GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2022-12-08 16:13:08, GGRNA.v2 : RefSeq release 214 (Sep, 2022)

LOCUS       NM_001161780            4245 bp    mRNA    linear   PRI 15-AUG-2022
DEFINITION  Homo sapiens pyruvate dehydrogenase phosphatase catalytic subunit 1
            (PDP1), transcript variant 3, mRNA.
ACCESSION   NM_001161780
VERSION     NM_001161780.2
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 4245)
  AUTHORS   Shi Y, Wang Y, Jiang H, Sun X, Xu H, Wei X, Wei Y, Xiao G, Song Z
            and Zhou F.
  TITLE     Mitochondrial dysfunction induces radioresistance in colorectal
            cancer by activating [Ca(2+)]m-PDP1-PDH-histone acetylation
            retrograde signaling
  JOURNAL   Cell Death Dis 12 (9), 837 (2021)
   PUBMED   34489398
  REMARK    GeneRIF: Mitochondrial dysfunction induces radioresistance in
            colorectal cancer by activating [Ca(2+)]m-PDP1-PDH-histone
            acetylation retrograde signaling.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 4245)
  AUTHORS   Luck K, Kim DK, Lambourne L, Spirohn K, Begg BE, Bian W, Brignall
            R, Cafarelli T, Campos-Laborie FJ, Charloteaux B, Choi D, Cote AG,
            Daley M, Deimling S, Desbuleux A, Dricot A, Gebbia M, Hardy MF,
            Kishore N, Knapp JJ, Kovacs IA, Lemmens I, Mee MW, Mellor JC,
            Pollis C, Pons C, Richardson AD, Schlabach S, Teeking B, Yadav A,
            Babor M, Balcha D, Basha O, Bowman-Colin C, Chin SF, Choi SG,
            Colabella C, Coppin G, D'Amata C, De Ridder D, De Rouck S,
            Duran-Frigola M, Ennajdaoui H, Goebels F, Goehring L, Gopal A,
            Haddad G, Hatchi E, Helmy M, Jacob Y, Kassa Y, Landini S, Li R, van
            Lieshout N, MacWilliams A, Markey D, Paulson JN, Rangarajan S,
            Rasla J, Rayhan A, Rolland T, San-Miguel A, Shen Y, Sheykhkarimli
            D, Sheynkman GM, Simonovsky E, Tasan M, Tejeda A, Tropepe V,
            Twizere JC, Wang Y, Weatheritt RJ, Weile J, Xia Y, Yang X,
            Yeger-Lotem E, Zhong Q, Aloy P, Bader GD, De Las Rivas J, Gaudet S,
            Hao T, Rak J, Tavernier J, Hill DE, Vidal M, Roth FP and Calderwood
            MA.
  TITLE     A reference map of the human binary protein interactome
  JOURNAL   Nature 580 (7803), 402-408 (2020)
   PUBMED   32296183
REFERENCE   3  (bases 1 to 4245)
  AUTHORS   Zhang Y, Zhang Y, Ding GL, Liu XM, Ye J, Sheng JZ, Fan J and Huang
            HF.
  TITLE     Regulation of hepatic pyruvate dehydrogenase phosphorylation in
            offspring glucose intolerance induced by intrauterine hyperglycemia
  JOURNAL   Oncotarget 8 (9), 15205-15212 (2017)
   PUBMED   28148899
  REMARK    GeneRIF: High PDH expression is associated with glucose
            intolerance.
REFERENCE   4  (bases 1 to 4245)
  AUTHORS   Shan C, Kang HB, Elf S, Xie J, Gu TL, Aguiar M, Lonning S, Hitosugi
            T, Chung TW, Arellano M, Khoury HJ, Shin DM, Khuri FR, Boggon TJ
            and Fan J.
  TITLE     Tyr-94 phosphorylation inhibits pyruvate dehydrogenase phosphatase
            1 and promotes tumor growth
  JOURNAL   J Biol Chem 289 (31), 21413-21422 (2014)
   PUBMED   24962578
  REMARK    GeneRIF: YB-1 phosphorylation at Ser-102 is an important
            prerequisite for CCL5 promoter activation during macrophage
            differentiation
REFERENCE   5  (bases 1 to 4245)
  AUTHORS   Fan J, Shan C, Kang HB, Elf S, Xie J, Tucker M, Gu TL, Aguiar M,
            Lonning S, Chen H, Mohammadi M, Britton LM, Garcia BA, Aleckovic M,
            Kang Y, Kaluz S, Devi N, Van Meir EG, Hitosugi T, Seo JH, Lonial S,
            Gaddh M, Arellano M, Khoury HJ, Khuri FR, Boggon TJ, Kang S and
            Chen J.
  TITLE     Tyr phosphorylation of PDP1 toggles recruitment between ACAT1 and
            SIRT3 to regulate the pyruvate dehydrogenase complex
  JOURNAL   Mol Cell 53 (4), 534-548 (2014)
   PUBMED   24486017
  REMARK    GeneRIF: the pyruvate dehydrogenase complex is regulated by Tyr
            phosphorylation of PDP1, which toggles recruitment between ACAT1
            and SIRT3
REFERENCE   6  (bases 1 to 4245)
  AUTHORS   Korotchkina LG and Patel MS.
  TITLE     Mutagenesis studies of the phosphorylation sites of recombinant
            human pyruvate dehydrogenase. Site-specific regulation
  JOURNAL   J Biol Chem 270 (24), 14297-14304 (1995)
   PUBMED   7782287
REFERENCE   7  (bases 1 to 4245)
  AUTHORS   Ganetzky,R., McCormick,E.M. and Falk,M.J.
  TITLE     Primary Pyruvate Dehydrogenase Complex Deficiency Overview
  JOURNAL   (in) Adam MP, Everman DB, Mirzaa GM, Pagon RA, Wallace SE, Bean
            LJH, Gripp KW and Amemiya A (Eds.);
            GENEREVIEWS((R));
            (1993)
   PUBMED   34138529
REFERENCE   8  (bases 1 to 4245)
  AUTHORS   Ito M, Kobashi H, Naito E, Saijo T, Takeda E, Huq AH and Kuroda Y.
  TITLE     Decrease of pyruvate dehydrogenase phosphatase activity in patients
            with congenital lactic acidemia
  JOURNAL   Clin Chim Acta 209 (1-2), 1-7 (1992)
   PUBMED   1327585
  REMARK    GeneRIF: In cultured skin fibroblasts from three patients with
            congenital lactic acidemia due to a defect in activation of the
            pyruvate dehydrogenase complex, the PDP-activity was significantly
            reduced to 50.7%, 64.6% and 63.1% of that of control fibroblasts.
REFERENCE   9  (bases 1 to 4245)
  AUTHORS   Teague,W.M., Pettit,F.H., Wu,T.L., Silberman,S.R. and Reed,L.J.
  TITLE     Purification and properties of pyruvate dehydrogenase phosphatase
            from bovine heart and kidney
  JOURNAL   Biochemistry 21 (22), 5585-5592 (1982)
   PUBMED   6293549
REFERENCE   10 (bases 1 to 4245)
  AUTHORS   Robinson,B.H. and Sherwood,W.G.
  TITLE     Pyruvate dehydrogenase phosphatase deficiency: a cause of
            congenital chronic lactic acidosis in infancy
  JOURNAL   Pediatr Res 9 (12), 935-939 (1975)
   PUBMED   172850
  REMARK    GeneRIF: In postmortem tissue samples, from male child with
            metabolic acidosis, PDK normally reduced PDH-activity in
            ATP-presence. Addition of Ca++ and Mg++ did not restored
            PDH-activity. The defect was attributed to a markedly reduced
            PDP-activity.
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AC084346.3, DA507397.1,
            BC064978.1, AK126862.1 and BX099681.1.
            On May 31, 2019 this sequence version replaced NM_001161780.1.
            
            Summary: Pyruvate dehydrogenase (E1) is one of the three components
            (E1, E2, and E3) of the large pyruvate dehydrogenase complex.
            Pyruvate dehydrogenase kinases catalyze phosphorylation of serine
            residues of E1 to inactivate the E1 component and inhibit the
            complex. Pyruvate dehydrogenase phosphatases catalyze the
            dephosphorylation and activation of the E1 component to reverse the
            effects of pyruvate dehydrogenase kinases. Pyruvate dehydrogenase
            phosphatase is a heterodimer consisting of catalytic and regulatory
            subunits. Two catalytic subunits have been reported; one is
            predominantly expressed in skeletal muscle and another one is is
            much more abundant in the liver. The catalytic subunit, encoded by
            this gene, is the former, and belongs to the protein phosphatase 2C
            (PP2C) superfamily. Along with the pyruvate dehydrogenase complex
            and pyruvate dehydrogenase kinases, this enzyme is located in the
            mitochondrial matrix. Mutation in this gene causes pyruvate
            dehydrogenase phosphatase deficiency. Multiple alternatively
            spliced transcript variants encoding different isoforms have been
            identified.[provided by RefSeq, Jun 2009].
            
            Transcript Variant: This variant (3) lacks an internal segment in
            the 5' UTR, compared to variant 2. Variants 2 and 3 encode the same
            isoform 2.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR1660805.18962.1,
                                           SRR1660805.232593.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA1965299, SAMEA1968540
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            gene product(s) localized to mito. :: reported by MitoCarta
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-11                AC084346.3         27525-27535         c
            12-27               DA507397.1         1-16
            28-2553             BC064978.1         1-2526
            2554-4243           AK126862.1         2964-4653
            4244-4245           BX099681.1         512-513
FEATURES             Location/Qualifiers
     source          1..4245
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="8"
                     /map="8q22.1"
     gene            1..4245
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /note="pyruvate dehydrogenase phosphatase catalytic
                     subunit 1"
                     /db_xref="GeneID:54704"
                     /db_xref="HGNC:HGNC:9279"
                     /db_xref="MIM:605993"
     exon            1..157
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /inference="alignment:Splign:2.1.0"
     variation       2
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810074135"
     variation       3
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810074218"
     variation       4..5
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:760573422"
     variation       4
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810074282"
     variation       5
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1039498506"
     variation       6..9
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1395557144"
     variation       6
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1162878595"
     variation       7
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752507773"
     variation       8
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1446133679"
     variation       9
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755659401"
     variation       10
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763511119"
     variation       13
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753531431"
     variation       14
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756885157"
     variation       15
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1430657457"
     variation       17
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:751952560"
     variation       18
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755268904"
     variation       20
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1563513283"
     variation       21
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1005518057"
     variation       22
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:781730023"
     variation       23
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:938444187"
     variation       24
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748591846"
     variation       25..28
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="ag"
                     /replace="agag"
                     /db_xref="dbSNP:1427057288"
     variation       26
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1056939016"
     variation       27
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810076090"
     variation       28
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1228833359"
     variation       29
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1365153137"
     variation       30
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1329526076"
     variation       32
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769982392"
     variation       34
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1282373433"
     variation       35
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810076576"
     variation       36
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1037584537"
     variation       37
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1324267971"
     variation       38
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777681394"
     variation       39..43
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="ggggg"
                     /replace="gggggg"
                     /db_xref="dbSNP:766339112"
     variation       39
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749570657"
     variation       40
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1400875396"
     variation       41
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771299570"
     variation       42
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759405446"
     variation       43
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771703282"
     variation       45..47
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="gag"
                     /replace="gagag"
                     /db_xref="dbSNP:752725428"
     variation       47
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1034176898"
     variation       50
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775552151"
     variation       51
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199202337"
     variation       52
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:570396595"
     variation       53
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1481742088"
     variation       54
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1439153237"
     variation       55
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:959883058"
     variation       56
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753371996"
     variation       58
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1810078989"
     variation       59
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761273137"
     variation       60
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764874879"
     variation       61
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388906916"
     variation       62
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750022171"
     variation       63
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810079461"
     variation       64
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755429761"
     variation       66
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202016823"
     variation       67
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1345915884"
     variation       68
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218946595"
     variation       72
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781404802"
     variation       74
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:527903830"
     variation       75
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756556074"
     variation       77
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237059557"
     variation       78
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749406937"
     variation       79
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1280759422"
     variation       80
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:771064281"
     variation       81
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779287937"
     variation       83
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746071530"
     variation       85..88
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="ag"
                     /replace="agag"
                     /db_xref="dbSNP:1490949992"
     variation       85
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:978382018"
     variation       86
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1434626760"
     variation       89
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1810080932"
     variation       90
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771944772"
     variation       93
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775128777"
     variation       95
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760474141"
     variation       96
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1409357340"
     variation       98
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810081392"
     variation       102
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1810081472"
     variation       103
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1184148219"
     variation       105
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810081623"
     variation       106
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1366795418"
     variation       107
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768510527"
     variation       113..117
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="ccccc"
                     /replace="cccccc"
                     /db_xref="dbSNP:1164465605"
     variation       113
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1023787451"
     variation       115
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810082098"
     variation       117
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1426350489"
     variation       119
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1424240945"
     variation       120
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1563513451"
     variation       121..137
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="tcgt"
                     /replace="tcgtcgggaagaatcgt"
                     /db_xref="dbSNP:758487883"
     variation       122
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1586148685"
     variation       123
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1296207271"
     variation       124
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776484586"
     variation       125
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:904119935"
     variation       127
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761326355"
     variation       128
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764715116"
     variation       129
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:532831481"
     variation       130
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1481790806"
     variation       131
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762480054"
     variation       135
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372548037"
     variation       136
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753025018"
     variation       141
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1248083371"
     variation       142
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:975648530"
     variation       143
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357634845"
     variation       145
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1810083566"
     variation       146
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1217888865"
     variation       148
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1001491146"
     variation       151
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756461276"
     variation       153
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810083876"
     variation       154
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1251094989"
     variation       157
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764697879"
     exon            158..192
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /inference="alignment:Splign:2.1.0"
     variation       158
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1563514224"
     variation       159
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1586150449"
     variation       160
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1468515662"
     CDS             162..1850
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /EC_number="3.1.3.43"
                     /note="isoform 2 is encoded by transcript variant 3;
                     pyruvate dehydrogenase (Lipoamide)
                     phosphatase-phosphatase; [Pyruvate dehydrogenase
                     [acetyl-transferring]]-phosphatase 1, mitochondrial;
                     protein phosphatase 2C, magnesium-dependent, catalytic
                     subunit; PDP 1; PDPC 1; pyruvate dehyrogenase phosphatase
                     catalytic subunit 1; protein phosphatase, Mg2+/Mn2+
                     dependent 2A"
                     /codon_start=1
                     /product="pyruvate dehyrogenase phosphatase catalytic
                     subunit 1 isoform 2"
                     /protein_id="NP_001155252.1"
                     /db_xref="CCDS:CCDS55262.1"
                     /db_xref="GeneID:54704"
                     /db_xref="HGNC:HGNC:9279"
                     /db_xref="MIM:605993"
                     /translation="
MCVCPGPRRIGIPVRSSSLPLFSDAMPAPTQLFFPLIRNCELSRIYGTACYCHHKHLCCSSSYIPQSRLRYTPHPAYATFCRPKENWWQYTQGRRYASTPQKFYLTPPQVNSILKANEYSFKVPEFDGKNVSSILGFDSNQLPANAPIEDRRSAATCLQTRGMLLGVFDGHAGCACSQAVSERLFYYIAVSLLPHETLLEIENAVESGRALLPILQWHKHPNDYFSKEASKLYFNSLRTYWQELIDLNTGESTDIDVKEALINAFKRLDNDISLEAQVGDPNSFLNYLVLRVAFSGATACVAHVDGVDLHVANTGDSRAMLGVQEEDGSWSAVTLSNDHNAQNERELERLKLEHPKSEAKSVVKQDRLLGLLMPFRAFGDVKFKWSIDLQKRVIESGPDQLNDNEYTKFIPPNYHTPPYLTAEPEVTYHRLRPQDKFLVLATDGLWETMHRQDVVRIVGEYLTGMHHQQPIAVGGYKVTLGQMHGLLTERRTKMSSVFEDQNAATHLIRHAVGNNEFGTVDHERLSKMLSLPEELARMYRDDITIIVVQFNSHVVGAYQNQE"
     misc_feature    561..1811
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /note="Serine/threonine phosphatases, family 2C, catalytic
                     domain; The protein architecture and deduced catalytic
                     mechanism of PP2C phosphatases are similar to the PP1,
                     PP2A, PP2B family of protein Ser/Thr phosphatases, with
                     which PP2C shares no sequence...; Region: PP2Cc; cd00143"
                     /db_xref="CDD:238083"
     variation       162
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1563514231"
     variation       163..173
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="tgtgtgtgt"
                     /replace="tgtgtgtgtgt"
                     /replace="tgtgtgtgtgtgt"
                     /db_xref="dbSNP:746354729"
     variation       163
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755168595"
     variation       164
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1408061261"
     variation       168
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1420280254"
     variation       170
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781341112"
     variation       171
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752519178"
     variation       175
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1810135540"
     variation       176
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1425733891"
     variation       177
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1305319365"
     variation       180
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755840386"
     variation       184
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777581092"
     variation       187
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749231431"
     exon            193..4245
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /inference="alignment:Splign:2.1.0"
     variation       195
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368896704"
     variation       196
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1586155428"
     variation       198
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745378971"
     variation       200
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1364739021"
     variation       201..205
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="gtcag"
                     /replace="gtcaggtcag"
                     /db_xref="dbSNP:1370605731"
     variation       203
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1810287781"
     variation       205
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810287881"
     variation       209
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810287985"
     variation       210
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76597597"
     variation       211
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1189211504"
     variation       212
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771654817"
     variation       213
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:779914919"
     variation       214
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746656680"
     variation       218
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810288612"
     variation       219
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810288710"
     variation       221
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1810288804"
     variation       222..233
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace=""
                     /replace="ctgttctctgat"
                     /db_xref="dbSNP:1810288894"
     variation       223
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:748745930"
     variation       224
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373914341"
     variation       227
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:767109728"
     variation       232
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763177277"
     variation       233
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:771499042"
     variation       237
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1810289614"
     variation       237
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774772187"
     variation       240
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1810289740"
     variation       241
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775877089"
     variation       243
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1429816363"
     variation       246
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1176613427"
     variation       248
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1372371856"
     variation       249
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759621538"
     variation       250
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376864107"
     variation       252
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775755715"
     variation       254
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760854097"
     variation       256
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:763841975"
     variation       257
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:938860566"
     variation       258
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753700131"
     variation       260
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756937580"
     variation       261
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371323550"
     variation       263
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810292428"
     variation       264
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1194411687"
     variation       265
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1265784802"
     variation       266
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1165035821"
     variation       267
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1479620586"
     variation       268
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765234818"
     variation       269
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1430548332"
     variation       270
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1479065511"
     variation       271
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810293398"
     variation       272
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1156859958"
     variation       273
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750372945"
     variation       274
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758052799"
     variation       279..287
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace=""
                     /replace="tgtgaactg"
                     /db_xref="dbSNP:1810294050"
     variation       279..282
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="tg"
                     /replace="tgtg"
                     /db_xref="dbSNP:1810293931"
     variation       279
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1563516401"
     variation       280
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1320461110"
     variation       281
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1479982264"
     variation       282
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:933577219"
     variation       283
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:760929995"
     variation       286
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746711864"
     variation       287
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1282600469"
     variation       288..289
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1810294834"
     variation       291
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810294935"
     variation       292..293
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace=""
                     /replace="tgccata"
                     /db_xref="dbSNP:1810295364"
     variation       292
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754684543"
     variation       295
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1242611946"
     variation       297..303
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace=""
                     /replace="tatggca"
                     /db_xref="dbSNP:1810295655"
     variation       298
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780665993"
     variation       299
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:913383064"
     variation       300
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1349585131"
     variation       301
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1205354976"
     variation       302
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749664764"
     variation       304
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771139058"
     variation       306
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1222161777"
     variation       308
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1810296836"
     variation       308
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:987721531"
     variation       309
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774892672"
     variation       310
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746369657"
     variation       320
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772178775"
     variation       323
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758947272"
     variation       325
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1160705799"
     variation       327
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201452113"
     variation       328
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764383471"
     variation       329..333
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="tct"
                     /replace="tctct"
                     /db_xref="dbSNP:1563516518"
     variation       329
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810297907"
     variation       338
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:946150868"
     variation       343
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1383581551"
     variation       346
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1422562484"
     variation       347
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761727112"
     variation       348
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:910786213"
     variation       358
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1391438201"
     variation       360
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758390717"
     variation       363..378
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="cgactgagatacacac"
                     /db_xref="dbSNP:1326691312"
     variation       363
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766372826"
     variation       364
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201081450"
     variation       365
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810299528"
     variation       366
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754376963"
     variation       367
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780907656"
     variation       369
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1038084499"
     variation       371
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:920703647"
     variation       372
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:942679751"
     variation       374
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:929341745"
     variation       375
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1356784813"
     variation       376
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810300758"
     variation       379
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1245761871"
     variation       381
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747738989"
     variation       387
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1156387306"
     variation       390
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140713866"
     variation       407
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1194600876"
     variation       408
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1182983060"
     variation       410
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810301262"
     variation       416
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1250372108"
     variation       419
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779217265"
     variation       422
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810301658"
     variation       428
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1180557441"
     variation       431
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375147234"
     variation       432
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:569067471"
     variation       434
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1162764061"
     variation       437
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775911139"
     variation       438
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374758737"
     variation       439
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810302478"
     variation       448
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776979550"
     variation       449
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1341527454"
     variation       450
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761913953"
     variation       451
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769765131"
     variation       454
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313483450"
     variation       455
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810303209"
     variation       458
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810303321"
     variation       462
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:773166625"
     variation       472
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1586156056"
     variation       475
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:79439881"
     variation       479
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1586156086"
     variation       485
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1232628417"
     variation       493
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762798871"
     variation       497
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144544236"
     variation       498
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1315244025"
     variation       499
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810304419"
     variation       507
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751392690"
     variation       510
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759139812"
     variation       512
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766927852"
     variation       513
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:267606938"
     variation       514
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1356598094"
     variation       520
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368756677"
     variation       524
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:866576381"
     variation       533
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1810305371"
     variation       541
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1400367432"
     variation       542
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755698784"
     variation       543
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777354361"
     variation       555
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1810305855"
     variation       556
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1460873710"
     variation       561
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750815139"
     variation       564
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758705968"
     variation       576
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1425365458"
     variation       578
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780597558"
     variation       579
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810306800"
     variation       580
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1349982297"
     variation       581
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768820696"
     variation       586
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1260992739"
     variation       587
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781113804"
     variation       590
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:879894213"
     variation       593
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1563516814"
     variation       594
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403285296"
     variation       597
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810307776"
     variation       598
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1055081238"
     variation       599
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1383097505"
     variation       600
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748213138"
     variation       601
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810308290"
     variation       603
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144604949"
     variation       604
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1380853009"
     variation       605
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810308684"
     variation       612
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:565152013"
     variation       613
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147845975"
     variation       614
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759361135"
     variation       619
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1261352075"
     variation       620
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810309294"
     variation       623
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1221006592"
     variation       630
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810309498"
     variation       633
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767102971"
     variation       640
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752170333"
     variation       641
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376531662"
     variation       642
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201131767"
     variation       643
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1258027306"
     variation       654
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141399719"
     variation       655
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810310387"
     variation       657
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151019488"
     variation       659
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368265235"
     variation       660
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1563516924"
     variation       661..665
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="tttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:768282589"
     variation       667
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1444082593"
     variation       670
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810311039"
     variation       672
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1259886475"
     variation       680
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1034416981"
     variation       692
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1325670533"
     variation       695
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1293116223"
     variation       699
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388163272"
     variation       703..783
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="ct"
                     /replace="gtgaaagactcttttattatattgctgtctctttgttaccccatgaga
                     ctttgctagagattgaaaatgcagtggagagcg"
                     /db_xref="dbSNP:1554572659"
     variation       713
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1477993393"
     variation       714..717
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="tt"
                     /replace="tttt"
                     /db_xref="dbSNP:1159542570"
     variation       718
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1195787646"
     variation       719
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758829356"
     variation       722
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1479847882"
     variation       723
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810312368"
     variation       728
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780250994"
     variation       729
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752161030"
     variation       730..734
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="tct"
                     /replace="tctct"
                     /db_xref="dbSNP:1459398078"
     variation       734..736
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1810312864"
     variation       737
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755465648"
     variation       746
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200661557"
     variation       748
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:954908409"
     variation       751
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750529031"
     variation       752..754
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="t"
                     /replace="ttt"
                     /db_xref="dbSNP:1810313424"
     variation       754
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1173424572"
     variation       760
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361584375"
     variation       764
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1462912167"
     variation       771
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769934912"
     variation       772
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778196214"
     variation       773
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770886339"
     variation       777
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773995220"
     variation       778
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810314269"
     variation       781
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1810314386"
     variation       782
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202034256"
     variation       783
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:910824525"
     variation       784
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:965302966"
     variation       785
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771933821"
     variation       786
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775429341"
     variation       787
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760238687"
     variation       791
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810315267"
     variation       792
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763591084"
     variation       793
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:572895007"
     variation       794
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:926037932"
     variation       797
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1191340820"
     variation       801
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810315858"
     variation       806
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764899090"
     variation       809
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1338599597"
     variation       820
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810316215"
     variation       821
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249405051"
     variation       822
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810316414"
     variation       823
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1416730296"
     variation       826
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1158315464"
     variation       831
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810316766"
     variation       832
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810316858"
     variation       833
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810316964"
     variation       835
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810317054"
     variation       836
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:541907484"
     variation       837
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810317336"
     variation       843
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403574457"
     variation       845
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380484397"
     variation       846
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767925776"
     variation       854
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1692583055"
     variation       856
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1563517129"
     variation       859
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753240948"
     variation       871
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1312464903"
     variation       877
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200145429"
     variation       887
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777966209"
     variation       890
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749570505"
     variation       893
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374859758"
     variation       895
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810318610"
     variation       898
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810318717"
     variation       902
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1390854082"
     variation       904
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1378517517"
     variation       905
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138512618"
     variation       907
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140780685"
     variation       911
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810319409"
     variation       914
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199977411"
     variation       916
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771889434"
     variation       917
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369055053"
     variation       920
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757895185"
     variation       924
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1467889708"
     variation       925
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201467137"
     variation       926
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776144330"
     variation       927
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:929292514"
     variation       929
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761277113"
     variation       933
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1236640497"
     variation       941
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764804506"
     variation       942
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772866221"
     variation       953
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150112501"
     variation       957
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810321813"
     variation       961
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1452757212"
     variation       967
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1240116075"
     variation       969
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810322200"
     variation       970
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:928023340"
     variation       973
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1385010412"
     variation       974
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767917111"
     variation       977
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1167569662"
     variation       983
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1810322911"
     variation       986
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810323053"
     variation       989
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138553326"
     variation       991
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1586156901"
     variation       992
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1586156914"
     variation       997
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:939189186"
     variation       1008
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1332115818"
     variation       1012
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750473319"
     variation       1013
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753292297"
     variation       1014
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1586156955"
     variation       1016
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140224111"
     variation       1018
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145915456"
     variation       1019
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1665467605"
     variation       1021
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:754001678"
     variation       1027
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1291984139"
     variation       1033
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757292942"
     variation       1040
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779015042"
     variation       1041..1044
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1810325171"
     variation       1043
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:746100755"
     variation       1046
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1810325442"
     variation       1052
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758169742"
     variation       1055
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1181382457"
     variation       1056
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866475428"
     variation       1064
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779802119"
     variation       1066
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1563517331"
     variation       1067
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746758163"
     variation       1069
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1011203506"
     variation       1076..1083
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="tg"
                     /replace="tggtgttg"
                     /db_xref="dbSNP:1810326385"
     variation       1078
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1183941927"
     variation       1079
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1418063103"
     variation       1080
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1409895008"
     variation       1083
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768615485"
     variation       1085
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1402568352"
     variation       1085
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="caccatc"
                     /db_xref="dbSNP:1810327231"
     variation       1086..1089
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="cttc"
                     /db_xref="dbSNP:1554572756"
     variation       1086
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468256144"
     variation       1091
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201021364"
     variation       1092
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810327700"
     variation       1099
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747673653"
     variation       1102
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810327956"
     variation       1103
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810328088"
     variation       1106
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:561440517"
     variation       1107
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772803719"
     variation       1114
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762632055"
     variation       1119
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1217941564"
     variation       1120
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810328787"
     variation       1122
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758604713"
     variation       1127
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1586157145"
     variation       1128
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373016029"
     variation       1130
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1335748032"
     variation       1133
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776018911"
     variation       1134
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780162130"
     variation       1136
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761080494"
     variation       1141
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1442631477"
     variation       1142
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138488258"
     variation       1145
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146222349"
     variation       1149
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149633208"
     variation       1151
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1433093409"
     variation       1155
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765330955"
     variation       1162
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750660703"
     variation       1163
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758670020"
     variation       1166
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1469669186"
     variation       1170
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175769887"
     variation       1171
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1034056443"
     variation       1173
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780213686"
     variation       1180
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751365113"
     variation       1187
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754713600"
     variation       1190
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1399111336"
     variation       1193
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1810331392"
     variation       1195
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:993085903"
     variation       1199
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1256562891"
     variation       1202
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1586157308"
     variation       1203
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370143029"
     variation       1206
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810332027"
     variation       1207
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748108713"
     variation       1208
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1405922286"
     variation       1212
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1020506319"
     variation       1215
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373354872"
     variation       1216
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:529355400"
     variation       1217
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1762062610"
     variation       1225
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1563517539"
     variation       1226
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1009082221"
     variation       1229
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200054483"
     variation       1231
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867300834"
     variation       1237
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770737506"
     variation       1238
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774080309"
     variation       1240
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1217762974"
     variation       1242
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810333790"
     variation       1245
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1266029999"
     variation       1247
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761133347"
     variation       1248
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769128065"
     variation       1252
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810334264"
     variation       1253
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1378281602"
     variation       1257
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144339806"
     variation       1260
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762362258"
     variation       1265
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755900273"
     variation       1266
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534701211"
     variation       1269..1270
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:774046054"
     variation       1271
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810335164"
     variation       1280
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810335276"
     variation       1292
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810335411"
     variation       1296
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810335517"
     variation       1301
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1413302433"
     variation       1302
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1362455272"
     variation       1304
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769050733"
     variation       1306
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1586157492"
     variation       1321
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1586157498"
     variation       1325
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1362742185"
     variation       1326
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750548247"
     variation       1331
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810336586"
     variation       1340
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762878527"
     variation       1343
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766605438"
     variation       1346
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:920842077"
     variation       1355
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751770350"
     variation       1365
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:754838278"
     variation       1366
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780930808"
     variation       1372
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810337427"
     variation       1375
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1810337541"
     variation       1378
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810337654"
     variation       1379
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752624152"
     variation       1381
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810337880"
     variation       1382
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1331534041"
     variation       1383
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810338002"
     variation       1386
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1235054959"
     variation       1389
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:777603105"
     variation       1392
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810338343"
     variation       1394
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777530209"
     variation       1395..1396
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1563517726"
     variation       1397
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1357655892"
     variation       1398
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1810338676"
     variation       1404
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:983434744"
     variation       1405
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:748834473"
     variation       1407
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:756767503"
     variation       1409
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:928051107"
     variation       1410
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810339237"
     variation       1412
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778764676"
     variation       1418
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745485872"
     variation       1431
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1586157581"
     variation       1440
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769193664"
     variation       1441
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810339813"
     variation       1445
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777075890"
     variation       1448
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810340057"
     variation       1449
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377342640"
     variation       1450
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770342233"
     variation       1453
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1162626364"
     variation       1455
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1810340497"
     variation       1464
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369447724"
     variation       1465
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763153521"
     variation       1468
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1328667103"
     variation       1469
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374326474"
     variation       1476
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1810341106"
     variation       1478
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148348306"
     variation       1482
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810341326"
     variation       1487
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774592444"
     variation       1491
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810341564"
     variation       1494
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759729815"
     variation       1499
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1057524261"
     variation       1503
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767674134"
     variation       1505..1507
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="t"
                     /replace="tat"
                     /db_xref="dbSNP:1199379470"
     variation       1506
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260117347"
     variation       1510
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200222464"
     variation       1511
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:907768890"
     variation       1513
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1266586674"
     variation       1517
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141493326"
     variation       1518
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1194223223"
     variation       1519
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1586157708"
     variation       1520
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753703262"
     variation       1521
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810343175"
     variation       1528
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1458225483"
     variation       1536
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810343367"
     variation       1538
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1586157729"
     variation       1540
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756892474"
     variation       1542
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1241490062"
     variation       1543
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1586157747"
     variation       1547
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:778545811"
     variation       1549
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1186546565"
     variation       1550
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1586157767"
     variation       1551
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1369041122"
     variation       1552
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745323862"
     variation       1554
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758156720"
     variation       1558
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779506684"
     variation       1560
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1465644044"
     variation       1561
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1586157809"
     variation       1565
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:748562555"
     variation       1568
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810345119"
     variation       1571
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1399570414"
     variation       1572
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1271089455"
     variation       1575
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1810345449"
     variation       1577
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770046269"
     variation       1578
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749168775"
     variation       1585
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1313878083"
     variation       1586
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1810345933"
     variation       1590
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773838560"
     variation       1591
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749767366"
     variation       1592
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771044295"
     variation       1594
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1586157850"
     variation       1596
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1318736953"
     variation       1599
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373946288"
     variation       1601
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393707661"
     variation       1602
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759570204"
     variation       1608
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1162666131"
     variation       1609
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1483038614"
     variation       1611
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767783621"
     variation       1616..1622
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace=""
                     /replace="cctttta"
                     /db_xref="dbSNP:747806749"
     variation       1617
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1810347404"
     variation       1627
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1810347517"
     variation       1628
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1810347624"
     variation       1629
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775515661"
     variation       1634
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760576538"
     variation       1636..1637
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1419977863"
     variation       1636
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763792118"
     variation       1638
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377553463"
     variation       1643
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810348348"
     variation       1644
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1001324533"
     variation       1645
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810348566"
     variation       1648
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:935020452"
     variation       1649
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757283913"
     variation       1651
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810348988"
     variation       1652
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1465239814"
     variation       1653
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201132164"
     variation       1659
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749959908"
     variation       1661
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:757927785"
     variation       1664
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1298166583"
     variation       1665
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779817145"
     variation       1667
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147477305"
     variation       1668
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756545344"
     variation       1670
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:117294206"
     variation       1682
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137975172"
     variation       1683
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370390664"
     variation       1685
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1484129448"
     variation       1686
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745958515"
     variation       1687
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1262447510"
     variation       1689..1704
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="ca"
                     /replace="cacgctgtgggcaaca"
                     /db_xref="dbSNP:771873073"
     variation       1691
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374262682"
     variation       1692
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810351360"
     variation       1693
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:995004664"
     variation       1697
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775848242"
     variation       1700
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810351741"
     variation       1702
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760776715"
     variation       1703
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1176378785"
     variation       1706
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768875523"
     variation       1707
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1418312363"
     variation       1709
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:950920384"
     variation       1712
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1810352447"
     variation       1717
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776599018"
     variation       1718
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1810352688"
     variation       1719
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1402398202"
     variation       1725
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1323902385"
     variation       1729
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1292230349"
     variation       1730
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448911693"
     variation       1731
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761636189"
     variation       1732
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376060350"
     variation       1736
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810353550"
     variation       1738
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750375166"
     variation       1739
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762593464"
     variation       1740
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1034983010"
     variation       1743
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810353866"
     variation       1746
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810353960"
     variation       1749
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426876089"
     variation       1750
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1173908896"
     variation       1756
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145358369"
     variation       1763
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751277921"
     variation       1768
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1390930889"
     variation       1770
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202225648"
     variation       1774
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1354080949"
     variation       1775
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810354838"
     variation       1778
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1392741717"
     variation       1781
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754605931"
     variation       1787
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1244873240"
     variation       1788
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:960823238"
     variation       1789
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1000839362"
     variation       1794
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202145000"
     variation       1803
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754204252"
     variation       1805
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810355695"
     variation       1806
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147237491"
     variation       1813
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779452040"
     variation       1815
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746369671"
     variation       1818
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1810356133"
     variation       1819..1820
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace=""
                     /replace="at"
                     /db_xref="dbSNP:1421851629"
     variation       1820..1825
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="tgt"
                     /replace="tgttgt"
                     /db_xref="dbSNP:1810356343"
     variation       1821
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772232968"
     variation       1822
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1349778302"
     variation       1824
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780020258"
     variation       1825
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1388317775"
     variation       1827..1830
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:772846653"
     variation       1828
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:922649401"
     variation       1829
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747071043"
     variation       1830
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1446340264"
     variation       1831
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768767735"
     variation       1832
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:535568386"
     variation       1833
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1554572967"
     variation       1834
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1301017354"
     variation       1836
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810357815"
     variation       1840
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1563518260"
     variation       1842
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1347339456"
     variation       1843
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810358093"
     variation       1844
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1225231679"
     variation       1850
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139199750"
     variation       1851
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761761105"
     variation       1852
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769711015"
     variation       1863
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810358632"
     variation       1864
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773326652"
     variation       1865
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1563518294"
     variation       1866
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:762781777"
     variation       1870
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766287359"
     variation       1872
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:555465685"
     variation       1875
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:41272415"
     variation       1881
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759016944"
     variation       1883
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1374028282"
     variation       1886
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:4735258"
     variation       1887
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752331175"
     variation       1888
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757684185"
     variation       1889
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765555188"
     variation       1890
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1167455601"
     variation       1893
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1398229939"
     variation       1896
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750976092"
     variation       1897
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1332348672"
     variation       1899
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:192535454"
     variation       1901
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149521176"
     variation       1903
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444561453"
     variation       1908
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:937129706"
     variation       1909..1913
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1810360752"
     variation       1909
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:540479716"
     variation       1915
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144036151"
     variation       1918
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1810360951"
     variation       1920
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810361039"
     variation       1921
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148691545"
     variation       1923
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1469001009"
     variation       1925
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810361304"
     variation       1926
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810361372"
     variation       1932
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542596810"
     variation       1935
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810361548"
     variation       1937
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1212037028"
     variation       1942
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1485500856"
     variation       1943
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144473673"
     variation       1945
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1180625523"
     variation       1946
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1586158506"
     variation       1949
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1014002246"
     variation       1951
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1317623288"
     variation       1961
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:898227530"
     variation       1963..1966
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="tttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:1810362336"
     variation       1969
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1222022654"
     variation       1970
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1810362570"
     variation       1970
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810362497"
     variation       1971
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357219682"
     variation       1973
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1251170653"
     variation       1976
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810362804"
     variation       1984
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810362904"
     variation       1985
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1477729607"
     variation       1988
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810363050"
     variation       1989
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1810363132"
     variation       1990
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810363225"
     variation       1991
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810363296"
     variation       1993
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:995434184"
     variation       2004
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810363509"
     variation       2008
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:760027289"
     variation       2009
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373290434"
     variation       2010
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1810363747"
     variation       2014
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1027794562"
     variation       2015
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810363930"
     variation       2017
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1290236375"
     variation       2021
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1453962892"
     variation       2022
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1810364162"
     variation       2025
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810364245"
     variation       2028
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810364338"
     variation       2030
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577643189"
     variation       2034
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1586158569"
     variation       2038
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1344115398"
     variation       2040
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810364668"
     variation       2044
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810364748"
     variation       2046
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:902849966"
     variation       2054
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1000487025"
     variation       2057
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810364983"
     variation       2060
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810365069"
     variation       2062
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:886696693"
     variation       2063
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810365256"
     variation       2073
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:964247451"
     variation       2074
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1427517574"
     variation       2075
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189155613"
     variation       2078
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1475065358"
     variation       2079
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1810365824"
     variation       2080
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1005095971"
     variation       2081
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1810365974"
     variation       2091
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810366048"
     variation       2092
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1035265918"
     variation       2094
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1188525833"
     variation       2096
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1168196056"
     variation       2099
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810366390"
     variation       2106
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810366469"
     variation       2113
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1586158625"
     variation       2114
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1810366652"
     variation       2117
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1810366730"
     variation       2120
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1213733305"
     variation       2123
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810366902"
     variation       2127
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1810367040"
     variation       2129
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810367125"
     variation       2130..2133
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="aa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1336933546"
     variation       2130
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1273718352"
     variation       2136
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810367412"
     variation       2137
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810367509"
     variation       2138
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1810367592"
     variation       2141
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769186837"
     variation       2143..2145
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="cct"
                     /replace="cctcct"
                     /db_xref="dbSNP:1810367792"
     variation       2151
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:531689009"
     variation       2152
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1810367965"
     variation       2156
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:990822325"
     variation       2159
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:955478928"
     variation       2161
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1297392561"
     variation       2170
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1382439837"
     variation       2174
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810368392"
     variation       2177
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810368478"
     variation       2182
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1810368579"
     variation       2190
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1024162440"
     variation       2193..2194
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1286671211"
     variation       2196
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1442437129"
     variation       2199
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:982825832"
     variation       2202
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810368996"
     variation       2203
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:968136012"
     variation       2204..2205
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1810369140"
     variation       2206
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1810369221"
     variation       2209
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810369293"
     variation       2214
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1166321427"
     variation       2218
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:551728387"
     variation       2219
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810369529"
     variation       2223
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185126352"
     variation       2232
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1810369678"
     variation       2233
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810369743"
     variation       2234..2236
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1328899784"
     variation       2236
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:956536787"
     variation       2241
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810370027"
     variation       2243
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:527981638"
     variation       2248..2249
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1810370191"
     variation       2250
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1810370275"
     variation       2252
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:986714561"
     variation       2254
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810370407"
     variation       2259
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1261284481"
     variation       2267
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810370588"
     variation       2268
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810370647"
     variation       2270
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:548043412"
     variation       2271
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1275134737"
     variation       2288
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1469856049"
     variation       2295
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1253661559"
     variation       2301
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1810370988"
     variation       2302
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:566488276"
     variation       2307
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346615463"
     variation       2308
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:535475031"
     variation       2314
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810371325"
     variation       2316
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810371392"
     variation       2317
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1332517927"
     variation       2318
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1217189585"
     variation       2319
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810371627"
     variation       2320
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810371721"
     variation       2322
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:920481544"
     variation       2324
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1586158751"
     variation       2328
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1319247318"
     variation       2332
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306609372"
     variation       2334
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810372165"
     variation       2340
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1586158764"
     variation       2341
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:41272417"
     variation       2345
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1586158774"
     variation       2347
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1810372474"
     variation       2349
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1586158776"
     variation       2351
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:991351188"
     variation       2353
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1586158788"
     variation       2357
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:942385274"
     variation       2358
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1271794471"
     variation       2359
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199846257"
     variation       2361
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810373052"
     variation       2366
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199653570"
     variation       2369
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1324566563"
     variation       2371
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810373288"
     variation       2372
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810373362"
     variation       2375..2376
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1810373427"
     variation       2379
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:949822357"
     variation       2383
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1389203537"
     variation       2386..2387
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1300331985"
     variation       2402
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810373754"
     variation       2414
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1248681855"
     variation       2416
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78884124"
     variation       2418
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1166983566"
     variation       2420
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1191275181"
     variation       2421
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810374192"
     variation       2423..2428
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="ctt"
                     /replace="cttctt"
                     /db_xref="dbSNP:1395784719"
     variation       2423
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:879133259"
     variation       2424
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810374430"
     variation       2436
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:919681917"
     variation       2439
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1252550961"
     variation       2442
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537935933"
     variation       2447..2448
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1810374701"
     variation       2448
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:557676479"
     variation       2449
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1049258200"
     variation       2451
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810374934"
     variation       2452..2456
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="atcca"
                     /db_xref="dbSNP:1810375084"
     variation       2452
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1236055958"
     variation       2453
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810375180"
     variation       2457
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810375255"
     variation       2459
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:935627684"
     variation       2460
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190420045"
     variation       2466
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810375534"
     variation       2469
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810375597"
     variation       2471
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:545692596"
     variation       2479
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192629673"
     variation       2481
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:911"
     variation       2489
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147461233"
     variation       2495
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762341289"
     variation       2500
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1012679769"
     variation       2505..2506
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1810376370"
     variation       2505
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185015320"
     variation       2511
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306498941"
     variation       2512
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1397699940"
     variation       2516..2518
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:139623857"
     variation       2516
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810376608"
     variation       2517
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1376275422"
     variation       2518
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810376882"
     variation       2526
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810376955"
     variation       2531
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1004259967"
     variation       2533
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810377133"
     variation       2538..2544
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="tt"
                     /replace="ttctatt"
                     /db_xref="dbSNP:1220841389"
     variation       2542
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1264257944"
     variation       2543
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1563518721"
     variation       2544..2545
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1810377462"
     variation       2551..2561
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="aaagaaa"
                     /replace="aaagaaagaaa"
                     /db_xref="dbSNP:1356190161"
     variation       2553
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:562533870"
     variation       2559..2565
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:1210513042"
     variation       2561
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554502999"
     variation       2566
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1445517830"
     variation       2568..2574
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="tttttt"
                     /replace="ttttttt"
                     /replace="tttttttt"
                     /db_xref="dbSNP:886063179"
     variation       2570
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:974449846"
     variation       2571
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1264132201"
     variation       2574
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1208160199"
     variation       2575
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1810378343"
     variation       2577
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:545440707"
     variation       2578
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:958899550"
     variation       2579
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810378594"
     variation       2581
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:991403451"
     variation       2584
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1810378745"
     variation       2588
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:917123341"
     variation       2592
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810378881"
     variation       2593
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:886063180"
     variation       2594..2602
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="ttta"
                     /replace="tttagttta"
                     /db_xref="dbSNP:1416983609"
     variation       2596
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810379099"
     variation       2597
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1356378536"
     variation       2599
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1312527124"
     variation       2601..2608
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="taa"
                     /replace="taaaataa"
                     /db_xref="dbSNP:949831779"
     variation       2604
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1387250584"
     variation       2607..2609
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace=""
                     /replace="aag"
                     /db_xref="dbSNP:1159151185"
     variation       2608
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:977173720"
     variation       2613
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1409648120"
     variation       2624
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1189864183"
     variation       2626
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810379727"
     variation       2628..2629
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:1475395656"
     variation       2632
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810379900"
     variation       2636
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810379992"
     variation       2639
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256492792"
     variation       2644
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:924332613"
     variation       2646
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1031038185"
     variation       2649
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810380341"
     variation       2650
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810380411"
     variation       2652
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:935693939"
     variation       2653
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810380588"
     variation       2657
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:188727327"
     variation       2659
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1586159082"
     variation       2662
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765693471"
     variation       2663
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867889115"
     variation       2665
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1204034896"
     variation       2666
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810380986"
     variation       2668
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810381072"
     variation       2669
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810381150"
     variation       2672
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1810381227"
     variation       2679
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1810381282"
     variation       2680
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1329127699"
     variation       2681
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1417289665"
     variation       2683
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1297267343"
     variation       2687
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810381632"
     variation       2688
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1810381703"
     variation       2692
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1235634501"
     variation       2694
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:986580146"
     variation       2697
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810382084"
     variation       2706
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810382167"
     variation       2708
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750465585"
     variation       2709..2714
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="gt"
                     /replace="gtaagt"
                     /db_xref="dbSNP:1293002175"
     variation       2709
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:527854224"
     variation       2715
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1328420035"
     variation       2716
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1319128774"
     variation       2718
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810382747"
     variation       2724
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:572912702"
     variation       2726..2742
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="agactgctgccggggaa"
                     /db_xref="dbSNP:1810382924"
     variation       2727
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1810383003"
     variation       2735
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810383105"
     variation       2736
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:547657737"
     variation       2737
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310947144"
     variation       2744
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810383457"
     variation       2745
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:919561744"
     variation       2748..2753
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="ctt"
                     /replace="cttctt"
                     /db_xref="dbSNP:756226872"
     variation       2749
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1286446525"
     variation       2750
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1586159179"
     variation       2756
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1476229282"
     variation       2758
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1810384043"
     variation       2760
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:7461396"
     variation       2765
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810384188"
     variation       2766
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1242327547"
     variation       2770
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1191895405"
     variation       2772..2775
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="tt"
                     /replace="tttt"
                     /db_xref="dbSNP:1463182645"
     variation       2775
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810384508"
     variation       2777
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1810384585"
     variation       2780
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:180752222"
     variation       2785
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:868659534"
     variation       2793
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1810384888"
     variation       2799
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810384960"
     variation       2803
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1336015880"
     variation       2807
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75265995"
     variation       2808
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1226950074"
     variation       2809
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1810385326"
     variation       2820
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810385409"
     variation       2821
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1341794876"
     variation       2823
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810385611"
     variation       2828
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1270960734"
     variation       2834
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810385768"
     variation       2837
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:908277870"
     variation       2838
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1363145580"
     variation       2839
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:940863202"
     variation       2842
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1810386069"
     variation       2847
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1056610401"
     variation       2849
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810386215"
     variation       2852
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810386301"
     variation       2853..2855
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:35866235"
     variation       2853
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:995587527"
     variation       2855
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1441557830"
     variation       2856..2858
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="t"
                     /replace="tat"
                     /db_xref="dbSNP:1489354538"
     variation       2857
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185360919"
     variation       2865..2871
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="agga"
                     /replace="aggagga"
                     /db_xref="dbSNP:1810386803"
     variation       2866
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1586159265"
     variation       2870
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810387010"
     variation       2879
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1810387177"
     variation       2879
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762919416"
     variation       2893
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810387269"
     variation       2894
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1206702880"
     variation       2897
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1034138769"
     variation       2900
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1447220317"
     variation       2903
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1810387535"
     variation       2905
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810387623"
     variation       2912
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1253756615"
     variation       2914
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1441605991"
     variation       2920
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810387854"
     variation       2926
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1810387924"
     variation       2927
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1188207228"
     variation       2936
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1810388066"
     variation       2939
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810388137"
     variation       2941
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:568829851"
     variation       2944
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1437347199"
     variation       2945..2948
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="at"
                     /replace="atat"
                     /db_xref="dbSNP:1810388364"
     variation       2950
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:540442395"
     variation       2953
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1219879337"
     variation       2962
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1045721938"
     variation       2963
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:537546709"
     variation       2964
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:551427862"
     variation       2966
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1000809204"
     variation       2974..2980
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="atata"
                     /replace="atatata"
                     /db_xref="dbSNP:1810388902"
     variation       2977
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766520277"
     variation       2978
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:971238849"
     variation       2986
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1305810477"
     variation       2989
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810389225"
     variation       2998
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810389289"
     variation       2999
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1421101022"
     variation       3004
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301485300"
     variation       3005
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:956766852"
     variation       3006
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1008031237"
     variation       3007
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1273036747"
     variation       3008
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:977224374"
     variation       3010
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810390112"
     variation       3015
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1019408289"
     variation       3025
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810390268"
     variation       3029
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:964305940"
     variation       3041
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:924456518"
     variation       3043
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810390535"
     variation       3054
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:35793146"
     variation       3056..3074
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace=""
                     /replace="agcagtctccataattata"
                     /db_xref="dbSNP:1810390692"
     variation       3063
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810390752"
     variation       3068..3074
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace=""
                     /replace="aattata"
                     /db_xref="dbSNP:1810390825"
     variation       3069..3076
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="att"
                     /replace="attatatt"
                     /db_xref="dbSNP:1376880719"
     variation       3069
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1173769673"
     variation       3071
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810391047"
     variation       3072
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810391129"
     variation       3073
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810391207"
     variation       3078
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:571367515"
     variation       3085
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1639391979"
     variation       3089
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:751718373"
     variation       3092
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1402005024"
     variation       3093
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1422399427"
     variation       3094
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1190005431"
     variation       3098
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1396942822"
     variation       3100
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:534020211"
     variation       3105
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1810391886"
     variation       3106
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:957387645"
     variation       3110
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1586159439"
     variation       3112
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810392119"
     variation       3114
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1233826471"
     variation       3124
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1336794106"
     variation       3125
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1027308059"
     variation       3126
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1239522269"
     variation       3128..3129
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1211814006"
     variation       3132
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810393175"
     variation       3140
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:920935707"
     variation       3141
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1225393727"
     variation       3142
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1287553123"
     variation       3151
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:952385289"
     variation       3152
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810393696"
     variation       3154..3157
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="t"
                     /replace="tttt"
                     /db_xref="dbSNP:1231397713"
     variation       3167..3169
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1357016456"
     variation       3169
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313147459"
     variation       3170
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1810394014"
     variation       3174
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774244422"
     variation       3183
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:553548239"
     variation       3186
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810394363"
     variation       3187
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1810394444"
     variation       3191
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:573640783"
     variation       3200
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:561592504"
     variation       3209
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810394714"
     variation       3212
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810394791"
     variation       3217
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810394870"
     variation       3220
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:886063182"
     variation       3226
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1409343042"
     variation       3230
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1810395146"
     variation       3232
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1471798591"
     variation       3237
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1810395300"
     variation       3241
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1456336913"
     variation       3254
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1177505434"
     variation       3255
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:992739931"
     variation       3256
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753665809"
     variation       3259
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757140568"
     variation       3264
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1045350359"
     variation       3268
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1376712301"
     variation       3269
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201779185"
     variation       3270
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810396221"
     variation       3281
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1810396298"
     variation       3282
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810396374"
     variation       3283
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810396449"
     variation       3286
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1586159559"
     variation       3292
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748740342"
     variation       3294
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1732346584"
     variation       3297
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1466887345"
     variation       3302..3303
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:1218022792"
     variation       3304
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810396872"
     variation       3306..3317
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="gt"
                     /replace="gtgtttaggagt"
                     /db_xref="dbSNP:1810396932"
     variation       3307
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1810396999"
     variation       3316
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810397073"
     variation       3318
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1317496592"
     variation       3319..3322
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="tt"
                     /replace="tttt"
                     /db_xref="dbSNP:898663814"
     variation       3321
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:996031943"
     variation       3324
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1336708334"
     variation       3325
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1563519200"
     variation       3327..3332
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="tttttt"
                     /replace="ttttttt"
                     /db_xref="dbSNP:1293619688"
     variation       3331
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810397664"
     variation       3332
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810397752"
     variation       3337
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:189435075"
     variation       3342
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810397930"
     variation       3346
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:576359274"
     variation       3347
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1290183004"
     variation       3347
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:892560651"
     variation       3350
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810398324"
     variation       3354
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1430796846"
     variation       3357
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013570287"
     variation       3359..3363
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="ct"
                     /replace="ctcct"
                     /db_xref="dbSNP:1024241810"
     variation       3359
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810398551"
     variation       3361
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745862328"
     variation       3362..3366
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="ct"
                     /replace="cttct"
                     /db_xref="dbSNP:1420473756"
     variation       3367
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:545190275"
     variation       3369
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1166094525"
     variation       3376
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:998768985"
     variation       3377
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810399113"
     variation       3381
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1020111930"
     variation       3385
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:899697636"
     variation       3387
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1486252140"
     variation       3388
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771482216"
     variation       3389
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1300911544"
     variation       3390..3394
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="tacta"
                     /replace="tactacta"
                     /db_xref="dbSNP:1309692999"
     variation       3393
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1206759700"
     variation       3393
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810399660"
     variation       3394
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810399882"
     variation       3395
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:997069286"
     variation       3397
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1273653064"
     variation       3399
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:565409416"
     variation       3400
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810400350"
     variation       3401
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779668197"
     variation       3407
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1586159697"
     variation       3413
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810400600"
     variation       3414
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:111728711"
     variation       3415
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1264731600"
     variation       3416
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1316016894"
     variation       3423
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1810400970"
     variation       3424
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1363843997"
     variation       3425..3432
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="ag"
                     /replace="agactcag"
                     /db_xref="dbSNP:1317870472"
     variation       3427
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1433606681"
     variation       3433
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1197990690"
     variation       3435
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810401418"
     variation       3440
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1457691238"
     variation       3441
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1810401535"
     variation       3443
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1367044607"
     variation       3445
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1258600677"
     variation       3446
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172836419"
     variation       3450
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810401825"
     variation       3452..3456
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="at"
                     /replace="atcat"
                     /db_xref="dbSNP:920997972"
     variation       3452
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1481367432"
     variation       3456
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810402097"
     variation       3459
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186669527"
     variation       3462
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:886063183"
     variation       3463
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1186752733"
     variation       3465
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810402446"
     variation       3467..3472
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="tttttt"
                     /replace="ttttttt"
                     /db_xref="dbSNP:1433367159"
     variation       3473
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810402596"
     variation       3475
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810402670"
     variation       3476
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1455579895"
     variation       3490
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1253528438"
     variation       3493..3499
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="tgtgt"
                     /replace="tgtgtgt"
                     /replace="tgtgtgtgt"
                     /db_xref="dbSNP:986456087"
     variation       3496
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1252787419"
     variation       3498
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:145384326"
     variation       3498
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1204780154"
     variation       3498
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1235821816"
     variation       3499..3511
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="ttttttttttt"
                     /replace="tttttttttttt"
                     /replace="ttttttttttttt"
                     /replace="tttttttttttttt"
                     /replace="ttttttttttttttt"
                     /db_xref="dbSNP:rs60316663"
     variation       3499..3500
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:886063184"
     variation       3499
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377214447"
     variation       3500
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:192025344"
     variation       3501..3502
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1810403962"
     variation       3501
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:886063185"
     variation       3511
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1370172070"
     variation       3512
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1166849630"
     variation       3514
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:558897089"
     variation       3516
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810404235"
     variation       3519
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1378236887"
     variation       3522
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1198107645"
     variation       3526
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810404474"
     variation       3530
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1810404544"
     variation       3531
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810404628"
     variation       3533
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810404703"
     variation       3534
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810404769"
     variation       3538
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810404835"
     variation       3539
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1586159864"
     variation       3540
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777095381"
     variation       3544
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810405040"
     variation       3545
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1431301475"
     variation       3549
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810405170"
     variation       3559
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:982457360"
     variation       3565
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810405296"
     variation       3568
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1037280228"
     variation       3569
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1482550471"
     variation       3570
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:566314054"
     variation       3571
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1212526795"
     variation       3586
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:116788695"
     variation       3587..3590
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="tttt"
                     /replace="tttttt"
                     /db_xref="dbSNP:1810405730"
     variation       3587
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1254846844"
     variation       3591
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810405807"
     variation       3593
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1651804957"
     variation       3598
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810405891"
     variation       3599
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1810405964"
     variation       3604
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1233167539"
     variation       3610..3617
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="aat"
                     /replace="aatgaaat"
                     /db_xref="dbSNP:1810406194"
     variation       3610
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810406125"
     variation       3612
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:568255963"
     variation       3618
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810406354"
     variation       3620
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810406447"
     variation       3627
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810406526"
     variation       3628
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:931461143"
     variation       3630
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1810406603"
     variation       3636
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1810406675"
     variation       3637
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810406748"
     variation       3638..3640
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:753816030"
     variation       3638
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1350149296"
     variation       3639
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1388695678"
     variation       3640
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810407079"
     variation       3641
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1810407185"
     variation       3642
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306437972"
     variation       3649
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:535028389"
     variation       3652
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1586159941"
     variation       3653
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773560152"
     variation       3654
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810407624"
     variation       3655
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:531302765"
     variation       3656..3658
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1338199837"
     variation       3657
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:77734416"
     variation       3660
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810407989"
     variation       3666
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1810408063"
     variation       3675
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:915633588"
     variation       3680
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:571368323"
     variation       3687
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:533642903"
     variation       3692
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1464529961"
     variation       3694
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:886063186"
     variation       3696
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537145163"
     variation       3697
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810408631"
     variation       3699
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810408711"
     variation       3702
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:796349269"
     variation       3707
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:925553397"
     variation       3708
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767466121"
     variation       3711
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1046457662"
     variation       3712
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810409143"
     variation       3717
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1563519542"
     variation       3719
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:553341714"
     variation       3725
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:892503598"
     variation       3726
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1442572278"
     variation       3729
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1264298239"
     variation       3734
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810409556"
     variation       3742
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810409630"
     variation       3748
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810409706"
     variation       3749
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:999186555"
     variation       3754
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1343552663"
     variation       3756
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:567078023"
     variation       3761
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1810410075"
     variation       3762
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1229511513"
     variation       3763
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1041162686"
     variation       3765..3772
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="tagta"
                     /replace="tagtagta"
                     /db_xref="dbSNP:1810410473"
     variation       3765
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810410406"
     variation       3767
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1286787633"
     variation       3770
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810410616"
     variation       3772
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139839619"
     variation       3773
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1333646100"
     variation       3775
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810410885"
     variation       3776
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1011378190"
     variation       3778
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810411032"
     variation       3779
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1394330050"
     variation       3780
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1028097570"
     variation       3784
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:953818530"
     variation       3791
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260580387"
     variation       3792
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:899896241"
     variation       3794
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1810411459"
     variation       3798
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1409495177"
     variation       3800
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751645556"
     variation       3803
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1477730137"
     variation       3807
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:886063187"
     variation       3811
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:886063188"
     variation       3815
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810411914"
     variation       3818
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810411992"
     variation       3820
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1019275552"
     variation       3822
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:960995894"
     variation       3833
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1194761571"
     variation       3838
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:973399609"
     variation       3840
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810412469"
     variation       3847
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1209925599"
     variation       3849
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1422281871"
     variation       3850
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:920167119"
     variation       3855
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1422544101"
     variation       3857
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810412804"
     variation       3861
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1235498835"
     variation       3862
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810413028"
     variation       3868
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810413089"
     variation       3871
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1026789823"
     variation       3873
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810413245"
     variation       3879
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810413325"
     variation       3884
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1350591210"
     variation       3890
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:931487691"
     variation       3893
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1296658575"
     variation       3897
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1360119236"
     variation       3900
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1810413782"
     variation       3902
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:888372500"
     variation       3906
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1004172028"
     variation       3907
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1810414015"
     variation       3909
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810414090"
     variation       3913
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1810414167"
     variation       3922
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1321225228"
     variation       3924
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1015512539"
     variation       3925..3926
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:368109978"
     variation       3926
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1386344877"
     variation       3933
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298537637"
     variation       3935..3950
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="cactgttgtacggtgt"
                     /replace="cactgttgtacggtgttaaccgtacactgttgtacggtgt"
                     /db_xref="dbSNP:1810414725"
     variation       3935
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1810414648"
     variation       3936
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:556007957"
     variation       3942
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:959764176"
     variation       3943
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:867099192"
     variation       3945
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115434133"
     variation       3946
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1586160211"
     variation       3947
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810415258"
     variation       3949
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810415336"
     variation       3952
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810415404"
     variation       3962
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1389702058"
     variation       3968
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1022733530"
     variation       3969
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1476158974"
     variation       3970
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810416390"
     variation       3972
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810416468"
     variation       3978
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810416541"
     variation       3982
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810416625"
     variation       3983
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:886063189"
     variation       3984
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810416801"
     variation       3989
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1187369579"
     variation       3991
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1586160228"
     variation       3996
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1449439050"
     variation       4001
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1810417044"
     variation       4002..4008
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="ttttttt"
                     /replace="tttttttt"
                     /db_xref="dbSNP:1810417225"
     variation       4002
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1246693353"
     variation       4008
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810417317"
     variation       4015
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1586160256"
     variation       4016
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1224373092"
     variation       4019
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810417570"
     variation       4022
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1321865708"
     variation       4030
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810417822"
     variation       4031
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:970185092"
     variation       4038
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1208292049"
     variation       4039
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283450822"
     variation       4040
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810418144"
     variation       4041
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810418225"
     variation       4042
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810418346"
     variation       4045
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:902518323"
     variation       4046..4048
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="tat"
                     /replace="tatat"
                     /db_xref="dbSNP:1810418567"
     variation       4046
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1586160290"
     variation       4052
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810418643"
     variation       4058
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298497437"
     variation       4060
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:935322521"
     variation       4065
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759715556"
     variation       4069
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1362996041"
     variation       4077
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810419000"
     variation       4080
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:767751976"
     variation       4082
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1810419154"
     variation       4083
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1586160316"
     variation       4084
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1482469709"
     variation       4085
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1586160326"
     variation       4086
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1810419444"
     variation       4096
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810419528"
     variation       4099
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:980973459"
     variation       4104
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1810419694"
     variation       4105
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183503324"
     variation       4107
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:367694582"
     variation       4109
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:893079017"
     variation       4112
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810420087"
     variation       4113
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145337691"
     variation       4119
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1810420295"
     variation       4121
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1028150023"
     variation       4121
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810420412"
     variation       4125
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810420567"
     variation       4126
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810420658"
     variation       4130
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810420754"
     variation       4131
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1370759886"
     variation       4135
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1167456626"
     variation       4137
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810421038"
     variation       4141
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:958195728"
     variation       4142
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1396309305"
     variation       4144
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1810421271"
     variation       4146
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810421352"
     variation       4149
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:886063190"
     variation       4151..4154
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:539401507"
     variation       4153
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:889610322"
     variation       4160
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810421766"
     variation       4163
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754099555"
     variation       4167
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1320506789"
     variation       4170
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1810422033"
     variation       4175
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1346787065"
     variation       4183
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1810422190"
     variation       4185..4196
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace=""
                     /replace="atgtacagaatg"
                     /db_xref="dbSNP:1810422252"
     variation       4186
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:186410170"
     variation       4191
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810422404"
     variation       4194
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1484187928"
     variation       4198
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1445532845"
     variation       4203
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:190113849"
     variation       4204
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810422747"
     variation       4210
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1810422822"
     variation       4211
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1810422903"
     variation       4212
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1019286799"
     variation       4213
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1379723509"
     variation       4215
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810423139"
     variation       4217
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1810423209"
     regulatory      4219..4224
                     /regulatory_class="polyA_signal_sequence"
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /note="hexamer: ATTAAA"
     variation       4222
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810423285"
     variation       4225
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1340166566"
     variation       4230
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:988384849"
     variation       4232
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1810423495"
     variation       4234
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1280759871"
     variation       4235
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:557560034"
     variation       4236
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1366817779"
     variation       4237
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1586160436"
     variation       4241
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:745781350"
     variation       4241
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:868479762"
     variation       4243
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1352563536"
     polyA_site      4245
                     /gene="PDP1"
                     /gene_synonym="PDH; PDP; PDPC; PPM2A; PPM2C"
                     /note="major polyA site"
ORIGIN      
ggcggccccgcacggtaggggagcagagtgggcaggccgggggtgagggctcgcgctccgggagctgcacggggctgcgtggaaagagcgccgagcggtggcgtcgttgtcgccccctcctcgtcgggaagaatcgtttggtctcctgccgtgcccggagaatgtgtgtgtgtcccgggcccagacgaattggaatcccagtcagaagttccagcctgccactgttctctgatgccatgccagcaccaactcaactgttttttcctctcatccgtaactgtgaactgagcaggatctatggcactgcatgttactgccaccacaaacatctctgttgttcctcatcgtacattcctcagagtcgactgagatacacacctcatccagcatatgctaccttttgcaggccaaaggagaactggtggcagtacacccaaggaaggagatatgcttccacaccacagaaattttacctcacacctccacaagtcaatagcatccttaaagctaatgaatacagtttcaaagtgccagaatttgacggcaaaaatgtcagttctatccttggatttgacagcaatcagctgcctgcaaatgcacccattgaggaccggagaagtgcagcaacctgcttgcagaccagagggatgcttttgggggtttttgatggccatgcaggttgtgcttgttcccaggcagtcagtgaaagactcttttattatattgctgtctctttgttaccccatgagactttgctagagattgaaaatgcagtggagagcggccgggcactgctacccattctccagtggcacaagcaccccaatgattactttagtaaggaggcatccaaattgtactttaacagcttgaggacttactggcaagagcttatagacctcaacactggtgagtcgactgatattgatgttaaggaggctctaattaatgccttcaagaggcttgataatgacatctccttggaggcgcaagttggtgatcctaattcttttctcaactacctggtgcttcgagtggcattttctggagccactgcttgtgtggcccatgtggatggtgttgaccttcatgtggccaatactggcgatagcagagccatgctgggtgtgcaggaagaggacggctcatggtcagcagtcacgctgtctaatgaccacaatgctcaaaatgaaagagaactagaacggctgaaattggaacatccaaagagtgaggccaagagtgtcgtgaaacaggatcggctgcttggcttgctgatgccatttagggcatttggagatgtaaagttcaaatggagcattgaccttcaaaagagagtgatagaatctggcccagaccagttgaatgacaatgaatataccaagtttattcctcctaattatcacacacctccttatctcactgctgagccagaggtaacttaccaccgattaaggccacaggataagtttctggtgttggctactgatgggttgtgggagactatgcataggcaggatgtggttaggattgtgggtgagtacctaactggcatgcatcaccaacagccaatagctgttggtggctacaaggtgactctgggacagatgcatggccttttaacagaaaggagaaccaaaatgtcctcggtatttgaggatcagaacgcagcaacccatctcattcgccacgctgtgggcaacaacgagtttgggactgttgatcatgagcgcctctctaaaatgcttagtcttcctgaagagcttgctcgaatgtacagagatgacattacaatcattgtagttcagttcaattctcatgttgtaggggcgtatcaaaaccaagaatagtgagtggctctttcactggcaattctcaaatgatatacatttaaagggcagattttttaaaaagatactactataataaacatttccagttggtcattctaagcatttacccttttgatactctagctagtcaggtactccaaattgactttgcagcagggtggcagggtcaggagagtctggtcctgcctagctcagatttcatggcacctgcacttgaagcaagtcacttctttatcacaggtgtcttgaaacattagcttcttttaccaacctgagaaaattaggatgacctggcaaataagatcttgaataggccaaaagcaagtatcttgctgtgtgtagtctcttggttaaagtgaagaaacagtactgttcacacctttcttcactgagattccagtgtacatgagaacatatatttattgcatgattttctagatacacagtctatgcattattcatatacatttattttagcctaaagtggttttcaaatccagttcttcaagccataaatgaccaagatccaagcaatctgaatttgtttttgtgattatttgactggaatgcttcttaagtggaataactatactccgttatccacccgatttcctaatgtaattgaaagattttctattttgccacacacttggagacaataagggtttttagttttatctactcttctattgaagttaaagaaagaaaaaaagatttttttatttgtattaatgaaaagctttagtttaaaataaggagatccagaataaaaagaagagactgatctcttcaattattgtcatctgtagccaccagcacatcactcttatgtaatccccaaaggcttggcatgccgtaagtgtgtggtgggtagactgctgccggggaatcgtacttcttatttagtaatgataagacttttcattatttttggaattttaaagatgacataaataagtttaaatatcaatttggggagtaaggtttaatattgccatcgggtattgagacaggaggaagtttctgtttttctccatttagacataggtcaattaaaatatttgggtttaaaatgactaaatgctttaaacatattgtagcttaagatatatgtgttaagatatatacatgagaaactttaaaaggtaactactgtgcatgcctgatgcttaatagaatacttagtggcatcaaatgtttgcagcagtctccataattatattcagtcccttctaatactgtatcaatgtaaatgaaataaatatattcaaattggctttttgatatgcatcaagtggcattttgttcctgtgtttaatagtgatctgtatacagctgtgcacatattgtcatcacttattctagcatcactgttaaggctgtgattatgtttgatattcacctggattttaatacaagccaatatcagcttcccattgtgtaataacttgggtgtttaggagtcttttcacattttttggggatatgaactagatgttcaagaactccttctggactgtggatactgaatcagtgtactattggctgcagaatttgtttcaattgaaaatagactcaggaagattgctgctcagaatatcatataatgtttattttttgaggtgtttttgtttttatttgtgtgtttttttttttttaagtcagcttggaacttttttcctgggtagtatttgggagagggaaaggctgtactatatatttatttctaaatgttttgactgggcatttttcttttaatgaaatatgtggactgctctagcaaaccctattttcagctactatttgaatattcttgaacaccaccactgaagagtttcatatacaccaaataatgtctcatctctatagtacagggaatataaaattggtttcctgtggtcatgatcaagatagtagtattattacacaagaaacttggtctgcagtctggaagcttgtctgctctatagaaatgaaaatgcagcatgaagttgacattgtggaaatgaaagtaattgggtattagaaatctgaaagtactgtcatctaaaagcaattgtgattttattgtaattggttgtcactgttgtacggtgtctagaattaaagaatacatgtaaactttcatggtatttagcctttcttaaatttttttaaaatttaaactttctaacctatgtattcaacttctgtatttatatttaatcagtggttcatgttatataatacacccttaactagttaaatggaatgttggtatggtacagagtaccatattgctaagaaaactgtcttataaaagatgtatatgtgtgaagacatgaaagtttaatgtacagaatggttggagaaatgcctatggtgaattaaagcttcatatctgctttctgaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]