GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-01-25 18:12:35, GGRNA.v2 : RefSeq release 97 (Nov, 2019)

LOCUS       NM_001161191            4890 bp    mRNA    linear   PLN 14-FEB-2019
DEFINITION  Arabidopsis thaliana dicer-like 3 (DCL3), mRNA.
ACCESSION   NM_001161191
VERSION     NM_001161191.3
DBLINK      BioProject: PRJNA116
            BioSample: SAMN03081427
KEYWORDS    RefSeq.
SOURCE      Arabidopsis thaliana (thale cress)
  ORGANISM  Arabidopsis thaliana
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliophyta; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Brassicales; Brassicaceae;
            Camelineae; Arabidopsis.
REFERENCE   1  (bases 1 to 4890)
  AUTHORS   Salanoubat,M., Lemcke,K., Rieger,M., Ansorge,W., Unseld,M.,
            Fartmann,B., Valle,G., Blocker,H., Perez-Alonso,M., Obermaier,B.,
            Delseny,M., Boutry,M., Grivell,L.A., Mache,R., Puigdomenech,P., De
            Simone,V., Choisne,N., Artiguenave,F., Robert,C., Brottier,P.,
            Wincker,P., Cattolico,L., Weissenbach,J., Saurin,W., Quetier,F.,
            Schafer,M., Muller-Auer,S., Gabel,C., Fuchs,M., Benes,V.,
            Wurmbach,E., Drzonek,H., Erfle,H., Jordan,N., Bangert,S.,
            Wiedelmann,R., Kranz,H., Voss,H., Holland,R., Brandt,P.,
            Nyakatura,G., Vezzi,A., D'Angelo,M., Pallavicini,A., Toppo,S.,
            Simionati,B., Conrad,A., Hornischer,K., Kauer,G., Lohnert,T.H.,
            Nordsiek,G., Reichelt,J., Scharfe,M., Schon,O., Bargues,M.,
            Terol,J., Climent,J., Navarro,P., Collado,C., Perez-Perez,A.,
            Ottenwalder,B., Duchemin,D., Cooke,R., Laudie,M., Berger-Llauro,C.,
            Purnelle,B., Masuy,D., de Haan,M., Maarse,A.C., Alcaraz,J.P.,
            Cottet,A., Casacuberta,E., Monfort,A., Argiriou,A., flores,M.,
            Liguori,R., Vitale,D., Mannhaupt,G., Haase,D., Schoof,H., Rudd,S.,
            Zaccaria,P., Mewes,H.W., Mayer,K.F., Kaul,S., Town,C.D., Koo,H.L.,
            Tallon,L.J., Jenkins,J., Rooney,T., Rizzo,M., Walts,A.,
            Utterback,T., Fujii,C.Y., Shea,T.P., Creasy,T.H., Haas,B.,
            Maiti,R., Wu,D., Peterson,J., Van Aken,S., Pai,G., Militscher,J.,
            Sellers,P., Gill,J.E., Feldblyum,T.V., Preuss,D., Lin,X.,
            Nierman,W.C., Salzberg,S.L., White,O., Venter,J.C., Fraser,C.M.,
            Kaneko,T., Nakamura,Y., Sato,S., Kato,T., Asamizu,E., Sasamoto,S.,
            Kimura,T., Idesawa,K., Kawashima,K., Kishida,Y., Kiyokawa,C.,
            Kohara,M., Matsumoto,M., Matsuno,A., Muraki,A., Nakayama,S.,
            Nakazaki,N., Shinpo,S., Takeuchi,C., Wada,T., Watanabe,A.,
            Yamada,M., Yasuda,M. and Tabata,S.
  CONSRTM   European Union Chromosome 3 Arabidopsis Sequencing Consortium;
            Institute for Genomic Research; Kazusa DNA Research Institute
  TITLE     Sequence and analysis of chromosome 3 of the plant Arabidopsis
            thaliana
  JOURNAL   Nature 408 (6814), 820-822 (2000)
   PUBMED   11130713
REFERENCE   2  (bases 1 to 4890)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (14-FEB-2019) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 4890)
  AUTHORS   Krishnakumar,V., Cheng,C.-Y., Chan,A.P., Schobel,S., Kim,M.,
            Ferlanti,E.S., Belyaeva,I., Rosen,B.D., Micklem,G., Miller,J.R.,
            Vaughn,M. and Town,C.D.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-MAY-2016) Plant Genomics, J. Craig Venter Institute,
            9704 Medical Center Dr, Rockville, MD 20850, USA
  REMARK    Protein update by submitter
REFERENCE   4  (bases 1 to 4890)
  AUTHORS   Swarbreck,D., Lamesch,P., Wilks,C. and Huala,E.
  CONSRTM   TAIR
  TITLE     Direct Submission
  JOURNAL   Submitted (18-FEB-2011) Department of Plant Biology, Carnegie
            Institution, 260 Panama Street, Stanford, CA, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by TAIR and Araport.
            This record is derived from an annotated genomic sequence
            (NC_003074).
            On Sep 12, 2016 this sequence version replaced NM_001161191.2.
FEATURES             Location/Qualifiers
     source          1..4890
                     /organism="Arabidopsis thaliana"
                     /mol_type="mRNA"
                     /db_xref="taxon:3702"
                     /chromosome="3"
                     /ecotype="Columbia"
     gene            1..4890
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="Encodes a ribonuclease III family protein that is
                     required for endogenous RDR2-dependent siRNA (but not
                     miRNA) formation."
                     /db_xref="Araport:AT3G43920"
                     /db_xref="GeneID:823508"
                     /db_xref="TAIR:AT3G43920"
     CDS             149..4861
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="dicer-like 3 (DCL3); CONTAINS InterPro DOMAIN/s:
                     DNA/RNA helicase, DEAD/DEAH box type, N-terminal
                     (InterPro:IPR011545), DEAD-like helicase, N-terminal
                     (InterPro:IPR014001), Argonaute/Dicer protein, PAZ
                     (InterPro:IPR003100), DNA/RNA helicase, C-terminal
                     (InterPro:IPR001650), Helicase, superfamily 1/2,
                     ATP-binding domain (InterPro:IPR014021), Ribonuclease III
                     (InterPro:IPR000999); BEST Arabidopsis thaliana protein
                     match is: dicer-like 1 (TAIR:AT1G01040.1); Has 13599 Blast
                     hits to 8740 proteins in 2670 species: Archae - 198;
                     Bacteria - 7991; Metazoa - 1636; Fungi - 703; Plants -
                     621; Viruses - 45; Other Eukaryotes - 2405 (source: NCBI
                     BLink)."
                     /codon_start=1
                     /product="dicer-like 3"
                     /protein_id="NP_001154663.2"
                     /db_xref="GeneID:823508"
                     /db_xref="TAIR:AT3G43920"
                     /db_xref="Araport:AT3G43920"
                     /translation="
MHSSLEPEKMEEGGGSNSLKRKFSEIDGDQNLDSVSSPMMTDSNGSYELKVYEVAKNRNIIAVLGTGIDKSEITKRLIKAMGSSDTDKRLIIFLAPTVNLVKQQCCEIRALVNLKVEEYFGAKGVDKWTSQRWDEEFSKHDVLVMTPQILLDVLRSAFLKLEMVCLLIIDECHHTTGNHPYAKLMKEFYHESTSKPKIFGLTASAVIRKAQVSELERLMDSKIFNPEEREGVEKFATTVKEGPILYNPSPSCSLELKEKLETSHLKFDASLRRLQELGKDSFLNMDNKFETYQKRLSIDYREILHCLDNLGLICAHLAAEVCLEKISDTKEESETYKECSMVCKEFLEDILSTIGVYLPQDDKSLVDLQQNHLSAVISGHVSPKLKELFHLLDSFRGDKQKQCLILVERIITAKVIERFVKKEASLAYLNVLYLTENNPSTNVSAQKMQIEIPDLFQHGKVNLLFITDVVEEGFQVPDCSCMVCFDLPKTMCSYSQSQKHAKQSNSKSIMFLERGNPKQRDHLHDLMRREVLIQDPEAPNLKSCPPPVKNGHGVKEIGSMVIPDSNITVSEEAASTQTMSDPPSRNEQLPPCKKLRLDNNLLQSNGKEKVASSKSKSSSSAAGSKKRKELHGTTCANALSGTWGENIDGATFQAYKFDFCCNISGEVYSSFSLLLESTLAEDVGKVEMDLYLVRKLVKASVSPCGQIRLSQEELVKAKYFQQFFFNGMFGKLFVGSKSQGTKREFLLQTDTSSLWHPAFMFLLLPVETNDLASSATIDWSAINSCASIVEFLKKNSLLDLRDSDGNQCNTSSGQEVLLDDKMEETNLIHFANASSDKNSLEELVVIAIHTGRIYSIVEAVSDSSAMSPFEVDASSGYATYAEYFNKKYGIVLAHPNQPLMKLKQSHHAHNLLVDFNEEMVVKTEPKAGNVRKRKPNIHAHLPPELLARIDVPRAVLKSIYLLPSVMHRLESLMLASQLREEIDCSIDNFSISSTSILEAVTTLTCPESFSMERLELLGDSVLKYVASCHLFLKYPDKDEGQLSRQRQSIISNSNLHRLTTSRKLQGYIRNGAFEPRRWTAPGQFSLFPVPCKCGIDTREVPLDPKFFTENMTIKIGKSCDMGHRWVVSKSVSDCAEALIGAYYVSGGLSASLHMMKWLGIDVDFDPNLVVEAINRVSLRCYIPKEDELIELERKIQHEFSAKFLLKEAITHSSLRESYSYERLEFLGDSVLDFLITRHLFNTYEQTGPGEMTDLRSACVNNENFAQVAVKNNLHTHLQRCATVLETQINDYLMSFQKPDETGRSIPSIQGPKALGDVVESIAGALLIDTRLDLDQVWRVFEPLLSPLVTPDKLQLPPYRELNELCDSLGYFFRVKCSNDGVKAQATIQLQLDDVLLTGDGSEQTNKLALGKAASHLLTQLEKRNISRKTSLGDNQSSMDVNLACNHSDRETLTSETTEIQSIVIPFIGPINMKKGGPRGTLHEFCKKHLWPMPTFDTSEEKSRTPFEFIDGGEKRTSFSSFTSTITLRIPNREAVMYAGEARPDKKSSFDSAVVELLYELERRKIVIIQK"
     misc_feature    320..757
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="DEAD-like helicases superfamily. A diverse family
                     of proteins involved in ATP-dependent RNA or DNA
                     unwinding. This domain contains the ATP-binding region;
                     Region: DEXDc; cd00046"
                     /db_xref="CDD:238005"
     misc_feature    347..361
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:238005"
     misc_feature    656..667
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="putative Mg++ binding site [ion binding]; other
                     site"
                     /db_xref="CDD:238005"
     misc_feature    1292..1636
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="Helicase conserved C-terminal domain; Region:
                     Helicase_C; pfam00271"
                     /db_xref="CDD:278689"
     misc_feature    order(1370..1381,1478..1483,1547..1555)
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="nucleotide binding region [chemical binding]; other
                     site"
                     /db_xref="CDD:238034"
     misc_feature    2588..3004
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="PAZ domain, CAF_like subfamily. CAF (for carpel
                     factory) is a plant homolog of Dicer. CAF has been
                     implicated in flower morphogenesis and in early
                     Arabidopsis development and might function through
                     posttranscriptional regulation of specific mRNA...;
                     Region: PAZ_CAF_like; cd02844"
                     /db_xref="CDD:239210"
     misc_feature    order(2708..2710,2786..2788,2798..2800,2852..2854,
                     2963..2965,2969..2971)
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239210"
     misc_feature    3134..3643
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="RIBOc. Ribonuclease III C terminal domain. This
                     group consists of eukaryotic, bacterial and archeal
                     ribonuclease III (RNAse III) proteins. RNAse III is a
                     double stranded RNA-specific endonuclease. Prokaryotic
                     RNAse III is important in...; Region: RIBOc; cd00593"
                     /db_xref="CDD:238333"
     misc_feature    order(3182..3187,3194..3199,3206..3208,3215..3220,
                     3227..3232,3236..3244,3272..3274,3575..3577,3602..3604)
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238333"
     misc_feature    order(3182..3184,3191..3193,3203..3205,3545..3547,
                     3554..3556)
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="active site"
                     /db_xref="CDD:238333"
     misc_feature    order(3191..3193,3545..3547,3554..3556)
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="metal binding site [ion binding]; metal-binding
                     site"
                     /db_xref="CDD:238333"
     misc_feature    3716..4423
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="dsRNA-specific ribonuclease [Transcription];
                     Region: Rnc; COG0571"
                     /db_xref="CDD:223644"
     misc_feature    3758..4201
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="RIBOc. Ribonuclease III C terminal domain. This
                     group consists of eukaryotic, bacterial and archeal
                     ribonuclease III (RNAse III) proteins. RNAse III is a
                     double stranded RNA-specific endonuclease. Prokaryotic
                     RNAse III is important in...; Region: RIBOc; cd00593"
                     /db_xref="CDD:238333"
     misc_feature    order(3809..3814,3821..3826,3833..3835,3842..3847,
                     3854..3859,3863..3871,3899..3901,4124..4126,4157..4159)
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238333"
     misc_feature    order(3809..3811,3818..3820,3830..3832,4094..4096,
                     4103..4105)
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="active site"
                     /db_xref="CDD:238333"
     misc_feature    order(3818..3820,4094..4096,4103..4105)
                     /gene="DCL3"
                     /locus_tag="AT3G43920"
                     /gene_synonym="ATDCL3; dicer-like 3; DICER-LIKE 3"
                     /note="metal binding site [ion binding]; metal-binding
                     site"
                     /db_xref="CDD:238333"
ORIGIN      
aactcatgttctgacctcatttatacacttgcccagtggtcagtgcagaaaaagagaaaaagaatcacctttttgttttaatctcaaagtcgaaattcgaaattcctctactcttcccgttaagtgtgttcctttttatccgttcgtcatgcattcgtcgttggagccggagaaaatggaggaaggtgggggaagcaattcgcttaagagaaaattctctgaaatcgatggagatcaaaatcttgattctgtctcttctcctatgatgactgactctaatggtagttatgaattgaaagtgtacgaggttgctaagaacaggaacataattgctgttttggggacagggattgataagtcagagatcactaagaggcttatcaaagctatgggttcttctgatacagacaaaagattgataattttcttggccccaactgtgaatcttgttaaacagcaatgctgtgagatcagagcacttgtgaatttgaaagttgaagagtactttggagctaaaggagttgataaatggacatctcagcgctgggatgaggaatttagcaagcacgatgttttagttatgactcctcaaatattattggatgtccttagaagtgcattcctgaaactagagatggtatgtcttctaataatagatgaatgccaccataccactggcaatcatccctatgcgaagttaatgaaggaattctatcacgaatccactagcaaaccgaagatatttggattgactgcgtcagccgtcattagaaaagctcaagtatcagaacttgagagactcatggactcaaagatttttaatcctgaagagcgtgaaggagtggaaaagtttgctacaacggttaaagaaggtccaatattgtataacccatcaccatcctgtagtttggaattgaaagaaaagttagaaacttcacacctcaagtttgatgcttctcttagaaggcttcaagagttgggaaaagacagttttctgaatatggataataagtttgagacatatcaaaagagattgtctatcgactacagagagattttgcattgccttgataatcttggcctgatttgcgcacacttggcggctgaagtctgcttggagaaaatctcagatacgaaagaggaaagtgaaacttataaagaatgctcaatggtgtgcaaggaatttcttgaggatattttatccaccattggggtgtatttgccgcaagatgataagagtctggtagatttgcagcaaaaccatctgtcagcagtaatttctgggcatgtatctccaaagctaaaagaactcttccatctattggattcctttagaggtgacaagcaaaagcagtgccttattttagttgagagaattataactgcgaaagtgatcgaaagattcgttaagaaagaagcctctttggcttaccttaatgtcttgtatttaaccgaaaacaacccctccaccaatgtatcggcacagaaaatgcaaattgaaatccctgatttatttcaacatggcaaggtgaatcttttattcatcacagatgtggttgaagagggatttcaggttccagattgctcatgcatggtttgttttgacctgcccaaaacaatgtgtagttactcgcagtctcaaaaacatgccaaacagagtaattctaagtctatcatgtttcttgaaagagggaacccgaagcaaagagaccatctgcatgaccttatgcgaagagaagtcctaattcaagatccagaagctccaaacttgaaatcgtgtccacctccagtgaaaaatggacacggtgtgaaggagattggatccatggttatcccagattctaacataactgtatctgaggaagcagcttccacacaaactatgagtgatcctcctagcagaaatgagcagttaccaccgtgtaaaaagttacgcttggataacaatctcttacaatccaacggcaaagagaaggttgcctcttctaaaagtaaatcatcttcatcggctgcaggttcaaaaaaacgtaaggagttgcacggaacaacctgtgcaaacgcattgtcaggaacctggggagaaaatattgatggcgccacctttcaggcttataagtttgacttctgttgtaatatttctggcgaagtatactcgagtttctctcttttgcttgagtcaactctcgccgaggatgttggtaaagttgagatggacctttacttggtcaggaagcttgtcaaggcttctgtctcaccttgtggccagatacgtttgagtcaagaggagctggtcaaagcaaaatattttcagcagtttttctttaatggcatgtttggaaagttgtttgttggatctaagtcacagggaacaaagagagaatttttgcttcaaactgacactagttctctttggcaccctgcctttatgtttctactgctaccagttgaaacaaatgatctagcttcgagtgcgacaattgattggtcagctatcaactcctgtgcctcaatagttgagttcttgaagaaaaattctcttcttgatcttcgggatagtgatgggaatcagtgcaatacctcatccggtcaggaagtcttactagacgataaaatggaagaaacgaatctgattcattttgccaatgcttcgtctgataaaaatagtctcgaagaacttgtggtcattgcaattcatactggacggatatactctatagttgaagccgtaagcgattcttctgctatgagcccctttgaggtggatgcctcatcaggctatgctacttatgcagaatattttaacaaaaagtatgggattgttttagcgcacccgaaccagccgttgatgaagttgaagcagagtcaccatgcgcacaaccttttagtcgacttcaatgaagagatggttgtgaagacagaaccaaaagctggcaatgttaggaaaagaaaaccgaatatccatgcgcatttgcctccagagcttttggctagaattgatgtaccgcgtgctgtgctaaaatcaatctacttgctgccttcagtgatgcaccgcctagagtctctaatgttggccagccagcttagggaagagattgattgtagcatagataacttcagtatatcaagtacatcgattcttgaagcagttacaacacttacatgccccgaatcattttcaatggagcggttggaactgctcggggattcagtcttgaagtatgttgcgagctgtcatctattccttaagtatcctgacaaagatgaggggcaactatcacggcagagacaatcgattatatctaactcaaatcttcaccgcttgacaaccagtcgcaaactacagggatacataagaaatggcgcttttgaaccgcgtcgctggactgcacctggtcaattttctctttttcctgttccttgcaagtgtgggattgatactagagaagtaccattggacccaaaattcttcacagaaaacatgactatcaaaataggcaagtcttgcgacatgggtcatagatgggtagtttcaaaatctgtatcagattgcgctgaggccctgattggtgcctattatgtaagcggtggattgtctgcttctctccatatgatgaaatggctcggtattgacgtcgattttgacccaaacctagtcgttgaagccatcaatagagtttctctacggtgttacattcctaaagaagatgagctcatagagttggagagaaagatccaacatgaattctctgcaaagtttcttttaaaagaggctatcacacactcctctcttcgtgaatcctattcatacgagagattagagtttcttggcgattctgtactggattttctaataacccgtcatctttttaacacctacgaacaaactgggcctggagagatgaccgatcttcgttctgcatgtgtaaacaatgaaaattttgcgcaagttgcagtgaaaaataacctgcatacccaccttcaacgctgtgctacggttctcgagactcaaataaacgactatctgatgtcctttcaaaagccagatgagactggtagatcaatcccttcaatacagggccctaaggctcttggagatgttgtggagagtatcgctggagcattgctgatcgatacgaggttagatctcgatcaagtgtggagagtctttgagccgttgctttctccacttgtaactccagataaacttcagcttcctccataccgggagctcaatgagctatgcgactctcttgggtatttctttcgagtgaaatgttcaaatgatggtgtcaaagcacaagccacgatccagttgcagctggatgatgttcttttaactggagatggatctgaacagacaaataaactggccttgggaaaagcagcttcacatctgcttacacaacttgagaagagaaacatttcacgtaaaacctcgctcggggataatcaaagttccatggatgtcaatcttgcttgcaatcatagcgacagagaaactctgacttcagagactactgaaatccagagtatagtgattccatttattggacctataaacatgaagaaaggcgggcctcgtggaactctacatgagttttgcaagaagcatctgtggccaatgcctactttcgatacctcggaagagaaatccagaactccgtttgaattcatagatggcggtgagaagcggactagcttcagcagtttcacatcgaccataaccctaaggatacccaatcgtgaggctgtgatgtatgctggagaagcaaggcctgacaagaagagttccttcgactctgcagtcgtggaattgctttatgagctcgagcgccgcaagatcgtcataatacaaaagtagactaatttagactgtactatatatgattc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]