2025-07-06 11:49:07, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NM_001109394 660 bp mRNA linear ROD 20-MAR-2023 DEFINITION Rattus norvegicus claudin 20 (Cldn20), mRNA. ACCESSION NM_001109394 XM_001054648 VERSION NM_001109394.1 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 660) AUTHORS Berndt P, Winkler L, Cording J, Breitkreuz-Korff O, Rex A, Dithmer S, Rausch V, Blasig R, Richter M, Sporbert A, Wolburg H, Blasig IE and Haseloff RF. TITLE Tight junction proteins at the blood-brain barrier: far more than claudin-5 JOURNAL Cell Mol Life Sci 76 (10), 1987-2002 (2019) PUBMED 30734065 REFERENCE 2 (bases 1 to 660) AUTHORS Krause G, Winkler L, Mueller SL, Haseloff RF, Piontek J and Blasig IE. TITLE Structure and function of claudins JOURNAL Biochim Biophys Acta 1778 (3), 631-645 (2008) PUBMED 18036336 REMARK Review article COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from CH474052.2. On Oct 4, 2007 this sequence version replaced XM_001054648.1. ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..660 /organism="Rattus norvegicus" /mol_type="mRNA" /db_xref="taxon:10116" /chromosome="1" /map="1q11" gene 1..660 /gene="Cldn20" /note="claudin 20" /db_xref="GeneID:680178" /db_xref="RGD:1595446" CDS 1..660 /gene="Cldn20" /codon_start=1 /product="claudin-20 precursor" /protein_id="NP_001102864.1" /db_xref="GeneID:680178" /db_xref="RGD:1595446" /translation="
MASAGLQLLAFILAVSGVSGVLAATLLPNWKVNADAGSTIVTAIVQVHGLWMDCTWYSTGMFSCTLKYSILSLPVYVQAARATMVLACILSALGICTAIVGMKCTHLGGDAHTKSHISFAGGVCFITAGISALIPTVWYTKEIISNFLDLTVPESHKYEPGGAVYIGFISAMLLLIAGIIFCISYIKKNQEPWIYPPKQRLTSTWQPKNRLAYNLKDYV"
sig_peptide 1..69 /gene="Cldn20" /inference="COORDINATES: ab initio prediction:SignalP:4.0" misc_feature 13..543 /gene="Cldn20" /note="PMP-22/EMP/MP20/Claudin family; Region: PMP22_Claudin; cl21598" /db_xref="CDD:473919" exon 1..660 /gene="Cldn20" /inference="alignment:Splign:2.1.0" ORIGIN
atggcctcggccggtctccagctcctggctttcatcctggctgtgtctggggtctctggagtacttgctgccactctgctgccaaactggaaggttaatgcagatgcaggctccaccattgtaactgctattgtacaggtacatgggttgtggatggactgcacgtggtacagcactgggatgtttagctgcactctgaaatactccattctgtcgctccccgtctatgtgcaggctgcgagggctaccatggtcctggcctgcattctgtctgccttggggatttgtactgcgatagtaggaatgaaatgcactcacttaggaggagacgcacacaccaagagtcacatttcctttgctggaggagtctgcttcatcaccgcagggatctctgctttaatcccaacagtgtggtacaccaaagagatcatatccaactttttggatctgactgttccagaaagccacaaatatgaacctggaggagccgtgtacattgggttcatttcagcgatgttactacttatcgctggtattattttctgcatttcttatataaaaaagaaccaagaaccatggatctaccctcccaagcagagacttacctctacctggcagccaaagaacaggttagcatacaacctgaaggattatgtgtaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]