ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2025-12-17 20:13:34, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS NM_001161635 1012 bp mRNA linear MAM 19-FEB-2022 DEFINITION Sus scrofa claudin 1-like (LOC396566), mRNA. ACCESSION NM_001161635 VERSION NM_001161635.1 KEYWORDS RefSeq. SOURCE Sus scrofa (pig) ORGANISM Sus scrofa Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Suina; Suidae; Sus. REFERENCE 1 (bases 1 to 1012) AUTHORS Martin-Martin N, Ryan G, McMorrow T and Ryan MP. TITLE Sirolimus and cyclosporine A alter barrier function in renal proximal tubular cells through stimulation of ERK1/2 signaling and claudin-1 expression JOURNAL Am. J. Physiol. Renal Physiol. 298 (3), F672-F682 (2010) PUBMED 19955189 REMARK GeneRIF: Cyclosporine A/sirolimus alter claudin-1 expression in renal proximal tubular cells via ERK1/2 signaling pathway to alter barrier function. COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from FJ873109.1. ##Evidence-Data-START## Transcript exon combination :: FJ873109.1 [ECO:0000332] ##Evidence-Data-END## FEATURES Location/Qualifiers source 1..1012 /organism="Sus scrofa" /mol_type="mRNA" /db_xref="taxon:9823" /chromosome="8" /map="8" gene 1..1012 /gene="LOC396566" /note="claudin 1-like" /db_xref="GeneID:396566" exon 1..1012 /gene="LOC396566" /inference="alignment:Splign:2.1.0" misc_feature 34..36 /gene="LOC396566" /note="upstream in-frame stop codon" CDS 175..810 /gene="LOC396566" /codon_start=1 /product="claudin-1-like" /protein_id="NP_001155107.1" /db_xref="GeneID:396566" /translation="
MANAGLQLLGFILAFLGWIGSIVSTALLQWKIYSYAGDNIVTAQAIYEGLWMSCVSQSTGQIQCKVFDSLLNLNSTLQATRALMVIGILLGLIAIFVATVGMKCMKCMEDDEVQKMRMAVIGGVIFLISGLAILVATARYGNRIVQEFYHLMTPVNARYEFGQALFTGWAAASLCLLGGALLCRSCPRKTTSYPTPRPYPKPSPSSGKDYV"
misc_feature 187..693
/gene="LOC396566"
/note="PMP-22/EMP/MP20/Claudin family; Region:
PMP22_Claudin; cl21598"
/db_xref="CDD:473919"
ORIGIN
tcttgcttctcaacttcagcgcccacccggccctagacccacacccctcgcatcaccacctgcagcccccgcgcggcgccgccacccccgggagtcctgggtgggcacctgcaaactccgccttgtgcacctgcggcccttgagccggtgctagcgcctgatcgagccagagctatggccaacgcggggctgcagctgctgggcttcatcctggccttcctgggctggatcggctccatcgtcagcaccgcactgcttcagtggaagatttactcctacgctggtgacaacattgtgacggcccaggccatctacgaggggctgtggatgtcctgcgtgtcgcagagcaccgggcagatccagtgcaaagtcttcgactccttgctgaatctgaacagcactttgcaagcaacccgtgccttgatggtaattggcatcctgctgggactaatagccatctttgtggccactgttggcatgaagtgtatgaagtgcatggaagatgatgaggtgcagaagatgcggatggctgtcattgggggagtgatctttcttatttcaggtctggctatcttagttgccacagcaaggtatggtaacagaattgttcaagaattctatcacctcatgaccccggtcaatgccagatatgaatttggtcaggctctcttcactggctgggctgctgcttctctctgccttctgggaggtgccctactttgccgctcctgtccccgaaaaacaacatcttacccaacaccaaggccctatccaaaaccttcgccttccagtgggaaagactacgtgtgacacagaatcaaaaggacaaaaccgtgtgggaacaaccagaaaatggacattgaaatactgtcattgacactgagatcttcgacttttgactgttagagtctgaactatggtataaccaaaaaaatattatttttttaaaatacacattgctaaaaatgatgaggtcttattttatctcctttcctcaatacgggagggaagc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]