GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 12:10:44, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NM_001161345            3288 bp    mRNA    linear   PRI 28-DEC-2019
DEFINITION  Homo sapiens checkpoint with forkhead and ring finger domains
            (CHFR), transcript variant 2, mRNA.
ACCESSION   NM_001161345
VERSION     NM_001161345.1
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3288)
  AUTHORS   Cha Y, Kim SY, Yeo HY, Baek JY, Choi MK, Jung KH, Dong SM and Chang
            HJ.
  TITLE     Association of CHFR Promoter Methylation with Treatment Outcomes of
            Irinotecan-Based Chemotherapy in Metastatic Colorectal Cancer
  JOURNAL   Neoplasia 21 (1), 146-155 (2019)
   PUBMED   30562637
  REMARK    GeneRIF: These data suggest that CHFR methylation may be associated
            with favorable treatment outcomes of irinotecan-based chemotherapy
            in patients with metastatic colorectal cancer.
REFERENCE   2  (bases 1 to 3288)
  AUTHORS   Woo SR, Lee HJ, Oh SJ, Kim S, Park SH, Lee J, Song KH and Kim TW.
  TITLE     Stabilization of HDAC1 via TCL1-pAKT-CHFR axis is a key element for
            NANOG-mediated multi-resistance and stem-like phenotype in
            immune-edited tumor cells
  JOURNAL   Biochem. Biophys. Res. Commun. 503 (3), 1812-1818 (2018)
   PUBMED   30060952
  REMARK    GeneRIF: The results establish a firm molecular link in
            immune-edited tumor cells among NANOG, AKT, CHFR, and HDAC1,
            identifying HDAC1 as a molecular target in controlling NANOGHIGH
            immune-refractory cancer.
REFERENCE   3  (bases 1 to 3288)
  AUTHORS   Zhou JD, Zhang TJ, Li XX, Ma JC, Guo H, Wen XM, Yao DM, Zhang W,
            Lin J and Qian J.
  TITLE     Methylation-independent CHFR expression is a potential biomarker
            affecting prognosis in acute myeloid leukemia
  JOURNAL   J. Cell. Physiol. 233 (6), 4707-4714 (2018)
   PUBMED   29115660
  REMARK    GeneRIF: Lower CHFR expression was independently associated with
            unfavorable prognosis in acute myeloid leukemia. Moreover, aberrant
            CHFR promoter methylation was a rare event in myeloid malignances.
REFERENCE   4  (bases 1 to 3288)
  AUTHORS   Castellano L, Dabrowska A, Pellegrino L, Ottaviani S, Cathcart P,
            Frampton AE, Krell J and Stebbing J.
  TITLE     Sustained expression of miR-26a promotes chromosomal instability
            and tumorigenesis through regulation of CHFR
  JOURNAL   Nucleic Acids Res. 45 (8), 4401-4412 (2017)
   PUBMED   28126920
  REMARK    GeneRIF: Re-expression of CHFR in miR-26a overexpressing cells
            partially rescues normal mitosis and impairs the tumorigenesis
            exerted by miR-26a.
REFERENCE   5  (bases 1 to 3288)
  AUTHORS   Kim M, Kwon YE, Song JO, Bae SJ and Seol JH.
  TITLE     CHFR negatively regulates SIRT1 activity upon oxidative stress
  JOURNAL   Sci Rep 6, 37578 (2016)
   PUBMED   27883020
  REMARK    GeneRIF: JNK inhibitor prevents SIRT1 phosphorylation, leading to
            elevated SIRT1 protein levels even in the presence of H2O2. Taken
            together, our results indicate that CHFR plays a crucial role in
            the cellular stress response pathway by controlling the stability
            and function of SIRT1.
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 3288)
  AUTHORS   Sanbhnani S and Yeong FM.
  TITLE     CHFR: a key checkpoint component implicated in a wide range of
            cancers
  JOURNAL   Cell. Mol. Life Sci. 69 (10), 1669-1687 (2012)
   PUBMED   22159584
  REMARK    GeneRIF: CHFR is thought to contribute towards regulating mitotic
            entry and possible explanations for contradictory observations
            published on the functions and regulation of CHFR are presented.
            [review]
            Review article
REFERENCE   7  (bases 1 to 3288)
  AUTHORS   Chaturvedi P, Sudakin V, Bobiak ML, Fisher PW, Mattern MR,
            Jablonski SA, Hurle MR, Zhu Y, Yen TJ and Zhou BB.
  TITLE     Chfr regulates a mitotic stress pathway through its RING-finger
            domain with ubiquitin ligase activity
  JOURNAL   Cancer Res. 62 (6), 1797-1801 (2002)
   PUBMED   11912157
  REMARK    GeneRIF: Chfr regulates a mitotic stress pathway through its
            RING-finger domain with ubiquitin ligase activity.
REFERENCE   8  (bases 1 to 3288)
  AUTHORS   Kang D, Chen J, Wong J and Fang G.
  TITLE     The checkpoint protein Chfr is a ligase that ubiquitinates Plk1 and
            inhibits Cdc2 at the G2 to M transition
  JOURNAL   J. Cell Biol. 156 (2), 249-259 (2002)
   PUBMED   11807090
  REMARK    GeneRIF: checkpoint protein Chfr is a ligase that ubiquitinates
            Plk1 and inhibits Cdc2 at the G2 to M transition
REFERENCE   9  (bases 1 to 3288)
  AUTHORS   Scolnick DM and Halazonetis TD.
  TITLE     Chfr defines a mitotic stress checkpoint that delays entry into
            metaphase
  JOURNAL   Nature 406 (6794), 430-435 (2000)
   PUBMED   10935642
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from BP313700.1, AK304333.1,
            AK027687.1, AC127070.10 and BC012072.1.
            
            Summary: This gene encodes an E3 ubiquitin-protein ligase required
            for the maintenance of the antephase checkpoint that regulates cell
            cycle entry into mitosis and, therefore, may play a key role in
            cell cycle progression and tumorigenesis. The encoded protein has
            an N-terminal forkhead-associated domain, a central RING-finger
            domain, and a cysteine-rich C-terminal region. Alternatively
            spliced transcript variants that encode different protein isoforms
            have been described. [provided by RefSeq, Mar 2014].
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK304333.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMEA1965299, SAMEA1966682
                                           [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-13                BP313700.1         1-13
            14-968              AK304333.1         1-955
            969-969             AK027687.1         927-927
            970-1785            AK304333.1         957-1772
            1786-1877           AK027687.1         1747-1838
            1878-2146           AK304333.1         1865-2133
            2147-2931           AC127070.10        108335-109119
            2932-3288           BC012072.1         2825-3181
FEATURES             Location/Qualifiers
     source          1..3288
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="12"
                     /map="12q24.33"
     gene            1..3288
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /note="checkpoint with forkhead and ring finger domains"
                     /db_xref="GeneID:55743"
                     /db_xref="HGNC:HGNC:20455"
                     /db_xref="MIM:605209"
     exon            1..72
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1361815684"
     variation       4
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1003781663"
     variation       7
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1287541768"
     variation       11
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:553012411"
     variation       12
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:905468008"
     variation       16
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:534357480"
     variation       17
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:570446374"
     variation       18
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:896280970"
     variation       23
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1452969814"
     variation       24
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468914426"
     variation       29
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1403273314"
     variation       30..41
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="gcggcggcggcg"
                     /replace="gcggcggcggcggcg"
                     /db_xref="dbSNP:1462255454"
     variation       30
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1052274666"
     variation       32
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1023737356"
     variation       35
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1177915172"
     variation       36
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1305328622"
     variation       37
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043377910"
     variation       38
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:942391667"
     variation       39
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:910903529"
     variation       40
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:986491943"
     variation       43
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:867733545"
     variation       44
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:866582582"
     variation       45
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1184602056"
     variation       46
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1457982394"
     variation       47
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1180202481"
     variation       49
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:955129324"
     variation       50
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1418375663"
     variation       52
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:918721775"
     variation       53
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1379340094"
     variation       54
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:558080896"
     variation       55
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1401227842"
     variation       58
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1203285887"
     variation       59
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1373084089"
     variation       60
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1460094658"
     variation       62
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:972910573"
     variation       63
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:962990830"
     variation       68
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210883392"
     variation       69
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1261984726"
     variation       71
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1318118652"
     variation       72
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1307468722"
     exon            73..217
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    76..78
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /note="upstream in-frame stop codon"
     variation       81..83
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1000300479"
     variation       81
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756050840"
     variation       82
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1200689283"
     variation       83
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745782659"
     CDS             85..2076
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /EC_number="2.3.2.27"
                     /note="isoform 2 is encoded by transcript variant 2; RING
                     finger protein 196; checkpoint with forkhead and ring
                     finger domains, E3 ubiquitin protein ligase; RING-type E3
                     ubiquitin transferase CHFR"
                     /codon_start=1
                     /product="E3 ubiquitin-protein ligase CHFR isoform 2"
                     /protein_id="NP_001154817.1"
                     /db_xref="GeneID:55743"
                     /db_xref="HGNC:HGNC:20455"
                     /db_xref="MIM:605209"
                     /translation="
MERPEEGKQSPPPQPWGRLLRLGAEEGEPHVLLRKREWTIGRRRGCDLSFPSNKLVSGDHCRIVVDEKSGQVTLEDTSTSGTVINKLKVVKKQTCPLQTGDVIYLVYRKNEPEHNVAYLYESLSEKQGMTQESFEANKENVFHGTKDTSGAGAGRGADPRVPPSSPATQVCFEEPQPSTSTSDLFPTASASSTEPSPAGRERSSSCGSGGGGISPKGSGPSVASDEVSSFASALPDRKTASFSSLEPQDQEDLEPVKKKMRGDGDLDLNGQLLVAQPRRNAQTVHEDVRAAAGKPDKMEETLTCIICQDLLHDCVSLQPCMHTFCAACYSGWMERSSLCPTCRCPVERICKNHILNNLVEAYLIQHPDKSRSEEDVQSMDARNKITQDMLQPKVRRSFSDEEGSSEDLLELSDVDSESSDISQPYVVCRQCPEYRRQAAQPPHCPAPEGEPGAPQALGDAPSTSVSLTTVQDYVCPLQGSHALCTCCFQPMPDRRAEREQDPRVAPQQCAVCLQPFCHLYWGCTRTGCYGCLAPFCELNLGDKCLDGVLNNNSYESDILKNYLATRGLTWKNMLTESLVALQRGVFLLSDYRVTGDTVLCYCCGLRSFRELTYQYRQNIPASELPVAVTSRPDCYWGRNCRTQVKAHHAMKFNHICEQTRFKN"
     misc_feature    130..399
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /note="Forkhead associated domain (FHA); found in
                     eukaryotic and prokaryotic proteins. Putative nuclear
                     signalling domain. FHA domains may bind phosphothreonine,
                     phosphoserine and sometimes phosphotyrosine. In
                     eukaryotes, many FHA domain-containing proteins...;
                     Region: FHA; cd00060"
                     /db_xref="CDD:238017"
     misc_feature    <175..504
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /note="Forkhead associated (FHA) domain, binds pSer, pThr,
                     pTyr [Signal transduction mechanisms]; Region: FHA;
                     COG1716"
                     /db_xref="CDD:224630"
     misc_feature    order(208..210,247..249,253..258,319..327)
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /note="phosphopeptide binding site; other site"
                     /db_xref="CDD:238017"
     misc_feature    814..816
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine. {ECO:0000244|PubMed:23186163};
                     propagated from UniProtKB/Swiss-Prot (Q96EP1.2);
                     phosphorylation site"
     misc_feature    991..1122
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /note="RING-finger (Really Interesting New Gene) domain, a
                     specialized type of Zn-finger of 40 to 60 residues that
                     binds two atoms of zinc; defined by the 'cross-brace'
                     motif C-X2-C-X(9-39)-C-X(1-3)-
                     H-X(2-3)-(N/C/H)-X2-C-X(4-48)C-X2-C; probably involved
                     in...; Region: RING; cd00162"
                     /db_xref="CDD:238093"
     misc_feature    order(994..996,1003..1005,1042..1044,1048..1050,
                     1057..1059,1066..1068,1099..1101,1108..1110)
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /note="cross-brace motif; other site"
                     /db_xref="CDD:238093"
     misc_feature    1240..1242
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine. {ECO:0000250|UniProtKB:Q810L3};
                     propagated from UniProtKB/Swiss-Prot (Q96EP1.2);
                     phosphorylation site"
     variation       87
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1323042743"
     variation       89
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:780919643"
     variation       92
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757065782"
     variation       93
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:879451433"
     variation       94
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252988651"
     variation       100
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1285867152"
     variation       104
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1453369842"
     variation       107
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381686714"
     variation       109
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1334460653"
     variation       113..124
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="cgccgccgc"
                     /replace="cgccgccgccgc"
                     /replace="cgccgccgccgccgc"
                     /db_xref="dbSNP:765917829"
     variation       113
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752932212"
     variation       115
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372093401"
     variation       117
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566211828"
     variation       118
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1459172597"
     variation       121
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1022133046"
     variation       122
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1407689006"
     variation       123
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1415407421"
     variation       126
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184750358"
     variation       127
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444571399"
     variation       129
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:547086677"
     variation       131..134
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1180924768"
     variation       136
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481059648"
     variation       141
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1327949016"
     variation       142
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1250940821"
     variation       146
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1202757955"
     variation       148
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1323574369"
     variation       151
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1292594475"
     variation       153
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1246548917"
     variation       156
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753867941"
     variation       157
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1312590714"
     variation       159
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448675201"
     variation       161
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373843772"
     variation       165
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1297235638"
     variation       169
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766461060"
     variation       170
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1242357676"
     variation       171
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:889736424"
     variation       172
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1050716303"
     variation       174
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1163686245"
     variation       175
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424534907"
     variation       177
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761126986"
     variation       178
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:896897715"
     variation       180
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1161017404"
     variation       181
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:558346895"
     variation       183
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1291046887"
     variation       186
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:994965729"
     variation       189
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1250327307"
     variation       191
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1037164725"
     variation       192
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1175632960"
     variation       198
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1489596045"
     variation       201
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1269637112"
     variation       202
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1329871429"
     variation       205
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1220935343"
     variation       207
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360131934"
     variation       208
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:941122476"
     variation       214
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1221878184"
     exon            218..317
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       219..220
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1566203316"
     variation       221
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762757910"
     variation       222
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775199616"
     variation       223
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1016169013"
     variation       226
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370348872"
     variation       229
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1184762410"
     variation       232
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776467669"
     variation       234
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1371415158"
     variation       235
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765839818"
     variation       236
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770855105"
     variation       238
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:146088609"
     variation       241
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77052806"
     variation       244
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:540426488"
     variation       249
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771849929"
     variation       254
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1325393287"
     variation       257
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:573017098"
     variation       258
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:780255609"
     variation       259
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:956973617"
     variation       262
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756177652"
     variation       263
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1336502857"
     variation       264
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1468386635"
     variation       272
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750466757"
     variation       274
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781107351"
     variation       275
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142824452"
     variation       277
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1372280960"
     variation       278
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752104453"
     variation       283
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1190933998"
     variation       291
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1446377947"
     variation       292
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764607751"
     variation       296
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763356188"
     variation       302
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1436266778"
     variation       303
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:115711908"
     variation       304
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252203966"
     variation       309
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1390531305"
     variation       314
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1196075617"
     variation       315
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764905392"
     variation       317
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:996565819"
     exon            318..427
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       320
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1405603798"
     variation       321
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200283117"
     variation       330
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138320999"
     variation       333
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1262248032"
     variation       341
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403538188"
     variation       349..354
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="gtt"
                     /replace="gttgtt"
                     /db_xref="dbSNP:749471534"
     variation       351
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1026698840"
     variation       358
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:753427887"
     variation       360
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1409273260"
     variation       361
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765931951"
     variation       362
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145622325"
     variation       363
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:896801495"
     variation       370
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1220821081"
     variation       377
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:773164146"
     variation       379
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1285340068"
     variation       391
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1204882792"
     variation       395
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1349041006"
     variation       397
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767392115"
     variation       399
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761633567"
     variation       400
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774239471"
     variation       405
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768330210"
     variation       413
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1281470229"
     variation       415
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1036686943"
     variation       417
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1277101257"
     variation       419
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377703818"
     variation       420
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771143796"
     variation       424
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201058448"
     variation       425
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778449705"
     variation       427
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758996497"
     exon            428..487
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       429
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368692761"
     variation       430
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765096474"
     variation       433
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1300704622"
     variation       435
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761045629"
     variation       436
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1402185439"
     variation       439
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773555344"
     variation       443
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772208422"
     variation       451
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1428337510"
     variation       454
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1387598301"
     variation       462
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1164831443"
     variation       466
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:202105666"
     variation       467
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769092725"
     variation       469
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1415955003"
     variation       472
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1312795252"
     variation       474
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374502930"
     variation       475
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761297928"
     variation       476
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1481092256"
     variation       478
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780460479"
     variation       480
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773617187"
     variation       483
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1443614623"
     exon            488..703
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       490
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:997424313"
     variation       494
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1287311542"
     variation       495
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141763844"
     variation       500
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767585723"
     variation       501
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1277771516"
     variation       502
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283386653"
     variation       503
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1404832547"
     variation       507
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1038860837"
     variation       511
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366157844"
     variation       513
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:547902011"
     variation       521
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1454615091"
     variation       524
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1415698891"
     variation       530..545
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="caggtgcagg"
                     /replace="caggtgcaggtgcagg"
                     /replace="caggtgcaggtgcaggtgcagg"
                     /db_xref="dbSNP:1566196191"
     variation       534
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1345035376"
     variation       538
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:529705996"
     variation       539
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:968187911"
     variation       540
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1053846225"
     variation       545
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1430015478"
     variation       546
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566196184"
     variation       548
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761341813"
     variation       550..553
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:1431549533"
     variation       555
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1265155365"
     variation       556
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768775618"
     variation       559
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:565366267"
     variation       560
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1267263973"
     variation       561
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:547367271"
     variation       562
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746187833"
     variation       563
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780923793"
     variation       569
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1231852845"
     variation       570
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1309985498"
     variation       572
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298364440"
     variation       575
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1030329804"
     variation       576
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199790262"
     variation       577
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1318983295"
     variation       578
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371470066"
     variation       579
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777219646"
     variation       581
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1176037831"
     variation       582
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1422710949"
     variation       583
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:998173223"
     variation       586
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1359228046"
     variation       587
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:757969077"
     variation       589
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748110156"
     variation       591
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:991093892"
     variation       592
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775208965"
     variation       594
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186481589"
     variation       596
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1462519990"
     variation       609
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1212965676"
     variation       610
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1243354590"
     variation       611
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756710137"
     variation       620
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:959491929"
     variation       621
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753235007"
     variation       623
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778929950"
     variation       624
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:909400005"
     variation       626
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252563891"
     variation       627
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754853631"
     variation       634
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1342113004"
     variation       639
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296093228"
     variation       640
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368788828"
     variation       643
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1398898916"
     variation       647
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:984493040"
     variation       650
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1048846757"
     variation       651
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:528825047"
     variation       652
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:564810555"
     variation       653
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1382340206"
     variation       657
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751789347"
     variation       658
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1298843354"
     variation       659
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:546136386"
     variation       660
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1430290279"
     variation       662
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:541715629"
     variation       663
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75391939"
     variation       665
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1166700448"
     variation       669
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1446218228"
     variation       673
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1385634222"
     variation       678
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:965751134"
     variation       681
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:563840755"
     variation       682
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745321936"
     variation       683
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776005190"
     variation       688
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1042155534"
     variation       689
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765687815"
     variation       694
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1460603946"
     variation       697
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381533831"
     variation       701
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1225450271"
     exon            704..871
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       707
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1038150337"
     variation       709
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370517411"
     variation       712
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1438318944"
     variation       713
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777186106"
     variation       715..716
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1189456093"
     variation       715
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766667278"
     variation       718
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761034338"
     variation       721
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138637226"
     variation       724
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1387477118"
     variation       727
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34220055"
     variation       728
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761525824"
     variation       737
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774070010"
     variation       738
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1419993206"
     variation       740
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201192149"
     variation       741
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:989203291"
     variation       747
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:796201985"
     variation       748
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1163339779"
     variation       756
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749192848"
     variation       760
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374107669"
     variation       762
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769505625"
     variation       767
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780945230"
     variation       784
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35206714"
     variation       787
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1366834805"
     variation       789
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1038008124"
     variation       791
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:560433355"
     variation       796
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201727566"
     variation       801
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758662673"
     variation       802
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:533118486"
     variation       803
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150995074"
     variation       804
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755027328"
     variation       807
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:908433616"
     variation       810
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200213031"
     variation       812
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754307363"
     variation       813
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145246258"
     variation       815
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141183005"
     variation       816
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767988129"
     variation       817..818
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:766718829"
     variation       819
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1566189184"
     variation       820
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1423637297"
     variation       823..826
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:762524769"
     variation       823
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751592981"
     variation       827
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373754363"
     variation       828
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761615752"
     variation       829
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147803776"
     variation       831
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1566189143"
     variation       837
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774088595"
     variation       838
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1472958431"
     variation       846
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768052255"
     variation       848
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762481129"
     variation       849
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1025589682"
     variation       850
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775309126"
     variation       852
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764279540"
     variation       854
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1463671908"
     variation       856
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:974854406"
     variation       859
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1221100387"
     variation       861
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1238379063"
     variation       863
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566189061"
     variation       868
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745763828"
     exon            872..1031
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       873
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756088633"
     variation       877
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:563202190"
     variation       881
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1360404336"
     variation       885
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781748631"
     variation       888
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757715316"
     variation       890
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752016583"
     variation       891
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377318460"
     variation       892
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115096950"
     variation       894
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393923793"
     variation       895..896
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:776753889"
     variation       896
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1311480210"
     variation       897
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758139441"
     variation       898
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:973250523"
     variation       900
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1021390710"
     variation       904
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752281100"
     variation       906
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115431373"
     variation       907
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148618944"
     variation       909
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369526598"
     variation       912
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769878915"
     variation       913
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:540759128"
     variation       914
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760584451"
     variation       915
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773102049"
     variation       916
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749537035"
     variation       917
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375174098"
     variation       919
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770024903"
     variation       925
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188170704"
     variation       926
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745889598"
     variation       928
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:781395404"
     variation       930
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757876886"
     variation       933
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747517165"
     variation       934
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199761208"
     variation       939
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1380131918"
     variation       940
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144838296"
     variation       942
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1449844658"
     variation       944
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1000960906"
     variation       945
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371434249"
     variation       946
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764757412"
     variation       947
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:768680290"
     variation       947
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1464052810"
     variation       949
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754506935"
     variation       950
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149862277"
     variation       954
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765845584"
     variation       956
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1277312621"
     variation       957
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746414469"
     variation       958
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1341883561"
     variation       960
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295926976"
     variation       962
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306779303"
     variation       965
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1375950961"
     variation       969
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:35011845"
     variation       970
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1341253353"
     variation       975
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1312306793"
     variation       976
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:767348322"
     variation       978
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1352413194"
     variation       986
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761474515"
     variation       987
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775799321"
     variation       993
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1369689338"
     variation       999
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770185579"
     variation       1000
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1252007101"
     variation       1002
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12315353"
     variation       1005
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146107503"
     variation       1011
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1368629651"
     variation       1014
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186411942"
     variation       1016
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759798633"
     variation       1020
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1253421391"
     variation       1026
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776915637"
     variation       1027
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771123706"
     variation       1029
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1469130916"
     exon            1032..1186
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       1032
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:560066373"
     variation       1036
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1213141444"
     variation       1040
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780721649"
     variation       1041
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:565644778"
     variation       1045
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:987211916"
     variation       1048
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566185781"
     variation       1049
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1174814592"
     variation       1050
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1478670195"
     variation       1052
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751498855"
     variation       1053
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142975525"
     variation       1056
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1466544467"
     variation       1059
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138280939"
     variation       1060
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754144763"
     variation       1061
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:921635691"
     variation       1062
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766660009"
     variation       1063
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760933260"
     variation       1064
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1221124973"
     variation       1070
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368405665"
     variation       1071
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767634272"
     variation       1073
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762287710"
     variation       1074
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1367099211"
     variation       1076
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774770261"
     variation       1081
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1433978124"
     variation       1083
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:553735979"
     variation       1084..1086
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="gag"
                     /replace="gagag"
                     /db_xref="dbSNP:1566185670"
     variation       1085
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:968563777"
     variation       1087
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749601873"
     variation       1088
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775805064"
     variation       1091
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1402056016"
     variation       1092
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769371058"
     variation       1095
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745529097"
     variation       1101
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780623191"
     variation       1105
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:535313174"
     variation       1106
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756736276"
     variation       1108
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1474574138"
     variation       1111
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770034782"
     variation       1112
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146343801"
     variation       1115
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1441931198"
     variation       1117
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:571101753"
     variation       1119
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115029653"
     variation       1120
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1344021759"
     variation       1126
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182092641"
     variation       1127
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756361707"
     variation       1131
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1359376881"
     variation       1133
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141404869"
     variation       1136
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767497782"
     variation       1138
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1313496770"
     variation       1139
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1319716667"
     variation       1140
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1339366523"
     variation       1146
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375199215"
     variation       1151
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774858017"
     variation       1153
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1371529354"
     variation       1154
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764629991"
     variation       1156
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1255988921"
     variation       1158
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191062458"
     variation       1159
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775898959"
     variation       1162
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1182669640"
     variation       1165
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213131732"
     variation       1166
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1241168194"
     variation       1170
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148311652"
     variation       1173
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143181439"
     variation       1174
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1241159400"
     variation       1176
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770380694"
     variation       1180
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746470663"
     variation       1181
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370386571"
     exon            1187..1349
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       1188
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1227736511"
     variation       1189..1190
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="aa"
                     /db_xref="dbSNP:777961507"
     variation       1195
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1210874026"
     variation       1197
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:928539042"
     variation       1203
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566184554"
     variation       1210
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:879123151"
     variation       1212
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1229649968"
     variation       1214
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777930523"
     variation       1215
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566184534"
     variation       1217
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1293723698"
     variation       1219
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377225060"
     variation       1223
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:748309050"
     variation       1224
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778828908"
     variation       1225
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1434082116"
     variation       1226
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200764395"
     variation       1227
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369063253"
     variation       1228
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1026572995"
     variation       1229
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766865645"
     variation       1230
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2062163"
     variation       1238
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1047280041"
     variation       1239
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750119581"
     variation       1241
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760238279"
     variation       1243
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761337268"
     variation       1249
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150467142"
     variation       1257
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763498728"
     variation       1266
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:930183182"
     variation       1267
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1322357484"
     variation       1268
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762961678"
     variation       1269
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:879252133"
     variation       1270
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:920205326"
     variation       1271
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201828860"
     variation       1274
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769607729"
     variation       1275
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745615761"
     variation       1278
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:776390811"
     variation       1282
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:974463026"
     variation       1285..1291
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="gaag"
                     /replace="gaagaag"
                     /db_xref="dbSNP:1434190222"
     variation       1292
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772321674"
     variation       1295
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1315657949"
     variation       1298
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1413044699"
     variation       1302
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1353432969"
     variation       1309
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1309789349"
     variation       1314
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748314312"
     variation       1320
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1283784330"
     variation       1323
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395585538"
     variation       1324
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1165776578"
     variation       1334
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:779111370"
     variation       1338
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1368718436"
     variation       1347
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754958760"
     exon            1350..1492
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       1353
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1286314037"
     variation       1354
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1020597739"
     variation       1356
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748419509"
     variation       1357
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372270460"
     variation       1358
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013270057"
     variation       1359
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1438322046"
     variation       1360
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768814594"
     variation       1361
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1318363216"
     variation       1362
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749373830"
     variation       1363
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150627547"
     variation       1365
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368755833"
     variation       1369
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1435723841"
     variation       1370
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746360566"
     variation       1371
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1191956640"
     variation       1377
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1451601823"
     variation       1379
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781699438"
     variation       1382
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:757496767"
     variation       1386
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1192492326"
     variation       1390
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1445358565"
     variation       1397
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374229656"
     variation       1398
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777240371"
     variation       1399
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1303770543"
     variation       1400
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371541325"
     variation       1401
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:563852229"
     variation       1405
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1231849613"
     variation       1408
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366854652"
     variation       1409
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1270421677"
     variation       1410
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1429332642"
     variation       1412
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1176161885"
     variation       1413
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764723102"
     variation       1423
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1237028076"
     variation       1425
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759529335"
     variation       1426
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753721064"
     variation       1428
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1375184437"
     variation       1430
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367968934"
     variation       1431
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374006779"
     variation       1432
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774658371"
     variation       1433
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1167629443"
     variation       1434
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566181842"
     variation       1435
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:924051400"
     variation       1437
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1041545091"
     variation       1441
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768798394"
     variation       1443
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1239336733"
     variation       1458
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1189940191"
     variation       1463
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138207644"
     variation       1465
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256747525"
     variation       1467
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1379314322"
     variation       1468
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775767314"
     variation       1471
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1196421815"
     variation       1472
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769933100"
     variation       1473
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746380972"
     variation       1474
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1215461680"
     variation       1476
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781511228"
     variation       1477
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141835819"
     variation       1481
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747380214"
     variation       1484
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778169456"
     variation       1486
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1355326421"
     variation       1487
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752333209"
     variation       1488
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:536396076"
     exon            1493..1609
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       1494
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146976267"
     variation       1496
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765605647"
     variation       1497
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1408464611"
     variation       1503
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141349945"
     variation       1504
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776642806"
     variation       1509
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306934237"
     variation       1510
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764423128"
     variation       1513
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766469365"
     variation       1515
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761102171"
     variation       1520
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1304421220"
     variation       1524
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773703522"
     variation       1525
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772460210"
     variation       1527
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147791929"
     variation       1528
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1454391193"
     variation       1532
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1345653105"
     variation       1533
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:116286061"
     variation       1536
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768361418"
     variation       1538
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1396714833"
     variation       1539..1546
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="ctgct"
                     /replace="ctgctgct"
                     /db_xref="dbSNP:1363396811"
     variation       1539
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748952886"
     variation       1540
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:763257394"
     variation       1542
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278317795"
     variation       1550
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779441212"
     variation       1551
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775978433"
     variation       1558
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1187706335"
     variation       1560
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781224248"
     variation       1561
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757239007"
     variation       1564
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:936864653"
     variation       1565
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:969442993"
     variation       1568
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751440176"
     variation       1571
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2306541"
     variation       1572
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755310429"
     variation       1573
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298012137"
     variation       1576
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754035414"
     variation       1577
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:944300584"
     variation       1578
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766376169"
     variation       1579
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150920425"
     variation       1582
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1015010652"
     variation       1583
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:773617183"
     variation       1589
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768065335"
     variation       1590
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142511371"
     variation       1591
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114117795"
     variation       1592
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201454195"
     variation       1593
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172173801"
     variation       1594
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200436687"
     variation       1596
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:920038038"
     variation       1597
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746554223"
     variation       1599
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:973207321"
     variation       1603
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1486915053"
     variation       1605
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346472721"
     variation       1606
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1258850426"
     variation       1608
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769207559"
     exon            1610..1693
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       1612
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372012714"
     variation       1613
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201350082"
     variation       1614
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:7975454"
     variation       1617
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375656978"
     variation       1623
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1335016856"
     variation       1625
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201237898"
     variation       1626
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1442703181"
     variation       1627
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765505226"
     variation       1628
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1324580295"
     variation       1637
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403110794"
     variation       1644
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759242088"
     variation       1649
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:953787024"
     variation       1653
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:546055046"
     variation       1655
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766020195"
     variation       1657
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371092913"
     variation       1658
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146156998"
     variation       1659
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1454840670"
     variation       1660
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:979112170"
     variation       1661
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252629926"
     variation       1662
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772089817"
     variation       1663
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448818469"
     variation       1668
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1249069969"
     variation       1670
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767140702"
     variation       1671
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765611625"
     variation       1672
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1349644861"
     variation       1677
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189987561"
     variation       1678
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1236250946"
     variation       1680
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:966632867"
     variation       1684
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1348083185"
     variation       1685
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1302248351"
     variation       1686
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1433674477"
     variation       1689
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1327743680"
     exon            1694..1764
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       1695
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777921940"
     variation       1701
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200853567"
     variation       1704
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748721756"
     variation       1705
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1179840200"
     variation       1710
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1471040037"
     variation       1713
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1415191475"
     variation       1715
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1233090445"
     variation       1722
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372404283"
     variation       1723
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755522022"
     variation       1724
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754297675"
     variation       1725
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1323808548"
     variation       1734
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1213796881"
     variation       1735
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:780565079"
     variation       1736
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1288355908"
     variation       1739
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225827826"
     variation       1740
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755891788"
     variation       1742
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1288380542"
     variation       1746
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749973618"
     variation       1748
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1379904886"
     variation       1749
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767082498"
     variation       1755
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1416698488"
     variation       1759
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761176081"
     variation       1764
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1326600805"
     exon            1765..1852
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       1766
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1432073088"
     variation       1770
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1422500887"
     variation       1771
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:899072283"
     variation       1772
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1008556440"
     variation       1777
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776466473"
     variation       1781
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:576074865"
     variation       1786
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2306537"
     variation       1791
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:536151635"
     variation       1792
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1281285798"
     variation       1793
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1378971375"
     variation       1795..1799
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="aaaaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:1224656808"
     variation       1799
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1232869629"
     variation       1801
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200187965"
     variation       1809
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749821203"
     variation       1810
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780655269"
     variation       1816
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770399858"
     variation       1818
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:899313894"
     variation       1819
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2306536"
     variation       1822
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1485801990"
     variation       1823
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781614371"
     variation       1824
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756917083"
     variation       1829
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1313082363"
     variation       1830
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1465200907"
     variation       1831
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357095646"
     variation       1832
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:558156375"
     variation       1839
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363290036"
     variation       1843
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1428595949"
     variation       1850
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1423530802"
     exon            1853..1960
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       1853
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1265969471"
     variation       1865
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115684143"
     variation       1866
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1222086097"
     variation       1875
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115566777"
     variation       1876
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758025460"
     variation       1878
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:976650599"
     variation       1879
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747697880"
     variation       1880
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1566173893"
     variation       1886
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1356919481"
     variation       1888
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778392987"
     variation       1889
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754931883"
     variation       1890
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442480016"
     variation       1899
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:937547511"
     variation       1900
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:961309862"
     variation       1901
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:557461509"
     variation       1902
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1456695524"
     variation       1904
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766096241"
     variation       1909
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376798546"
     variation       1915
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1439266364"
     variation       1919
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764448295"
     variation       1921
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220708351"
     variation       1923
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1195509679"
     variation       1925
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114483951"
     variation       1930
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775769340"
     variation       1931
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144644143"
     variation       1950
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373411620"
     variation       1951
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777155485"
     variation       1957
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76224039"
     exon            1961..2033
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       1965
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772354359"
     variation       1966
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761464761"
     variation       1967
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1476434657"
     variation       1969
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1425682767"
     variation       1974
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1194364986"
     variation       1980
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774002945"
     variation       1983
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1260717996"
     variation       1984
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1212784968"
     variation       1989
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768078789"
     variation       1996
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192495200"
     variation       1997
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779420556"
     variation       2003..2007
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="gc"
                     /replace="gccgc"
                     /db_xref="dbSNP:1218603125"
     variation       2005
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769922499"
     variation       2006
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745735958"
     variation       2009
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1339131647"
     variation       2012
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1188833829"
     variation       2014
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1295444518"
     variation       2016
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1449229353"
     variation       2022
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1340024053"
     variation       2028
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146332668"
     variation       2029
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371841032"
     variation       2031
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1401175113"
     variation       2032
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752894210"
     variation       2033
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779235326"
     exon            2034..3278
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /inference="alignment:Splign:2.1.0"
     variation       2040
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1456116703"
     variation       2042
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:549826875"
     variation       2045
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1223009144"
     variation       2046
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772496941"
     variation       2059
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1288110354"
     variation       2060
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1190631767"
     variation       2064
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200441646"
     variation       2077
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1242787279"
     variation       2084
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776670620"
     variation       2085
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:770961851"
     variation       2087
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1566171705"
     variation       2088
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1238046110"
     variation       2091
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746869999"
     variation       2092
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777416500"
     variation       2093
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:755292850"
     variation       2094
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:973123804"
     variation       2096
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375664747"
     variation       2099..2101
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1566171684"
     variation       2102
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780118329"
     variation       2106
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1293032557"
     variation       2107
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756135373"
     variation       2113
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750955936"
     variation       2114
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1157735470"
     variation       2115
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:531300162"
     variation       2118
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757695645"
     variation       2119
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113800546"
     variation       2122
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752032125"
     variation       2123
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:549782692"
     variation       2124
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762683133"
     variation       2141
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314603974"
     variation       2145
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1353651008"
     variation       2146
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1286369531"
     variation       2147
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1045979"
     variation       2150
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:954494653"
     variation       2151
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749186808"
     variation       2153
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1283042988"
     variation       2156
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237120100"
     variation       2157
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1348995249"
     variation       2162
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1030178377"
     variation       2174
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:925838751"
     variation       2177
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361292300"
     variation       2183
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:974644686"
     variation       2186
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:567430632"
     variation       2187
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1341331550"
     variation       2191
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:911586191"
     variation       2194
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:542153503"
     variation       2197
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1156419163"
     variation       2198
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1435059615"
     variation       2201
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370209943"
     variation       2203
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:950536054"
     variation       2208
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:559705268"
     variation       2210
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1010901456"
     variation       2214
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298882440"
     variation       2216
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:893810615"
     variation       2222
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:963549804"
     variation       2231..2233
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="ttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:3832804"
     variation       2235
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111820152"
     variation       2236
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1052601435"
     variation       2238
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1414983132"
     variation       2244
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:935595520"
     variation       2249..2251
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1418783722"
     variation       2255
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1002477975"
     variation       2262
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278595598"
     variation       2264
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1347878070"
     variation       2265
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541179525"
     variation       2269
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:576945941"
     variation       2271
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769326943"
     variation       2272
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:892514179"
     variation       2273
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1054288089"
     variation       2278
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367620504"
     variation       2279
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:916367947"
     variation       2282
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:973064787"
     variation       2288
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1038910312"
     variation       2289
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:963001005"
     variation       2290..2291
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="cc"
                     /replace="ga"
                     /db_xref="dbSNP:796574941"
     variation       2291
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:943323229"
     variation       2304
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370314942"
     variation       2307
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182916402"
     variation       2308
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3741490"
     variation       2313
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1443374356"
     variation       2319
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:983339952"
     variation       2324
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1301770978"
     variation       2330
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:987116079"
     variation       2333
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554895850"
     variation       2345
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298316988"
     variation       2350
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:75237791"
     variation       2351
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746850522"
     variation       2353
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1353265460"
     variation       2354
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777597930"
     variation       2355
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:973165920"
     variation       2359
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758214417"
     variation       2360
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:996057076"
     variation       2362
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192844482"
     variation       2363..2367
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="gag"
                     /replace="gagag"
                     /db_xref="dbSNP:1423726431"
     variation       2363
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:547619077"
     variation       2371
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1010952147"
     variation       2372
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002451487"
     variation       2378
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:893777773"
     variation       2382
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1030977492"
     variation       2384
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1163686844"
     variation       2396
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781543889"
     variation       2397
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:906815915"
     variation       2401
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1415593537"
     variation       2403
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1046993159"
     variation       2413
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1334852400"
     variation       2414
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3741489"
     variation       2424
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1270832087"
     variation       2425
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1450666893"
     variation       2427
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:4758909"
     variation       2435
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201112509"
     variation       2438
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1192780707"
     variation       2449
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1258321216"
     variation       2453
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112870346"
     variation       2458
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1476204979"
     variation       2459
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1163079471"
     variation       2464
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754605513"
     variation       2465
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:549889950"
     variation       2468
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1458219528"
     variation       2475
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1413405596"
     variation       2483
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1037421988"
     variation       2485..2487
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="gag"
                     /db_xref="dbSNP:1272645289"
     variation       2489
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1053774837"
     variation       2494
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1401470577"
     variation       2499
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1231595234"
     variation       2502
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1161815482"
     variation       2508
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1343788492"
     variation       2510
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:941773272"
     variation       2511
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907515157"
     variation       2512
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142376269"
     variation       2517..2518
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:36039891"
     variation       2528
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:933225060"
     variation       2538
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1355291257"
     variation       2540
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1223981564"
     variation       2550
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:923251377"
     variation       2554
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755120503"
     variation       2558
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566171220"
     variation       2562
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:964542689"
     variation       2566
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1021425081"
     variation       2579..2586
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="ctt"
                     /replace="cttatctt"
                     /db_xref="dbSNP:943198387"
     variation       2584
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:989498094"
     variation       2589
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1215845332"
     variation       2601
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1258077252"
     variation       2607
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296311836"
     variation       2613
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:958138392"
     variation       2626..2641
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="tataattta"
                     /replace="tataatttataattta"
                     /db_xref="dbSNP:1401013436"
     variation       2626
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1486597998"
     variation       2638
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1030946220"
     variation       2646
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1236969685"
     variation       2651
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:911779056"
     variation       2654
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1179105860"
     variation       2658
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1406240647"
     variation       2660
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:560709767"
     variation       2665
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:999568389"
     variation       2669
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:548922117"
     variation       2670
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1377843900"
     variation       2676
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1025188661"
     variation       2685
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1331697816"
     variation       2686
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:973134921"
     variation       2687
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1012923039"
     variation       2690
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:895287582"
     variation       2695..2696
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:34409499"
     variation       2696
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1165063779"
     variation       2705..2711
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:1350044921"
     variation       2705
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1374414628"
     variation       2706
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:926776920"
     variation       2711
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1280739400"
     variation       2716
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:530330334"
     variation       2717
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:971314022"
     variation       2723
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1438398757"
     variation       2740
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1206923715"
     variation       2741
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1231446323"
     variation       2742
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1406251214"
     variation       2744
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:941743070"
     variation       2747
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:115799873"
     variation       2748
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541241838"
     variation       2763
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047424647"
     variation       2765
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:932962176"
     variation       2766
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753996875"
     variation       2767
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1211863620"
     variation       2770
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1397721159"
     variation       2771
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1489535422"
     variation       2773
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1215337863"
     variation       2773
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1266210457"
     variation       2778
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1316055975"
     variation       2779..2780
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="acggccccgagcctggggctggacgcaggtcccaggacgtgct"
                     /db_xref="dbSNP:1441439409"
     variation       2779
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766575351"
     variation       2780..2781
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="ctcccttct"
                     /db_xref="dbSNP:1336309071"
     variation       2781
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="gacatgctgctcccttgtgtgagtgaccacggccccgagcctggggct
                     ggacgcaggtcccaggacgtgctgctcccttctg"
                     /db_xref="dbSNP:1566171025"
     variation       2782
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:974656529"
     variation       2783
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1304579464"
     variation       2790
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577007021"
     variation       2791
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:60054929"
     variation       2792..2831
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="cggccccgagcctggggctggacgcaggtcccaggacatg"
                     /replace="cggccccgagcctggggctggacgcaggtcccaggacatgttgctccc
                     ttgtgtgagtgaccacggccccgagcctggggctggacgcaggtcccaggacgtgctg
                     ctcccttctgtgagtgaccacggccccgagcctggggctggacgcaggtcccaggaca
                     tg"
                     /db_xref="dbSNP:1566170943"
     variation       2792..2828
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="cggccccgagcctggggctggacgcaggtcccaggac"
                     /replace="cggccccgagcctggggctggacgcaggtcccaggacgtgctgctccc
                     ttctgtgagtgaccacggccccgagcctggggctggacgcaggtcccaggac"
                     /db_xref="dbSNP:1566170955"
     variation       2792
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137860747"
     variation       2793
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543507917"
     variation       2794
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1339972650"
     variation       2798
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:576425597"
     variation       2799
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:978587251"
     variation       2802
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:970720837"
     variation       2811
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1000902244"
     variation       2814
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1025409954"
     variation       2815
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1012477120"
     variation       2822
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1452627569"
     variation       2825
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:899887350"
     variation       2829
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373137192"
     variation       2832
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:554677515"
     variation       2835
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377537751"
     variation       2839
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1420814830"
     variation       2842
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:796139459"
     variation       2843
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1006432643"
     variation       2852
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1396446600"
     variation       2853..2854
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="acggccccgagcctggggctggacgcaggtcccaggacgtgctgctcc
                     cttctgtgagt"
                     /db_xref="dbSNP:1566170899"
     variation       2853
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1384812230"
     variation       2854..2855
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="acca"
                     /db_xref="dbSNP:1566170888"
     variation       2854
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:15638"
     variation       2855
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111799372"
     variation       2856
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:572274927"
     variation       2859
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:997687935"
     variation       2861
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376925671"
     variation       2862
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1039131607"
     variation       2867..2917
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="tggggctggacgcaggtcccaggacgtgctgctcccttgtgtgagtga
                     cca"
                     /db_xref="dbSNP:1566170810"
     variation       2867
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373528706"
     variation       2872
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1354479573"
     variation       2873
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1192334475"
     variation       2877
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369891917"
     variation       2882
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:867795922"
     variation       2889
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:187667016"
     variation       2891
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1186063298"
     variation       2892
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:111786421"
     variation       2900
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1485012640"
     variation       2904
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1054216011"
     variation       2905
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:75167846"
     variation       2917
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1456063340"
     variation       2918
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538873969"
     variation       2919
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:117246365"
     variation       2920..2932
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="gccccaagcccag"
                     /db_xref="dbSNP:1230976787"
     variation       2920
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566170789"
     variation       2923
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1007364269"
     variation       2924
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218487646"
     variation       2925
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111338463"
     variation       2930
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978174785"
     variation       2931
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:8021"
     variation       2933
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:917908364"
     variation       2940
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1332266605"
     variation       2941
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:890301777"
     variation       2942
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301350623"
     variation       2952
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1051667411"
     variation       2954
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:991258229"
     variation       2955
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:959608059"
     variation       2956
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1016485269"
     variation       2957
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1006486333"
     variation       2959
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:73489148"
     variation       2964
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1364197764"
     variation       2965
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1455110594"
     variation       2973
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1026915435"
     variation       2975
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1359866417"
     variation       2976
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566170710"
     variation       2977
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1172254217"
     variation       2978
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1468017193"
     variation       2980
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376990440"
     variation       2986
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:997254637"
     variation       2989
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395673079"
     variation       2990
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1378783852"
     variation       2999
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:941680964"
     variation       3002
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:535014873"
     variation       3018
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1238486499"
     variation       3025
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1038687461"
     variation       3026
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1007221366"
     variation       3027
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182104463"
     variation       3030
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:980532486"
     variation       3031
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1349314061"
     variation       3035
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213577280"
     variation       3041
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1436173408"
     variation       3044
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764304023"
     variation       3052
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:566065778"
     variation       3056
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1481966746"
     variation       3070
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1199546557"
     variation       3074
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:892808322"
     variation       3078
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:949556782"
     variation       3080..3081
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1176616028"
     variation       3082..3089
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="aaaa"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /replace="aaaaaaaaa"
                     /db_xref="dbSNP:rs957212862"
     variation       3082
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1265543823"
     variation       3083
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1054268966"
     variation       3084
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:934594162"
     variation       3085
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1488453973"
     variation       3090
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191072646"
     variation       3091..3096
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="ttttt"
                     /replace="tttttt"
                     /db_xref="dbSNP:1566170618"
     variation       3093
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1256563011"
     variation       3097
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:566122046"
     variation       3100
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:949484292"
     variation       3115
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1018288530"
     variation       3122
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1299758456"
     variation       3123
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:549120489"
     variation       3136
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:918030300"
     variation       3138
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565128269"
     variation       3142
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1458856890"
     variation       3150..3157
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="cttct"
                     /replace="cttcttct"
                     /db_xref="dbSNP:1468716986"
     variation       3151
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:937960418"
     variation       3152
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:909224402"
     variation       3153
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1226033314"
     variation       3156
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1046106"
     variation       3163
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1315555821"
     variation       3165
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1279655347"
     variation       3167
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:985017981"
     variation       3176
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1432491382"
     variation       3179
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753726528"
     variation       3189
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1425798710"
     variation       3197
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:529547282"
     variation       3200
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148270257"
     variation       3202
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11542904"
     variation       3215
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:976689419"
     variation       3223
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:965819930"
     variation       3233
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:897708347"
     variation       3233
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1367604138"
     variation       3236
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1037632913"
     variation       3251
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:941651179"
     variation       3252
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1046130"
     regulatory      3254..3259
                     /regulatory_class="polyA_signal_sequence"
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
     variation       3260
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:904877930"
     variation       3261
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1017734390"
     variation       3265
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376262240"
     variation       3266
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1007273719"
     variation       3267
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:892777244"
     variation       3268
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:561407931"
     variation       3272
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1244757352"
     variation       3274
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298125618"
     variation       3275
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998710936"
     polyA_site      3278
                     /gene="CHFR"
                     /gene_synonym="RNF116; RNF196"
ORIGIN      
agctgagggagccgcaatgtctcttgacagcggcggcggcgcagccggttccgggttcggcgcggggcggggatgtgaatcccgatggagcggcccgaggaaggcaagcagtcgccgccgccgcagccctggggacggctcctgcgtctgggcgcggaggagggcgagccgcacgtcctcctgaggaagcgggagtggaccatcgggcggagacgaggttgcgacctttccttccccagcaataaactggtctctggagatcactgtagaattgtagtggatgaaaaatcaggtcaggtgacactggaagataccagcaccagtggaacagtgattaacaagctgaaggttgttaagaagcagacatgccctttacagactggggatgtcatctacttggtgtacaggaagaatgaaccggaacacaacgtggcatacctctatgaatctttaagtgaaaagcaaggcatgacacaagaatcctttgaagctaacaaggaaaatgtgttccatgggaccaaagatacctcaggtgcaggtgcagggcgaggggccgatccccgggtccctccgtcgtcgcccgccactcaggtgtgctttgaggaaccacagccatcaacatcgacgtcagacctcttccccacagcctcggcctcttccacggagccttctcctgcagggcgagagcgttcctccagttgtgggtctgggggtggtggcatctcccctaaaggaagtggtccctctgtggcaagtgatgaagtctccagctttgcctcagctctcccagacagaaagactgcgtccttttcgtcgttggaaccccaggatcaggaggatttggagcccgtgaagaagaaaatgagaggagatggggaccttgacctgaacgggcagttgttggtcgcacaaccgcgtagaaatgcccaaaccgtccacgaggacgtcagagcagcggctgggaagccagacaagatggaggagacgctgacatgcatcatctgccaggacctgctgcacgactgcgtgagtttgcagccctgcatgcacacgttctgcgcggcttgctactcgggctggatggagcgctcgtccctgtgtcctacctgccgctgtcccgtggagcggatctgtaaaaaccacatcctcaacaacctcgtggaagcatacctcatccagcatccagacaagagtcgcagtgaagaagatgtgcaaagtatggatgccaggaataaaatcactcaagacatgctgcagcccaaagtcaggcggtctttttctgatgaagaagggagttcagaggacctgctggagctgtcagacgttgacagtgagtcctcagacattagccagccatacgtcgtgtgccggcagtgtcctgagtacagaaggcaggcggcgcagcctccccactgcccagcacccgagggcgagccaggagccccacaggccctgggggatgcaccctccacgtccgtcagcctgacgacagtccaggattacgtgtgccctctgcaaggaagccacgccctgtgcacctgctgcttccagcccatgcccgaccggagagcggagcgcgagcaggacccgcgtgtcgcccctcagcagtgtgcggtctgcctgcagcctttctgccacctgtactggggctgcacccggaccggctgctacggctgcctggccccgttttgtgagctcaacctgggtgacaagtgtctggacggcgtgctgaacaacaacagctacgagtcagacatcctgaagaattacctggcaaccagaggtttgacatggaaaaacatgttgaccgagagcctcgtggctctccagcggggagtgtttctgctgtctgattacagagtcacgggagacaccgttctgtgttactgctgtggcctgcgcagcttccgtgagctgacctatcagtatcggcagaacattcctgcttccgagttgccagtggccgtaacatcccgtcctgactgctactggggccgtaactgccgcactcaggtgaaagctcaccacgccatgaaattcaatcatatctgtgaacagacaaggttcaaaaactaagcatccagaggccctgagcagctttcagcactggaggtgaagagagcgtgtttttaaaatacagagacaagcacgtcaaggtgttttcacagccccctgagggaagggacgcagggtctccgacaggtgctctggggtgactcttctgtggagctttaccctctgagtgagaccctccccagagccccgggggccgcagcccgccctcctggtgagcgctgggcagggctcgtggtggcatcagcagcagagacgaagcctttctgtaacatgcggccgtcccgccgagaggggcagttttgctcttttgtacattttccgaaactacagttaaagcagaagtctgtttttaggaaaagtttcaagggagaagggcaagtttatcaaaaacattgtttcaggagaagggagcataagtttacagcctacaggacgtacacaatatcctgctgctgggaaaaccacagcattttatctattttttattttaataggtttggtgcttatcttctaataagatttaaatgtcacaaactgtagcacaaataatataatttataatttacaaattgactaaaattgggtatagtatggtatttgaaagaataagcatatgcttctgtttattaaaaaaagaaaccttccaatgtccaaaactgctaaccctcgacgtggccgccaagttagtcgctccttgctaaccggtgagtgaccgcggccccgagcctggggctggacgcaggtcccaggacatgctgctcccttgtgtgagtgaccgcggccccgagcctggggctggacgcaggtcccaggacgtgctgctcccttgtgtgagtgaccacggccccaagcccagggctggaggcaggtcccaggacgcgccgctccctcatgctgcccgggcccttcctccaagaccctacagagcctgaggggcaccttggcttccgcctgtgctagctttgccatgtcatctggaataatacttgaaattttgatttttggaaaaaaaagttttttatcttttgttgaaatcacctgttatccttgtttgtaaactgataacttttttgcttcttctcaggaatacagttttcaactgttgtcttgctcttgatagaaactgagaagcagcaatctgtatttgtggaggaaagtcctctcttttgcatattctaataaatgagccgcgtttgctcctcaaaaaaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]