GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 12:22:30, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NM_001169064            1332 bp    mRNA    linear   PRI 21-NOV-2019
DEFINITION  Papio anubis homeobox A3 (HOXA3), mRNA.
ACCESSION   NM_001169064
VERSION     NM_001169064.1
KEYWORDS    RefSeq.
SOURCE      Papio anubis (olive baboon)
  ORGANISM  Papio anubis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Cercopithecidae; Cercopithecinae; Papio.
COMMENT     INFERRED REFSEQ: This record is predicted by genome sequence
            analysis and is not yet supported by experimental evidence. The
            reference sequence was derived from DP000507.1.
            
            ##Evidence-Data-START##
            RNAseq introns :: single sample supports all introns SAMN02045697,
                              SAMN02045698 [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..1332
                     /organism="Papio anubis"
                     /mol_type="mRNA"
                     /db_xref="taxon:9555"
                     /chromosome="4"
                     /map="4"
     gene            1..1332
                     /gene="HOXA3"
                     /note="homeobox A3"
                     /db_xref="GeneID:100137569"
     CDS             1..1332
                     /gene="HOXA3"
                     /note="homeobox A3, isoform 2"
                     /codon_start=1
                     /product="homeobox protein Hox-A3"
                     /protein_id="NP_001162535.1"
                     /db_xref="GeneID:100137569"
                     /translation="
MQKATYYDSSAIYGGYPYQAANGFAYNANQQPYPASVALGADGEYHRPACSLQSPSSAGGHPKAHELSDACLRSLSAPPSQPPSLGEPPLHPPPTQAAPPAPQPPQPPPQPPAPTSAAPPPPSSVSPPQNASSNPTPANAAKSPLLNSPTVAKQIFPWMKESRQNTKQKTSSSSSGESCAGDKSPPGQASSKRARTAYTSAQLVELEKEFHFNRYLCRPRRVEMANLLNLTERQIKIWFQNRRMKYKKDQKGKGMLTSSGGQSPSRSPVPPGAGGYLNSMHSLVNSVPYEPQSPPPFSKPPQGTYGLPPASYPASLPSCAPPPPPQKRYTAAGAGAGGTPDYDPHAHGLQGNGSYGTPHIQGSPVFVGGSYVEPMSNSGPALFGLTHLPHAASGAMDYGGAGPLGSGHHHGPGPGEPHPTYTDLTAHHPSQGRIQEAPKLTHL"
     misc_feature    order(574..588,592..594,643..645,661..663,700..702,
                     706..711,718..723,727..735,739..744)
                     /gene="HOXA3"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(580..582,589..591,709..711,718..723,730..732)
                     /gene="HOXA3"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    583..741
                     /gene="HOXA3"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:306543"
     misc_feature    1129..1323
                     /gene="HOXA3"
                     /note="Domain of unknown function (DUF4074); Region:
                     DUF4074; pfam13293"
                     /db_xref="CDD:315871"
     exon            1..526
                     /gene="HOXA3"
                     /inference="alignment:Splign:2.1.0"
     exon            527..1332
                     /gene="HOXA3"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
atgcaaaaagcgacctactacgacagctcggcgatctacggtggctacccctaccaggcagccaacgggttcgcttataatgccaatcagcagccgtacccggcgtccgtcgctttgggtgccgacggcgagtaccatcgacccgcctgctccctccagtctccctccagcgccggaggccaccccaaggcacacgaactgagtgacgcgtgcctgcgcagcctgagcgccccacctagccagcctccaagcctgggcgagccgcccctgcacccgccgccgacccaggccgcgccccctgccccacagccgcctcagcccccacctcagccccctgcacctacctctgccgcgcccccgcctccctcttctgtctccccacctcagaatgccagcagcaaccccacccccgccaacgcggccaagagccccctgctcaactcacccacagtggccaaacaaatcttcccctggatgaaagagtctcgacaaaacacaaagcagaaaaccagcagctctagctcaggcgagagctgcgctggcgacaagagcccgccggggcaggcttcgtccaagcgcgcgcgcacggcctacacgagtgcgcagctggtggagctggaaaaagagttccacttcaaccgctacctgtgccggccgcgccgggtggagatggccaatctgctgaacctcactgagcgccagatcaagatctggttccagaatcgccgcatgaagtacaaaaaggatcagaagggcaagggcatgctaacctcatcggggggccagtctccaagtcgcagtcccgtgccccccggcgccggtggctatctgaactctatgcattcgttggtcaacagcgtcccgtacgagccccagtcgcccccgcccttctccaagcccccccagggtacctacgggctgccccccgcctcctaccctgcatccctgcccagctgtgcacccccaccacccccacagaagcgctacacggcggcaggggcgggcgcagggggcacccccgactatgacccgcacgctcatggcctgcagggcaacggcagctatgggaccccacacatacagggaagccccgtcttcgtggggggcagctacgtggagcccatgagcaactctgggccagccctctttggtctaactcacctcccccacgctgcctcgggcgccatggactatgggggcgccgggccgctgggcagcggccaccaccacgggcccgggcctggggagccgcaccccacctacacggaccttactgcccaccatccttctcagggaagaattcaggaagcacccaagctcacccacctgtga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]