0"
     exon            1839..1900
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /inference="alignment:Splign:2.1.0"
     exon            1901..2033
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /inference="alignment:Splign:2.1.0"
     exon            2034..2164
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /inference="alignment:Splign:2.1.0"
     exon            2165..2320
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /inference="alignment:Splign:2.1.0"
     exon            2321..2508
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /inference="alignment:Splign:2.1.0"
     exon            2509..2657
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /inference="alignment:Splign:2.1.0"
     exon            2658..2779
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /inference="alignment:Splign:2.1.0"
     exon            2780..2899
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /inference="alignment:Splign:2.1.0"
     exon            2900..2965
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /inference="alignment:Splign:2.1.0"
     exon            2966..3122
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /inference="alignment:Splign:2.1.0"
     exon            3123..3234
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /inference="alignment:Splign:2.1.0"
     exon            3235..3326
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /inference="alignment:Splign:2.1.0"
     exon            3327..3460
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /inference="alignment:Splign:2.1.0"
     exon            3461..3628
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /inference="alignment:Splign:2.1.0"
     exon            3629..4470
                     /gene="Trappc11"
                     /gene_synonym="RGD1309765"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
atggaacaccttcctaacaagaaaccccgttctattccaggactggtgtgcggtactgtcactcaagcccaggaagtgcttcctgtgccaacggaggcggggaaaaggaagtctcgccttctgccgcccggtctggggctggggctgtcggttgtcggtggccgtgttcctagacgcccctccctgactctcctggctctttcggggccgacggagactcgccgcggctgcagcgggtccagggcctggagttttctgtgacgtcttaaacatgagccccacacagtgggacttccctgtggagttatgttgccggcctatggcttttgttacacttactggccttgatgtggtgtataatgctgtccatcgagcagtctgggatgctttctgtgccaatcggagagctgaccgggtaccaatttctttcaaagtgctcccaggtgaccatgaatacccaaaatgtagatcaaagagaacttcgtatgagtggtacattcctaaaggaatcctaaagaccggctggatgaataagcatctgaacctcgtgccagcgctggtggtcgtgttctatgaactggactgggacgagcctcagtggaaggaaaagcaatctgagtgtgccaccagggtggagattgtcaggcaaagtttgcaagggagaaacacaaaagttgcagtcgtcctgattcaaaagaaaacacctttacccccaggggaagatatcattgcttctgagcgggctgcagctttatgcaatgtgtgtgagctctcaggcaagtctctgttcgtgctgccccacactgaccaccttgtgggctacattataagattagaaaatgcattttatgagcatgcccagacctattactacactgagatcagaagagtgaaatctcataaggaattcttgaataaaacaacacaccagcttttgtttgttagacatcagttcaaaatagctttcttcagtgagttgaaacaagatacacaaaacgccctgaagaattacaggactgcctataacctcgtacatgaactgagggcccatgaaactaatattctggaaattaagacgatggcaggatttataaactacaagatctgtaggctgtgttttcaacacaataccccactagatgccattgctcagtttcgaaaacacattgacttgtgcaagaagaaaattgggagcgcagagctgtcctttgagcatgctgcgtggatgtcgaaacaattccaggcctttggagatttatttgatgaagccattaagttggggctgacagcaattcaaacacagaaccctggtttctactatcagcaggctgcttactatgcccaggagcgaaaacagcacgcaaaagccctctgtaaccatgacgctgctgtggtgtaccccagtcctgatcccttggaaacaccaacaggtgttcttgacttctatggacagaggccctggagacaaggaatactaagctttgacctctcagaccctgaaaaagagaaagcagggattctcgccattcagctgaaggagagaagtgttgtccactccgagatgataatcactcttctgagcaatgccgttgcacagttcaagaagtacaagtgtccacggatgaagagccacctcatggttcagatgggagaggagtattattatgcgaaggactataccaaagctttgaagctgctggactatgtgatgtgtgactaccggagtgaagcatggtggactctcctcacatctatattgacaacagccctgaagtgttcctacctcatggcccagttaaaagattatattacttactctctggaactccttggaagagcttcaactctgaaagatgaccagaaatctcggatagaaaagaacctcatgaatgttttaatgaatgaaagtcctgaccctgaacctgactgtgacgccttagcagtaaagactgctcagaagctgtgggcagaccgggtctctctggctggcagcaatgttttcacaataggcgtacaggacttcgtgccatttgtgcagtgcaaagccaagttccatgctcccagttttcacgtggatgttcctgtccagtttgatgtttatctgaaggccgactgcccacaccccattaggttttccaagctctgtgtcagctttaataatcagggttacaaccagttctgtgtattggaggaagcatcaaaggcaagtgaagtcttagaaaatctgactcaaggaaagatgtgcttagttcctggcaaaacaagaaaattgttatttaaatttgttgccaaaactgaagatgtgggaaagaaaatagagatcacctctgtggatctgtttctgggcagcgagtcaggcaggtgtgtggttttgagctggcaaggaggaggaggggatgctgcttcctcccaggaagccctgcaggctgcaaggtctttcaagaggcggccaaagcttccggacgatgaggttcactgggacagcatcatagtccaggcaagcacaatgatcatttccagagttccaaacatttctgtacatctgcgacatgagcctcctgctctaatgaatgagatgtattgtttggttgtaactgttcaatcccaggaaaagtcccaaatcagggacgtgaagctcactgctggcctaaagccagggcaggatgccaacctgactcagaagacccatgtgacacttcacggagcagagctgtgtgatgagtcctacccagccttactcaccgacattcctgtaggagacttaaacccaggggagcagctggagaaaacagtgtatgttcgctgtggaacagtgggttccagaatgttccttgtgtatgtttcttacctgatcaatacaactgttgaaggaaaaggaattatgtgcaagtgtcacaaggatgaaacagtgacaatagaaactgtctttccatttgatgtcgcagtcagatttgtttccacaaagtttgagcacctggaaagagtctatgcagatatcccctttttgttgatgacggatattttaagtgcctcaccttgggccctcacaatcgtgtccagtgagctacagcttgctccgtctatggctgcaatggatcatctggagtcccaaatagacaaagttgtcttacagacaggagagagcgctagtgagtgcttctgtcttcgctgcccatctgctgggaaccttgaaggtggagtggcaacaggacattacattatctcctggaagaggtcctcaggcatggaaaacatccccgccatcagcaccatcatcacactgcctcacgtgattgttgaaaacatccctctccatgtgaacgcagacctgccctcgtttggacgagtcagagagtcgttacctgtcaggtatcacctacagaataagaccgacttggttcaagatgtggaaatttctgtggagcccagtgatgccttcatgttctcaggcctcaaacagatccgattacgtattctacctggcaccaaacaggagatgctatataatttctatcctctgatggctgggtaccaacagctaccatcgctcaacatcaacctgctgaggtttcccaacttcaccaaccagctgctcagacgcttcataccaaccagcatttttgtgaagccacagggtcgactcttggaggacacctccatcgctgctgcatgatgtccaggaccagctcttggtgttcttacggaggagtcaagagagtacccgggaggtgtactgtgactgtagctttgttcgtggtgaaaagttaatcctgcctgttttttaatggacataatatcagctcttcagagaactcatggttaaaatattgaggaaatcaacttctctagttttactaataaagtttgaaatgtgtcagtgtgatgtgaaaggtgtcaggtcatcattgctgttagaagtcctttcatggttagcacaatgtgccttgacatacagcatcagtagaacagagaccaagtgtggctgacagaggagacacaactcatccgggtctgcctgcaagtgacccaccccataagtcccctgtgtgcttagcgcatacacagcaagtagcacaggtctggctgaaggacagacctttaggggaggggcttcattagagcagttgaaaggtgtaagagttttacttactgttggaaagtttcagactacgacccacacatgcttttgtgtgcatcctgagaggacctgatgataggcttaattagtaaacgaaaagtctgtgagaatgaaacattggagtgttcagtcccattacgtcacttcctaagggcgatcgatttagaatgacctttaagttcatgtaaatggaaacagatcatatggtgaacattttctttgtaaaatatcttaatttaaaactacataatttcttggaaatttgtactatgcagactgcgggcatattgtaaaaaggaaatagtgatgtaaataaaatatgttctctttca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]