GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-07 23:15:24, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NM_001161347            3015 bp    mRNA    linear   PRI 02-AUG-2019
DEFINITION  Homo sapiens checkpoint with forkhead and ring finger domains
            (CHFR), transcript variant 5, mRNA.
ACCESSION   NM_001161347
VERSION     NM_001161347.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3015)
  AUTHORS   Cha Y, Kim SY, Yeo HY, Baek JY, Choi MK, Jung KH, Dong SM and Chang
            HJ.
  TITLE     Association of CHFR Promoter Methylation with Treatment Outcomes of
            Irinotecan-Based Chemotherapy in Metastatic Colorectal Cancer
  JOURNAL   Neoplasia 21 (1), 146-155 (2019)
   PUBMED   30562637
  REMARK    GeneRIF: These data suggest that CHFR methylation may be associated
            with favorable treatment outcomes of irinotecan-based chemotherapy
            in patients with metastatic colorectal cancer.
REFERENCE   2  (bases 1 to 3015)
  AUTHORS   Woo SR, Lee HJ, Oh SJ, Kim S, Park SH, Lee J, Song KH and Kim TW.
  TITLE     Stabilization of HDAC1 via TCL1-pAKT-CHFR axis is a key element for
            NANOG-mediated multi-resistance and stem-like phenotype in
            immune-edited tumor cells
  JOURNAL   Biochem. Biophys. Res. Commun. 503 (3), 1812-1818 (2018)
   PUBMED   30060952
  REMARK    GeneRIF: The results establish a firm molecular link in
            immune-edited tumor cells among NANOG, AKT, CHFR, and HDAC1,
            identifying HDAC1 as a molecular target in controlling NANOGHIGH
            immune-refractory cancer.
REFERENCE   3  (bases 1 to 3015)
  AUTHORS   Zhou JD, Zhang TJ, Li XX, Ma JC, Guo H, Wen XM, Yao DM, Zhang W,
            Lin J and Qian J.
  TITLE     Methylation-independent CHFR expression is a potential biomarker
            affecting prognosis in acute myeloid leukemia
  JOURNAL   J. Cell. Physiol. 233 (6), 4707-4714 (2018)
   PUBMED   29115660
  REMARK    GeneRIF: Lower CHFR expression was independently associated with
            unfavorable prognosis in acute myeloid leukemia. Moreover, aberrant
            CHFR promoter methylation was a rare event in myeloid malignances.
REFERENCE   4  (bases 1 to 3015)
  AUTHORS   Castellano L, Dabrowska A, Pellegrino L, Ottaviani S, Cathcart P,
            Frampton AE, Krell J and Stebbing J.
  TITLE     Sustained expression of miR-26a promotes chromosomal instability
            and tumorigenesis through regulation of CHFR
  JOURNAL   Nucleic Acids Res. 45 (8), 4401-4412 (2017)
   PUBMED   28126920
  REMARK    GeneRIF: Re-expression of CHFR in miR-26a overexpressing cells
            partially rescues normal mitosis and impairs the tumorigenesis
            exerted by miR-26a.
REFERENCE   5  (bases 1 to 3015)
  AUTHORS   Kim M, Kwon YE, Song JO, Bae SJ and Seol JH.
  TITLE     CHFR negatively regulates SIRT1 activity upon oxidative stress
  JOURNAL   Sci Rep 6, 37578 (2016)
   PUBMED   27883020
  REMARK    GeneRIF: JNK inhibitor prevents SIRT1 phosphorylation, leading to
            elevated SIRT1 protein levels even in the presence of H2O2. Taken
            together, our results indicate that CHFR plays a crucial role in
            the cellular stress response pathway by controlling the stability
            and function of SIRT1.
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 3015)
  AUTHORS   Sanbhnani S and Yeong FM.
  TITLE     CHFR: a key checkpoint component implicated in a wide range of
            cancers
  JOURNAL   Cell. Mol. Life Sci. 69 (10), 1669-1687 (2012)
   PUBMED   22159584
  REMARK    GeneRIF: CHFR is thought to contribute towards regulating mitotic
            entry and possible explanations for contradictory observations
            published on the functions and regulation of CHFR are presented.
            [review]
            Review article
REFERENCE   7  (bases 1 to 3015)
  AUTHORS   Mizuno K, Osada H, Konishi H, Tatematsu Y, Yatabe Y, Mitsudomi T,
            Fujii Y and Takahashi T.
  TITLE     Aberrant hypermethylation of the CHFR prophase checkpoint gene in
            human lung cancers
  JOURNAL   Oncogene 21 (15), 2328-2333 (2002)
   PUBMED   11948416
REFERENCE   8  (bases 1 to 3015)
  AUTHORS   Chaturvedi P, Sudakin V, Bobiak ML, Fisher PW, Mattern MR,
            Jablonski SA, Hurle MR, Zhu Y, Yen TJ and Zhou BB.
  TITLE     Chfr regulates a mitotic stress pathway through its RING-finger
            domain with ubiquitin ligase activity
  JOURNAL   Cancer Res. 62 (6), 1797-1801 (2002)
   PUBMED   11912157
  REMARK    GeneRIF: Chfr regulates a mitotic stress pathway through its
            RING-finger domain with ubiquitin ligase activity.
REFERENCE   9  (bases 1 to 3015)
  AUTHORS   Kang D, Chen J, Wong J and Fang G.
  TITLE     The checkpoint protein Chfr is a ligase that ubiquitinates Plk1 and
            inhibits Cdc2 at the G2 to M transition
  JOURNAL   J. Cell Biol. 156 (2), 249-259 (2002)
   PUBMED   11807090
  REMARK    GeneRIF: checkpoint protein Chfr is a ligase that ubiquitinates
            Plk1 and inhibits Cdc2 at the G2 to M transition
REFERENCE   10 (bases 1 to 3015)
  AUTHORS   Scolnick DM and Halazonetis TD.
  TITLE     Chfr defines a mitotic stress checkpoint that delays entry into
            metaphase
  JOURNAL   Nature 406 (6794), 430-435 (2000)
   PUBMED   10935642
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from BP313700.1, AK302785.1,
            AK027687.1, AC127070.10 and BC012072.1.
            
            Summary: This gene encodes an E3 ubiquitin-protein ligase required
            for the maintenance of the antephase checkpoint that regulates cell
            cycle entry into mitosis and, therefore, may play a key role in
            cell cycle progression and tumorigenesis. The encoded protein has
            an N-terminal forkhead-associated domain, a central RING-finger
            domain, and a cysteine-rich C-terminal region. Alternatively
            spliced transcript variants that encode different protein isoforms
            have been described. [provided by RefSeq, Mar 2014].
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK302785.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMEA1965299, SAMEA1966682
                                           [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-15                BP313700.1         1-15
            16-1545             AK302785.1         1-1530
            1546-1546           AK027687.1         1780-1780
            1547-1842           AK302785.1         1532-1827
            1843-2658           AC127070.10        108304-109119
            2659-3015           BC012072.1         2825-3181
FEATURES             Location/Qualifiers
     source          1..3015
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="12"
                     /map="12q24.33"
     gene            1..3015
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /note="checkpoint with forkhead and ring finger domains"
                     /db_xref="GeneID:55743"
                     /db_xref="HGNC:HGNC:20455"
                     /db_xref="MIM:605209"
     exon            1..72
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1361815684"
     variation       4
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1003781663"
     variation       7
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1287541768"
     variation       11
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:553012411"
     variation       12
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:905468008"
     variation       16
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:534357480"
     variation       17
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:570446374"
     variation       18
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:896280970"
     variation       23
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1452969814"
     variation       24
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468914426"
     variation       29
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1403273314"
     variation       30..41
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="gcggcggcggcg"
                     /replace="gcggcggcggcggcg"
                     /db_xref="dbSNP:1462255454"
     variation       30
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1052274666"
     variation       32
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1023737356"
     variation       35
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1177915172"
     variation       36
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1305328622"
     variation       37
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043377910"
     variation       38
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:942391667"
     variation       39
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:910903529"
     variation       40
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:986491943"
     variation       43
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:867733545"
     variation       44
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:866582582"
     variation       45
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1184602056"
     variation       46
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1457982394"
     variation       47
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1180202481"
     variation       49
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:955129324"
     variation       50
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1418375663"
     variation       52
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:918721775"
     variation       53
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1379340094"
     variation       54
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:558080896"
     variation       55
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1401227842"
     variation       58
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1203285887"
     variation       59
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1373084089"
     variation       60
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1460094658"
     variation       62
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:972910573"
     variation       63
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:962990830"
     variation       68
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210883392"
     variation       69
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1261984726"
     variation       71
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1318118652"
     variation       72
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1307468722"
     exon            73..217
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    76..78
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /note="upstream in-frame stop codon"
     variation       81..83
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1000300479"
     variation       81
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756050840"
     variation       82
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1200689283"
     variation       83
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745782659"
     CDS             85..1803
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /EC_number="2.3.2.27"
                     /note="isoform 5 is encoded by transcript variant 5; RING
                     finger protein 196; checkpoint with forkhead and ring
                     finger domains, E3 ubiquitin protein ligase; RING-type E3
                     ubiquitin transferase CHFR"
                     /codon_start=1
                     /product="E3 ubiquitin-protein ligase CHFR isoform 5"
                     /protein_id="NP_001154819.1"
                     /db_xref="CCDS:CCDS53847.1"
                     /db_xref="GeneID:55743"
                     /db_xref="HGNC:HGNC:20455"
                     /db_xref="MIM:605209"
                     /translation="
MERPEEGKQSPPPQPWGRLLRLGAEEGEPHVLLRKREWTIGRRRGCDLSFPSNKLVSGDHCRIVVDEKSGQVTLEDTSTSGTVINKLKVVKKQTCPLQTGDVIYLVYRKNEPEHRSGGGGISPKGSGPSVASDEVSSFASALPDRKTASFSSLEPQDQEDLEPVKKKMRGDGDLDLNGQLLVAQPRRNAQTVHEDVRAAAGKPDKMEETLTCIICQDLLHDCVSLQPCMHTFCAACYSGWMERSSLCPTCRCPVERICKNHILNNLVEAYLIQHPDKSRSEEDVQSMDARNKITQDMLQPKVRRSFSDEEGSSEDLLELSDVDSESSDISQPYVVCRQCPEYRRQAAQPPHCPAPEGEPGAPQALGDAPSTSVSLTTAVQDYVCPLQGSHALCTCCFQPMPDRRAEREQDPRVAPQQCAVCLQPFCHLYWGCTRTGCYGCLAPFCELNLGDKCLDGVLNNNSYESDILKNYLATRGLTWKNMLTESLVALQRGVFLLSDYRVTGDTVLCYCCGLRSFRELTYQYRQNIPASELPVAVTSRPDCYWGRNCRTQVKAHHAMKFNHICEQTRFKN"
     misc_feature    130..399
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /note="Forkhead associated domain (FHA); found in
                     eukaryotic and prokaryotic proteins. Putative nuclear
                     signalling domain. FHA domains may bind phosphothreonine,
                     phosphoserine and sometimes phosphotyrosine. In
                     eukaryotes, many FHA domain-containing proteins...;
                     Region: FHA; cd00060"
                     /db_xref="CDD:238017"
     misc_feature    <175..486
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /note="Forkhead associated (FHA) domain, binds pSer, pThr,
                     pTyr [Signal transduction mechanisms]; Region: FHA;
                     COG1716"
                     /db_xref="CDD:224630"
     misc_feature    order(208..210,247..249,253..258,319..327)
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /note="phosphopeptide binding site; other site"
                     /db_xref="CDD:238017"
     misc_feature    715..846
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /note="RING-finger (Really Interesting New Gene) domain, a
                     specialized type of Zn-finger of 40 to 60 residues that
                     binds two atoms of zinc; defined by the 'cross-brace'
                     motif C-X2-C-X(9-39)-C-X(1-3)-
                     H-X(2-3)-(N/C/H)-X2-C-X(4-48)C-X2-C; probably involved
                     in...; Region: RING; cd00162"
                     /db_xref="CDD:238093"
     misc_feature    order(718..720,727..729,766..768,772..774,781..783,
                     790..792,823..825,832..834)
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /note="cross-brace motif; other site"
                     /db_xref="CDD:238093"
     variation       87
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1323042743"
     variation       89
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:780919643"
     variation       92
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757065782"
     variation       93
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:879451433"
     variation       94
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252988651"
     variation       100
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1285867152"
     variation       104
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1453369842"
     variation       107
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381686714"
     variation       109
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1334460653"
     variation       113..124
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="cgccgccgc"
                     /replace="cgccgccgccgc"
                     /replace="cgccgccgccgccgc"
                     /db_xref="dbSNP:765917829"
     variation       113
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752932212"
     variation       115
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372093401"
     variation       117
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566211828"
     variation       118
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1459172597"
     variation       121
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1022133046"
     variation       122
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1407689006"
     variation       123
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1415407421"
     variation       126
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184750358"
     variation       127
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444571399"
     variation       129
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:547086677"
     variation       131..134
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1180924768"
     variation       136
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481059648"
     variation       141
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1327949016"
     variation       142
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1250940821"
     variation       146
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1202757955"
     variation       148
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1323574369"
     variation       151
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1292594475"
     variation       153
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1246548917"
     variation       156
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753867941"
     variation       157
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1312590714"
     variation       159
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448675201"
     variation       161
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373843772"
     variation       165
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1297235638"
     variation       169
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766461060"
     variation       170
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1242357676"
     variation       171
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:889736424"
     variation       172
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1050716303"
     variation       174
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1163686245"
     variation       175
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424534907"
     variation       177
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761126986"
     variation       178
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:896897715"
     variation       180
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1161017404"
     variation       181
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:558346895"
     variation       183
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1291046887"
     variation       186
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:994965729"
     variation       189
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1250327307"
     variation       191
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1037164725"
     variation       192
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1175632960"
     variation       198
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1489596045"
     variation       201
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1269637112"
     variation       202
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1329871429"
     variation       205
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1220935343"
     variation       207
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360131934"
     variation       208
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:941122476"
     variation       214
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1221878184"
     exon            218..317
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       219..220
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1566203316"
     variation       221
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762757910"
     variation       222
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775199616"
     variation       223
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1016169013"
     variation       226
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370348872"
     variation       229
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1184762410"
     variation       232
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776467669"
     variation       234
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1371415158"
     variation       235
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765839818"
     variation       236
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770855105"
     variation       238
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:146088609"
     variation       241
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77052806"
     variation       244
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:540426488"
     variation       249
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771849929"
     variation       254
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1325393287"
     variation       257
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:573017098"
     variation       258
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:780255609"
     variation       259
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:956973617"
     variation       262
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756177652"
     variation       263
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1336502857"
     variation       264
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1468386635"
     variation       272
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750466757"
     variation       274
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781107351"
     variation       275
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142824452"
     variation       277
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1372280960"
     variation       278
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752104453"
     variation       283
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1190933998"
     variation       291
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1446377947"
     variation       292
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764607751"
     variation       296
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763356188"
     variation       302
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1436266778"
     variation       303
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:115711908"
     variation       304
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252203966"
     variation       309
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1390531305"
     variation       314
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1196075617"
     variation       315
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764905392"
     variation       317
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:996565819"
     exon            318..427
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       320
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1405603798"
     variation       321
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200283117"
     variation       330
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138320999"
     variation       333
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1262248032"
     variation       341
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403538188"
     variation       349..354
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="gtt"
                     /replace="gttgtt"
                     /db_xref="dbSNP:749471534"
     variation       351
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1026698840"
     variation       358
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:753427887"
     variation       360
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1409273260"
     variation       361
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765931951"
     variation       362
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145622325"
     variation       363
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:896801495"
     variation       370
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1220821081"
     variation       377
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:773164146"
     variation       379
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1285340068"
     variation       391
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1204882792"
     variation       395
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1349041006"
     variation       397
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767392115"
     variation       399
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761633567"
     variation       400
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774239471"
     variation       405
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768330210"
     variation       413
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1281470229"
     variation       415
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1036686943"
     variation       417
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1277101257"
     variation       419
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377703818"
     variation       420
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771143796"
     variation       424
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201058448"
     variation       425
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778449705"
     variation       427
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758996497"
     exon            428..595
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       431
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1038150337"
     variation       433
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370517411"
     variation       436
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1438318944"
     variation       437
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777186106"
     variation       439..440
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1189456093"
     variation       439
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766667278"
     variation       442
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761034338"
     variation       445
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138637226"
     variation       448
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1387477118"
     variation       451
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34220055"
     variation       452
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761525824"
     variation       461
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774070010"
     variation       462
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1419993206"
     variation       464
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201192149"
     variation       465
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:989203291"
     variation       471
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:796201985"
     variation       472
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1163339779"
     variation       480
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749192848"
     variation       484
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374107669"
     variation       486
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769505625"
     variation       491
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780945230"
     variation       508
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35206714"
     variation       511
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1366834805"
     variation       513
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1038008124"
     variation       515
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:560433355"
     variation       520
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201727566"
     variation       525
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758662673"
     variation       526
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:533118486"
     variation       527
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150995074"
     variation       528
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755027328"
     variation       531
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908433616"
     variation       534
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200213031"
     variation       536
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754307363"
     variation       537
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145246258"
     variation       539
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141183005"
     variation       540
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767988129"
     variation       541..542
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:766718829"
     variation       543
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1566189184"
     variation       544
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1423637297"
     variation       547..550
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:762524769"
     variation       547
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751592981"
     variation       551
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373754363"
     variation       552
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761615752"
     variation       553
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147803776"
     variation       555
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1566189143"
     variation       561
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774088595"
     variation       562
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1472958431"
     variation       570
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768052255"
     variation       572
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762481129"
     variation       573
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1025589682"
     variation       574
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775309126"
     variation       576
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764279540"
     variation       578
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1463671908"
     variation       580
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:974854406"
     variation       583
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1221100387"
     variation       585
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1238379063"
     variation       587
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566189061"
     variation       592
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745763828"
     exon            596..755
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       597
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756088633"
     variation       601
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:563202190"
     variation       605
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1360404336"
     variation       609
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781748631"
     variation       612
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757715316"
     variation       614
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752016583"
     variation       615
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377318460"
     variation       616
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115096950"
     variation       618
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393923793"
     variation       619..620
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:776753889"
     variation       620
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1311480210"
     variation       621
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758139441"
     variation       622
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:973250523"
     variation       624
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1021390710"
     variation       628
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752281100"
     variation       630
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115431373"
     variation       631
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148618944"
     variation       633
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369526598"
     variation       636
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769878915"
     variation       637
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:540759128"
     variation       638
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760584451"
     variation       639
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773102049"
     variation       640
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749537035"
     variation       641
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375174098"
     variation       643
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770024903"
     variation       649
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188170704"
     variation       650
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745889598"
     variation       652
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:781395404"
     variation       654
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757876886"
     variation       657
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747517165"
     variation       658
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199761208"
     variation       663
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1380131918"
     variation       664
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144838296"
     variation       666
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1449844658"
     variation       668
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1000960906"
     variation       669
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371434249"
     variation       670
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764757412"
     variation       671
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:768680290"
     variation       671
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1464052810"
     variation       673
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754506935"
     variation       674
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149862277"
     variation       678
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765845584"
     variation       680
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277312621"
     variation       681
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746414469"
     variation       682
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1341883561"
     variation       684
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295926976"
     variation       686
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306779303"
     variation       689
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1375950961"
     variation       693
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:35011845"
     variation       694
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1341253353"
     variation       699
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1312306793"
     variation       700
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:767348322"
     variation       702
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1352413194"
     variation       710
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761474515"
     variation       711
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775799321"
     variation       717
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1369689338"
     variation       723
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770185579"
     variation       724
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1252007101"
     variation       726
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12315353"
     variation       729
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146107503"
     variation       735
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1368629651"
     variation       738
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186411942"
     variation       740
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759798633"
     variation       744
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1253421391"
     variation       750
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776915637"
     variation       751
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771123706"
     variation       753
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1469130916"
     exon            756..910
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       756
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:560066373"
     variation       760
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1213141444"
     variation       764
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780721649"
     variation       765
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:565644778"
     variation       769
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:987211916"
     variation       772
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566185781"
     variation       773
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1174814592"
     variation       774
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1478670195"
     variation       776
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751498855"
     variation       777
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142975525"
     variation       780
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1466544467"
     variation       783
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138280939"
     variation       784
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754144763"
     variation       785
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:921635691"
     variation       786
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766660009"
     variation       787
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760933260"
     variation       788
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1221124973"
     variation       794
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368405665"
     variation       795
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767634272"
     variation       797
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762287710"
     variation       798
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1367099211"
     variation       800
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774770261"
     variation       805
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1433978124"
     variation       807
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:553735979"
     variation       808..810
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="gag"
                     /replace="gagag"
                     /db_xref="dbSNP:1566185670"
     variation       809
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:968563777"
     variation       811
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749601873"
     variation       812
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775805064"
     variation       815
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1402056016"
     variation       816
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769371058"
     variation       819
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745529097"
     variation       825
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780623191"
     variation       829
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:535313174"
     variation       830
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756736276"
     variation       832
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1474574138"
     variation       835
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770034782"
     variation       836
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146343801"
     variation       839
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1441931198"
     variation       841
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:571101753"
     variation       843
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115029653"
     variation       844
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1344021759"
     variation       850
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182092641"
     variation       851
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756361707"
     variation       855
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1359376881"
     variation       857
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141404869"
     variation       860
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767497782"
     variation       862
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1313496770"
     variation       863
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1319716667"
     variation       864
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1339366523"
     variation       870
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375199215"
     variation       875
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774858017"
     variation       877
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1371529354"
     variation       878
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764629991"
     variation       880
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1255988921"
     variation       882
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191062458"
     variation       883
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775898959"
     variation       886
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1182669640"
     variation       889
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213131732"
     variation       890
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1241168194"
     variation       894
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148311652"
     variation       897
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143181439"
     variation       898
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1241159400"
     variation       900
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770380694"
     variation       904
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746470663"
     variation       905
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370386571"
     exon            911..1073
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       912
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1227736511"
     variation       913..914
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:777961507"
     variation       919
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210874026"
     variation       921
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:928539042"
     variation       927
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566184554"
     variation       934
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:879123151"
     variation       936
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1229649968"
     variation       938
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777930523"
     variation       939
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566184534"
     variation       941
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1293723698"
     variation       943
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377225060"
     variation       947
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:748309050"
     variation       948
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778828908"
     variation       949
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1434082116"
     variation       950
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200764395"
     variation       951
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369063253"
     variation       952
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1026572995"
     variation       953
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766865645"
     variation       954
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2062163"
     variation       962
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1047280041"
     variation       963
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750119581"
     variation       965
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760238279"
     variation       967
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761337268"
     variation       973
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150467142"
     variation       981
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763498728"
     variation       990
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:930183182"
     variation       991
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1322357484"
     variation       992
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762961678"
     variation       993
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:879252133"
     variation       994
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:920205326"
     variation       995
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201828860"
     variation       998
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769607729"
     variation       999
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745615761"
     variation       1002
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:776390811"
     variation       1006
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:974463026"
     variation       1009..1015
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="gaag"
                     /replace="gaagaag"
                     /db_xref="dbSNP:1434190222"
     variation       1016
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772321674"
     variation       1019
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1315657949"
     variation       1022
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1413044699"
     variation       1026
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1353432969"
     variation       1033
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1309789349"
     variation       1038
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748314312"
     variation       1044
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1283784330"
     variation       1047
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395585538"
     variation       1048
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1165776578"
     variation       1058
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:779111370"
     variation       1062
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1368718436"
     variation       1071
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754958760"
     exon            1074..1216
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       1077
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1286314037"
     variation       1078
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1020597739"
     variation       1080
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748419509"
     variation       1081
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372270460"
     variation       1082
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013270057"
     variation       1083
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1438322046"
     variation       1084
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768814594"
     variation       1085
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1318363216"
     variation       1086
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749373830"
     variation       1087
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150627547"
     variation       1089
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368755833"
     variation       1093
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1435723841"
     variation       1094
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746360566"
     variation       1095
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1191956640"
     variation       1101
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1451601823"
     variation       1103
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781699438"
     variation       1106
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:757496767"
     variation       1110
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1192492326"
     variation       1114
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1445358565"
     variation       1121
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374229656"
     variation       1122
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777240371"
     variation       1123
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1303770543"
     variation       1124
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371541325"
     variation       1125
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:563852229"
     variation       1129
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1231849613"
     variation       1132
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366854652"
     variation       1133
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1270421677"
     variation       1134
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1429332642"
     variation       1136
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1176161885"
     variation       1137
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764723102"
     variation       1147
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1237028076"
     variation       1149
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759529335"
     variation       1150
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753721064"
     variation       1152
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1375184437"
     variation       1154
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367968934"
     variation       1155
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374006779"
     variation       1156
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774658371"
     variation       1157
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1167629443"
     variation       1158
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566181842"
     variation       1159
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:924051400"
     variation       1161
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1041545091"
     variation       1165
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768798394"
     variation       1167
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1239336733"
     variation       1182
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1189940191"
     variation       1187
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138207644"
     variation       1189
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256747525"
     variation       1191
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1379314322"
     variation       1192
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775767314"
     variation       1195
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1196421815"
     variation       1196
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769933100"
     variation       1197
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746380972"
     variation       1198
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1215461680"
     variation       1200
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781511228"
     variation       1201
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141835819"
     variation       1205
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747380214"
     variation       1208
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778169456"
     variation       1210
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1355326421"
     variation       1211
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752333209"
     variation       1212
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:536396076"
     exon            1217..1336
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       1217
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1402157616"
     variation       1218
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757077660"
     variation       1221
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146976267"
     variation       1223
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765605647"
     variation       1224
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1408464611"
     variation       1230
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141349945"
     variation       1231
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776642806"
     variation       1236
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306934237"
     variation       1237
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764423128"
     variation       1240
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766469365"
     variation       1242
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761102171"
     variation       1247
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1304421220"
     variation       1251
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773703522"
     variation       1252
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772460210"
     variation       1254
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147791929"
     variation       1255
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1454391193"
     variation       1259
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1345653105"
     variation       1260
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:116286061"
     variation       1263
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768361418"
     variation       1265
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1396714833"
     variation       1266..1273
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="ctgct"
                     /replace="ctgctgct"
                     /db_xref="dbSNP:1363396811"
     variation       1266
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748952886"
     variation       1267
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:763257394"
     variation       1269
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278317795"
     variation       1277
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779441212"
     variation       1278
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775978433"
     variation       1285
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1187706335"
     variation       1287
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781224248"
     variation       1288
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757239007"
     variation       1291
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:936864653"
     variation       1292
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:969442993"
     variation       1295
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751440176"
     variation       1298
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2306541"
     variation       1299
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755310429"
     variation       1300
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298012137"
     variation       1303
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754035414"
     variation       1304
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:944300584"
     variation       1305
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766376169"
     variation       1306
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150920425"
     variation       1309
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1015010652"
     variation       1310
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:773617183"
     variation       1316
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768065335"
     variation       1317
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142511371"
     variation       1318
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114117795"
     variation       1319
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201454195"
     variation       1320
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172173801"
     variation       1321
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200436687"
     variation       1323
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:920038038"
     variation       1324
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746554223"
     variation       1326
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:973207321"
     variation       1330
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1486915053"
     variation       1332
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346472721"
     variation       1333
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1258850426"
     variation       1335
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769207559"
     exon            1337..1420
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       1339
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372012714"
     variation       1340
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201350082"
     variation       1341
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:7975454"
     variation       1344
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375656978"
     variation       1350
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1335016856"
     variation       1352
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201237898"
     variation       1353
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1442703181"
     variation       1354
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765505226"
     variation       1355
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1324580295"
     variation       1364
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403110794"
     variation       1371
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759242088"
     variation       1376
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:953787024"
     variation       1380
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:546055046"
     variation       1382
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766020195"
     variation       1384
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371092913"
     variation       1385
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146156998"
     variation       1386
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1454840670"
     variation       1387
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:979112170"
     variation       1388
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252629926"
     variation       1389
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772089817"
     variation       1390
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448818469"
     variation       1395
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1249069969"
     variation       1397
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767140702"
     variation       1398
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765611625"
     variation       1399
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1349644861"
     variation       1404
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189987561"
     variation       1405
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1236250946"
     variation       1407
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:966632867"
     variation       1411
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1348083185"
     variation       1412
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1302248351"
     variation       1413
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1433674477"
     variation       1416
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1327743680"
     exon            1421..1491
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       1422
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777921940"
     variation       1428
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200853567"
     variation       1431
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748721756"
     variation       1432
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1179840200"
     variation       1437
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1471040037"
     variation       1440
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1415191475"
     variation       1442
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1233090445"
     variation       1449
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372404283"
     variation       1450
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755522022"
     variation       1451
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754297675"
     variation       1452
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1323808548"
     variation       1461
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1213796881"
     variation       1462
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:780565079"
     variation       1463
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1288355908"
     variation       1466
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225827826"
     variation       1467
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755891788"
     variation       1469
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1288380542"
     variation       1473
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749973618"
     variation       1475
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1379904886"
     variation       1476
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767082498"
     variation       1482
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1416698488"
     variation       1486
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761176081"
     variation       1491
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1326600805"
     exon            1492..1579
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       1493
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1432073088"
     variation       1497
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1422500887"
     variation       1498
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:899072283"
     variation       1499
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1008556440"
     variation       1504
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776466473"
     variation       1508
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:576074865"
     variation       1513
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2306537"
     variation       1518
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:536151635"
     variation       1519
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1281285798"
     variation       1520
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1378971375"
     variation       1522..1526
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="aaaaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:1224656808"
     variation       1526
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1232869629"
     variation       1528
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200187965"
     variation       1536
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749821203"
     variation       1537
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780655269"
     variation       1543
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770399858"
     variation       1545
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:899313894"
     variation       1546
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2306536"
     variation       1549
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1485801990"
     variation       1550
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781614371"
     variation       1551
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756917083"
     variation       1556
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1313082363"
     variation       1557
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1465200907"
     variation       1558
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357095646"
     variation       1559
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:558156375"
     variation       1566
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363290036"
     variation       1570
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1428595949"
     variation       1577
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1423530802"
     exon            1580..1687
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       1580
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1265969471"
     variation       1592
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115684143"
     variation       1593
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1222086097"
     variation       1602
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115566777"
     variation       1603
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758025460"
     variation       1605
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:976650599"
     variation       1606
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747697880"
     variation       1607
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1566173893"
     variation       1613
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1356919481"
     variation       1615
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778392987"
     variation       1616
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754931883"
     variation       1617
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442480016"
     variation       1626
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:937547511"
     variation       1627
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:961309862"
     variation       1628
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:557461509"
     variation       1629
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1456695524"
     variation       1631
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766096241"
     variation       1636
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376798546"
     variation       1642
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1439266364"
     variation       1646
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764448295"
     variation       1648
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220708351"
     variation       1650
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1195509679"
     variation       1652
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114483951"
     variation       1657
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775769340"
     variation       1658
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144644143"
     variation       1677
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373411620"
     variation       1678
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777155485"
     variation       1684
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76224039"
     exon            1688..1760
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       1692
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772354359"
     variation       1693
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761464761"
     variation       1694
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1476434657"
     variation       1696
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1425682767"
     variation       1701
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1194364986"
     variation       1707
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774002945"
     variation       1710
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1260717996"
     variation       1711
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1212784968"
     variation       1716
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768078789"
     variation       1723
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192495200"
     variation       1724
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779420556"
     variation       1730..1734
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="gc"
                     /replace="gccgc"
                     /db_xref="dbSNP:1218603125"
     variation       1732
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769922499"
     variation       1733
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745735958"
     variation       1736
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1339131647"
     variation       1739
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1188833829"
     variation       1741
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1295444518"
     variation       1743
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1449229353"
     variation       1749
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1340024053"
     variation       1755
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146332668"
     variation       1756
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371841032"
     variation       1758
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1401175113"
     variation       1759
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752894210"
     variation       1760
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779235326"
     exon            1761..3005
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       1767
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1456116703"
     variation       1769
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:549826875"
     variation       1772
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1223009144"
     variation       1773
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772496941"
     variation       1786
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1288110354"
     variation       1787
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1190631767"
     variation       1791
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200441646"
     variation       1804
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1242787279"
     variation       1811
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776670620"
     variation       1812
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:770961851"
     variation       1814
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1566171705"
     variation       1815
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1238046110"
     variation       1818
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746869999"
     variation       1819
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777416500"
     variation       1820
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:755292850"
     variation       1821
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:973123804"
     variation       1823
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375664747"
     variation       1826..1828
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1566171684"
     variation       1829
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780118329"
     variation       1833
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1293032557"
     variation       1834
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756135373"
     variation       1840
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750955936"
     variation       1841
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1157735470"
     variation       1842
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:531300162"
     variation       1845
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757695645"
     variation       1846
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113800546"
     variation       1849
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752032125"
     variation       1850
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:549782692"
     variation       1851
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762683133"
     variation       1868
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314603974"
     variation       1872
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1353651008"
     variation       1873
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1286369531"
     variation       1874
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1045979"
     variation       1877
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:954494653"
     variation       1878
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749186808"
     variation       1880
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1283042988"
     variation       1883
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237120100"
     variation       1884
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1348995249"
     variation       1889
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1030178377"
     variation       1901
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:925838751"
     variation       1904
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361292300"
     variation       1910
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:974644686"
     variation       1913
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:567430632"
     variation       1914
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1341331550"
     variation       1918
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:911586191"
     variation       1921
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:542153503"
     variation       1924
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1156419163"
     variation       1925
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1435059615"
     variation       1928
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370209943"
     variation       1930
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:950536054"
     variation       1935
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:559705268"
     variation       1937
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1010901456"
     variation       1941
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298882440"
     variation       1943
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:893810615"
     variation       1949
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:963549804"
     variation       1958..1960
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="ttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:3832804"
     variation       1962
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111820152"
     variation       1963
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1052601435"
     variation       1965
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1414983132"
     variation       1971
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:935595520"
     variation       1976..1978
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1418783722"
     variation       1982
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1002477975"
     variation       1989
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278595598"
     variation       1991
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1347878070"
     variation       1992
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541179525"
     variation       1996
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:576945941"
     variation       1998
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769326943"
     variation       1999
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:892514179"
     variation       2000
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1054288089"
     variation       2005
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367620504"
     variation       2006
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:916367947"
     variation       2009
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:973064787"
     variation       2015
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1038910312"
     variation       2016
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:963001005"
     variation       2017..2018
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="cc"
                     /replace="ga"
                     /db_xref="dbSNP:796574941"
     variation       2018
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:943323229"
     variation       2031
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370314942"
     variation       2034
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182916402"
     variation       2035
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3741490"
     variation       2040
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1443374356"
     variation       2046
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:983339952"
     variation       2051
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1301770978"
     variation       2057
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:987116079"
     variation       2060
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554895850"
     variation       2072
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298316988"
     variation       2077
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:75237791"
     variation       2078
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746850522"
     variation       2080
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1353265460"
     variation       2081
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777597930"
     variation       2082
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:973165920"
     variation       2086
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758214417"
     variation       2087
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:996057076"
     variation       2089
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192844482"
     variation       2090..2094
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="gag"
                     /replace="gagag"
                     /db_xref="dbSNP:1423726431"
     variation       2090
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:547619077"
     variation       2098
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1010952147"
     variation       2099
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002451487"
     variation       2105
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:893777773"
     variation       2109
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1030977492"
     variation       2111
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1163686844"
     variation       2123
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781543889"
     variation       2124
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:906815915"
     variation       2128
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1415593537"
     variation       2130
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1046993159"
     variation       2140
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1334852400"
     variation       2141
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3741489"
     variation       2151
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1270832087"
     variation       2152
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1450666893"
     variation       2154
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:4758909"
     variation       2162
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201112509"
     variation       2165
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1192780707"
     variation       2176
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1258321216"
     variation       2180
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112870346"
     variation       2185
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1476204979"
     variation       2186
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1163079471"
     variation       2191
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754605513"
     variation       2192
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:549889950"
     variation       2195
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1458219528"
     variation       2202
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1413405596"
     variation       2210
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1037421988"
     variation       2212..2214
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="gag"
                     /db_xref="dbSNP:1272645289"
     variation       2216
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1053774837"
     variation       2221
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1401470577"
     variation       2226
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1231595234"
     variation       2229
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1161815482"
     variation       2235
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1343788492"
     variation       2237
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:941773272"
     variation       2238
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907515157"
     variation       2239
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142376269"
     variation       2244..2245
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:36039891"
     variation       2255
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:933225060"
     variation       2265
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1355291257"
     variation       2267
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1223981564"
     variation       2277
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:923251377"
     variation       2281
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755120503"
     variation       2285
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566171220"
     variation       2289
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:964542689"
     variation       2293
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1021425081"
     variation       2306..2313
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="ctt"
                     /replace="cttatctt"
                     /db_xref="dbSNP:943198387"
     variation       2311
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:989498094"
     variation       2316
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1215845332"
     variation       2328
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1258077252"
     variation       2334
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296311836"
     variation       2340
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:958138392"
     variation       2353..2368
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="tataattta"
                     /replace="tataatttataattta"
                     /db_xref="dbSNP:1401013436"
     variation       2353
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1486597998"
     variation       2365
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1030946220"
     variation       2373
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1236969685"
     variation       2378
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:911779056"
     variation       2381
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1179105860"
     variation       2385
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1406240647"
     variation       2387
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:560709767"
     variation       2392
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:999568389"
     variation       2396
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:548922117"
     variation       2397
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1377843900"
     variation       2403
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1025188661"
     variation       2412
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1331697816"
     variation       2413
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:973134921"
     variation       2414
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1012923039"
     variation       2417
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:895287582"
     variation       2422..2423
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:34409499"
     variation       2423
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1165063779"
     variation       2432..2438
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:1350044921"
     variation       2432
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1374414628"
     variation       2433
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:926776920"
     variation       2438
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1280739400"
     variation       2443
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:530330334"
     variation       2444
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:971314022"
     variation       2450
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1438398757"
     variation       2467
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1206923715"
     variation       2468
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1231446323"
     variation       2469
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1406251214"
     variation       2471
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:941743070"
     variation       2474
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:115799873"
     variation       2475
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541241838"
     variation       2490
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047424647"
     variation       2492
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:932962176"
     variation       2493
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753996875"
     variation       2494
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1211863620"
     variation       2497
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1397721159"
     variation       2498
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1489535422"
     variation       2500
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1215337863"
     variation       2500
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1266210457"
     variation       2505
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1316055975"
     variation       2506..2507
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="acggccccgagcctggggctggacgcaggtcccaggacgtgct"
                     /db_xref="dbSNP:1441439409"
     variation       2506
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766575351"
     variation       2507..2508
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="ctcccttct"
                     /db_xref="dbSNP:1336309071"
     variation       2508
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="gacatgctgctcccttgtgtgagtgaccacggccccgagcctggggct
                     ggacgcaggtcccaggacgtgctgctcccttctg"
                     /db_xref="dbSNP:1566171025"
     variation       2509
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:974656529"
     variation       2510
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1304579464"
     variation       2517
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577007021"
     variation       2518
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:60054929"
     variation       2519..2558
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="cggccccgagcctggggctggacgcaggtcccaggacatg"
                     /replace="cggccccgagcctggggctggacgcaggtcccaggacatgttgctccc
                     ttgtgtgagtgaccacggccccgagcctggggctggacgcaggtcccaggacgtgctg
                     ctcccttctgtgagtgaccacggccccgagcctggggctggacgcaggtcccaggaca
                     tg"
                     /db_xref="dbSNP:1566170943"
     variation       2519..2555
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="cggccccgagcctggggctggacgcaggtcccaggac"
                     /replace="cggccccgagcctggggctggacgcaggtcccaggacgtgctgctccc
                     ttctgtgagtgaccacggccccgagcctggggctggacgcaggtcccaggac"
                     /db_xref="dbSNP:1566170955"
     variation       2519
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137860747"
     variation       2520
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543507917"
     variation       2521
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1339972650"
     variation       2525
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:576425597"
     variation       2526
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:978587251"
     variation       2529
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:970720837"
     variation       2538
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1000902244"
     variation       2541
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1025409954"
     variation       2542
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1012477120"
     variation       2549
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1452627569"
     variation       2552
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:899887350"
     variation       2556
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373137192"
     variation       2559
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:554677515"
     variation       2562
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377537751"
     variation       2566
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1420814830"
     variation       2569
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:796139459"
     variation       2570
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1006432643"
     variation       2579
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1396446600"
     variation       2580..2581
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="acggccccgagcctggggctggacgcaggtcccaggacgtgctgctcc
                     cttctgtgagt"
                     /db_xref="dbSNP:1566170899"
     variation       2580
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1384812230"
     variation       2581..2582
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="acca"
                     /db_xref="dbSNP:1566170888"
     variation       2581
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:15638"
     variation       2582
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111799372"
     variation       2583
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:572274927"
     variation       2586
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:997687935"
     variation       2588
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376925671"
     variation       2589
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1039131607"
     variation       2594..2644
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="tggggctggacgcaggtcccaggacgtgctgctcccttgtgtgagtga
                     cca"
                     /db_xref="dbSNP:1566170810"
     variation       2594
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373528706"
     variation       2599
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1354479573"
     variation       2600
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1192334475"
     variation       2604
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369891917"
     variation       2609
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:867795922"
     variation       2616
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:187667016"
     variation       2618
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1186063298"
     variation       2619
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:111786421"
     variation       2627
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1485012640"
     variation       2631
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1054216011"
     variation       2632
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:75167846"
     variation       2644
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1456063340"
     variation       2645
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538873969"
     variation       2646
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:117246365"
     variation       2647..2659
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="gccccaagcccag"
                     /db_xref="dbSNP:1230976787"
     variation       2647
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566170789"
     variation       2650
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1007364269"
     variation       2651
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218487646"
     variation       2652
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111338463"
     variation       2657
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978174785"
     variation       2658
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:8021"
     variation       2660
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:917908364"
     variation       2667
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1332266605"
     variation       2668
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:890301777"
     variation       2669
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301350623"
     variation       2679
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1051667411"
     variation       2681
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:991258229"
     variation       2682
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:959608059"
     variation       2683
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1016485269"
     variation       2684
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1006486333"
     variation       2686
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:73489148"
     variation       2691
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1364197764"
     variation       2692
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1455110594"
     variation       2700
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1026915435"
     variation       2702
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1359866417"
     variation       2703
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566170710"
     variation       2704
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1172254217"
     variation       2705
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1468017193"
     variation       2707
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376990440"
     variation       2713
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:997254637"
     variation       2716
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395673079"
     variation       2717
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1378783852"
     variation       2726
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:941680964"
     variation       2729
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:535014873"
     variation       2745
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1238486499"
     variation       2752
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1038687461"
     variation       2753
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1007221366"
     variation       2754
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182104463"
     variation       2757
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:980532486"
     variation       2758
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1349314061"
     variation       2762
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213577280"
     variation       2768
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436173408"
     variation       2771
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764304023"
     variation       2779
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:566065778"
     variation       2783
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1481966746"
     variation       2797
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1199546557"
     variation       2801
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:892808322"
     variation       2805
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:949556782"
     variation       2807..2808
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1176616028"
     variation       2809..2816
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="aaaa"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /replace="aaaaaaaaa"
                     /db_xref="dbSNP:rs957212862"
     variation       2809
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1265543823"
     variation       2810
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1054268966"
     variation       2811
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:934594162"
     variation       2812
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1488453973"
     variation       2817
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191072646"
     variation       2818..2823
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="ttttt"
                     /replace="tttttt"
                     /db_xref="dbSNP:1566170618"
     variation       2820
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1256563011"
     variation       2824
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:566122046"
     variation       2827
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:949484292"
     variation       2842
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1018288530"
     variation       2849
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1299758456"
     variation       2850
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:549120489"
     variation       2863
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:918030300"
     variation       2865
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565128269"
     variation       2869
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1458856890"
     variation       2877..2884
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="cttct"
                     /replace="cttcttct"
                     /db_xref="dbSNP:1468716986"
     variation       2878
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:937960418"
     variation       2879
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:909224402"
     variation       2880
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1226033314"
     variation       2883
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1046106"
     variation       2890
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1315555821"
     variation       2892
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1279655347"
     variation       2894
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:985017981"
     variation       2903
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1432491382"
     variation       2906
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753726528"
     variation       2916
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1425798710"
     variation       2924
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:529547282"
     variation       2927
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148270257"
     variation       2929
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11542904"
     variation       2942
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:976689419"
     variation       2950
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:965819930"
     variation       2960
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:897708347"
     variation       2960
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1367604138"
     variation       2963
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1037632913"
     variation       2978
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:941651179"
     variation       2979
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1046130"
     regulatory      2981..2986
                     /regulatory_class="polyA_signal_sequence"
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
     variation       2987
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:904877930"
     variation       2988
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1017734390"
     variation       2992
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376262240"
     variation       2993
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1007273719"
     variation       2994
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:892777244"
     variation       2995
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:561407931"
     variation       2999
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1244757352"
     variation       3001
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298125618"
     variation       3002
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998710936"
     polyA_site      3005
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
ORIGIN      
agctgagggagccgcaatgtctcttgacagcggcggcggcgcagccggttccgggttcggcgcggggcggggatgtgaatcccgatggagcggcccgaggaaggcaagcagtcgccgccgccgcagccctggggacggctcctgcgtctgggcgcggaggagggcgagccgcacgtcctcctgaggaagcgggagtggaccatcgggcggagacgaggttgcgacctttccttccccagcaataaactggtctctggagatcactgtagaattgtagtggatgaaaaatcaggtcaggtgacactggaagataccagcaccagtggaacagtgattaacaagctgaaggttgttaagaagcagacatgccctttacagactggggatgtcatctacttggtgtacaggaagaatgaaccggaacacaggtctgggggtggtggcatctcccctaaaggaagtggtccctctgtggcaagtgatgaagtctccagctttgcctcagctctcccagacagaaagactgcgtccttttcgtcgttggaaccccaggatcaggaggatttggagcccgtgaagaagaaaatgagaggagatggggaccttgacctgaacgggcagttgttggtcgcacaaccgcgtagaaatgcccaaaccgtccacgaggacgtcagagcagcggctgggaagccagacaagatggaggagacgctgacatgcatcatctgccaggacctgctgcacgactgcgtgagtttgcagccctgcatgcacacgttctgcgcggcttgctactcgggctggatggagcgctcgtccctgtgtcctacctgccgctgtcccgtggagcggatctgtaaaaaccacatcctcaacaacctcgtggaagcatacctcatccagcatccagacaagagtcgcagtgaagaagatgtgcaaagtatggatgccaggaataaaatcactcaagacatgctgcagcccaaagtcaggcggtctttttctgatgaagaagggagttcagaggacctgctggagctgtcagacgttgacagtgagtcctcagacattagccagccatacgtcgtgtgccggcagtgtcctgagtacagaaggcaggcggcgcagcctccccactgcccagcacccgagggcgagccaggagccccacaggccctgggggatgcaccctccacgtccgtcagcctgacgacagcagtccaggattacgtgtgccctctgcaaggaagccacgccctgtgcacctgctgcttccagcccatgcccgaccggagagcggagcgcgagcaggacccgcgtgtcgcccctcagcagtgtgcggtctgcctgcagcctttctgccacctgtactggggctgcacccggaccggctgctacggctgcctggccccgttttgtgagctcaacctgggtgacaagtgtctggacggcgtgctgaacaacaacagctacgagtcagacatcctgaagaattacctggcaaccagaggtttgacatggaaaaacatgttgaccgagagcctcgtggctctccagcggggagtgtttctgctgtctgattacagagtcacgggagacaccgttctgtgttactgctgtggcctgcgcagcttccgtgagctgacctatcagtatcggcagaacattcctgcttccgagttgccagtggccgtaacatcccgtcctgactgctactggggccgtaactgccgcactcaggtgaaagctcaccacgccatgaaattcaatcatatctgtgaacagacaaggttcaaaaactaagcatccagaggccctgagcagctttcagcactggaggtgaagagagcgtgtttttaaaatacagagacaagcacgtcaaggtgttttcacagccccctgagggaagggacgcagggtctccgacaggtgctctggggtgactcttctgtggagctttaccctctgagtgagaccctccccagagccccgggggccgcagcccgccctcctggtgagcgctgggcagggctcgtggtggcatcagcagcagagacgaagcctttctgtaacatgcggccgtcccgccgagaggggcagttttgctcttttgtacattttccgaaactacagttaaagcagaagtctgtttttaggaaaagtttcaagggagaagggcaagtttatcaaaaacattgtttcaggagaagggagcataagtttacagcctacaggacgtacacaatatcctgctgctgggaaaaccacagcattttatctattttttattttaataggtttggtgcttatcttctaataagatttaaatgtcacaaactgtagcacaaataatataatttataatttacaaattgactaaaattgggtatagtatggtatttgaaagaataagcatatgcttctgtttattaaaaaaagaaaccttccaatgtccaaaactgctaaccctcgacgtggccgccaagttagtcgctccttgctaaccggtgagtgaccgcggccccgagcctggggctggacgcaggtcccaggacatgctgctcccttgtgtgagtgaccgcggccccgagcctggggctggacgcaggtcccaggacgtgctgctcccttgtgtgagtgaccacggccccaagcccagggctggaggcaggtcccaggacgcgccgctccctcatgctgcccgggcccttcctccaagaccctacagagcctgaggggcaccttggcttccgcctgtgctagctttgccatgtcatctggaataatacttgaaattttgatttttggaaaaaaaagttttttatcttttgttgaaatcacctgttatccttgtttgtaaactgataacttttttgcttcttctcaggaatacagttttcaactgttgtcttgctcttgatagaaactgagaagcagcaatctgtatttgtggaggaaagtcctctcttttgcatattctaataaatgagccgcgtttgctcctcaaaaaaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]