GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-07-06 11:49:07, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       NM_001109394             660 bp    mRNA    linear   ROD 20-MAR-2023
DEFINITION  Rattus norvegicus claudin 20 (Cldn20), mRNA.
ACCESSION   NM_001109394 XM_001054648
VERSION     NM_001109394.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 660)
  AUTHORS   Berndt P, Winkler L, Cording J, Breitkreuz-Korff O, Rex A, Dithmer
            S, Rausch V, Blasig R, Richter M, Sporbert A, Wolburg H, Blasig IE
            and Haseloff RF.
  TITLE     Tight junction proteins at the blood-brain barrier: far more than
            claudin-5
  JOURNAL   Cell Mol Life Sci 76 (10), 1987-2002 (2019)
   PUBMED   30734065
REFERENCE   2  (bases 1 to 660)
  AUTHORS   Krause G, Winkler L, Mueller SL, Haseloff RF, Piontek J and Blasig
            IE.
  TITLE     Structure and function of claudins
  JOURNAL   Biochim Biophys Acta 1778 (3), 631-645 (2008)
   PUBMED   18036336
  REMARK    Review article
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from CH474052.2.
            
            On Oct 4, 2007 this sequence version replaced XM_001054648.1.
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..660
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /db_xref="taxon:10116"
                     /chromosome="1"
                     /map="1q11"
     gene            1..660
                     /gene="Cldn20"
                     /note="claudin 20"
                     /db_xref="GeneID:680178"
                     /db_xref="RGD:1595446"
     CDS             1..660
                     /gene="Cldn20"
                     /codon_start=1
                     /product="claudin-20 precursor"
                     /protein_id="NP_001102864.1"
                     /db_xref="GeneID:680178"
                     /db_xref="RGD:1595446"
                     /translation="
MASAGLQLLAFILAVSGVSGVLAATLLPNWKVNADAGSTIVTAIVQVHGLWMDCTWYSTGMFSCTLKYSILSLPVYVQAARATMVLACILSALGICTAIVGMKCTHLGGDAHTKSHISFAGGVCFITAGISALIPTVWYTKEIISNFLDLTVPESHKYEPGGAVYIGFISAMLLLIAGIIFCISYIKKNQEPWIYPPKQRLTSTWQPKNRLAYNLKDYV"
     sig_peptide     1..69
                     /gene="Cldn20"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     misc_feature    13..543
                     /gene="Cldn20"
                     /note="PMP-22/EMP/MP20/Claudin family; Region:
                     PMP22_Claudin; cl21598"
                     /db_xref="CDD:473919"
     exon            1..660
                     /gene="Cldn20"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
atggcctcggccggtctccagctcctggctttcatcctggctgtgtctggggtctctggagtacttgctgccactctgctgccaaactggaaggttaatgcagatgcaggctccaccattgtaactgctattgtacaggtacatgggttgtggatggactgcacgtggtacagcactgggatgtttagctgcactctgaaatactccattctgtcgctccccgtctatgtgcaggctgcgagggctaccatggtcctggcctgcattctgtctgccttggggatttgtactgcgatagtaggaatgaaatgcactcacttaggaggagacgcacacaccaagagtcacatttcctttgctggaggagtctgcttcatcaccgcagggatctctgctttaatcccaacagtgtggtacaccaaagagatcatatccaactttttggatctgactgttccagaaagccacaaatatgaacctggaggagccgtgtacattgggttcatttcagcgatgttactacttatcgctggtattattttctgcatttcttatataaaaaagaaccaagaaccatggatctaccctcccaagcagagacttacctctacctggcagccaaagaacaggttagcatacaacctgaaggattatgtgtaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]