GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-10-29 01:33:10, GGRNA.v2 : RefSeq release 207 (Jul, 2021)

LOCUS       NM_001108363            1522 bp    mRNA    linear   ROD 18-MAR-2021
DEFINITION  Rattus norvegicus H6 family homeobox 1 (Hmx1), mRNA.
ACCESSION   NM_001108363 XM_001064149 XM_341238
VERSION     NM_001108363.2
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1522)
  AUTHORS   Quina LA, Kuramoto T, Luquetti DV, Cox TC, Serikawa T and Turner
            EE.
  TITLE     Deletion of a conserved regulatory element required for Hmx1
            expression in craniofacial mesenchyme in the dumbo rat: a newly
            identified cause of congenital ear malformation
  JOURNAL   Dis Model Mech 5 (6), 812-822 (2012)
   PUBMED   22736458
  REMARK    GeneRIF: Dysregulation of Hmx1 expression is a candidate mechanism
            for congenital ear malformation.
REFERENCE   2  (bases 1 to 1522)
  AUTHORS   Amendt BA, Sutherland LB and Russo AF.
  TITLE     Transcriptional antagonism between Hmx1 and Nkx2.5 for a shared
            DNA-binding site
  JOURNAL   J Biol Chem 274 (17), 11635-11642 (1999)
   PUBMED   10206974
REFERENCE   3  (bases 1 to 1522)
  AUTHORS   Yoshiura K, Leysens NJ, Reiter RS and Murray JC.
  TITLE     Cloning, characterization, and mapping of the mouse homeobox gene
            Hmx1
  JOURNAL   Genomics 50 (1), 61-68 (1998)
   PUBMED   9628823
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JACYVU010000254.1.
            On Mar 18, 2021 this sequence version replaced NM_001108363.1.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: CB577861.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMD00132287, SAMD00132291
                                           [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-379               JACYVU010000254.1  29065953-29066331   c
            380-1522            JACYVU010000254.1  29062545-29063687   c
FEATURES             Location/Qualifiers
     source          1..1522
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="14"
                     /map="14q21"
     gene            1..1522
                     /gene="Hmx1"
                     /note="H6 family homeobox 1"
                     /db_xref="GeneID:360960"
                     /db_xref="RGD:1304928"
     exon            1..379
                     /gene="Hmx1"
                     /inference="alignment:Splign:2.1.0"
     CDS             4..1005
                     /gene="Hmx1"
                     /note="H6 homeo box 1"
                     /codon_start=1
                     /product="homeobox protein HMX1"
                     /protein_id="NP_001101833.2"
                     /db_xref="GeneID:360960"
                     /db_xref="RGD:1304928"
                     /translation="
MPDELTEPGRATPARASSFLIENLLAAEAKGSGRAAQGDGVREEEEEDDDDPEDEDPEQARRRRLQRRRQQRAGSGPGGEARARALGLGPRPPPGPGPPFALGCGGATRWYPRAQGGYGGGLSPDTSDRDSPETGEDMGRAESAWPRCPGPGAVPREVTTQGPAAGGEEAAELAEAPAVAAAAAGEARGGRRKKTRTVFSRSQVFQLESTFDLKRYLSSAERAGLAASLQLTETQVKIWFQNRRNKWKRQLAAELEAASLSPPGAQRLVRVPVLYHESPPAATGPTLPFPLAPPAPAPPPPLLGFSGALAYPLAAFPAAASVPFLRAQMPGLV"
     exon            380..1522
                     /gene="Hmx1"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
gcgatgccggatgagctgaccgagcccgggcgtgccacgccggctcgcgcctcctccttcctcatagagaacctgctggcagccgaggccaagggctcggggcgcgcagcccagggcgatggcgtccgcgaggaagaggaggaagacgacgacgaccctgaggacgaggatccggagcaggcccgacgacgacgactacagcggcggcgacagcagcgcgcaggcagcgggccgggcggagaggcgagggcccgagcgctgggcctagggccccggccgcctcccgggcccgggccgcccttcgctctcggctgcggaggcgcgacgcggtggtacccacgggcgcagggcggctacggaggtggtctgagtcctgacacaagcgaccgggactctccggagaccggcgaggatatgggccgcgcagagagcgcctggccgcggtgcccggggccgggagccgttccgcgggaggtgacgacgcagggcccggctgccggcggggaggaagcggcggagttggccgaggctccggcggtggcagccgctgcggcaggggaggcacgcggcggtcgcaggaagaagacgcgcacggtcttctcgcgcagccaggtcttccagctcgagtccactttcgatctgaaacgctacctgagcagcgcggagcgcgcaggcctcgccgcctcgctgcaactcacggagacgcaggtcaagatctggtttcagaaccgccgcaacaagtggaagcggcagctggcggccgagctggaggcggctagcctgtccccgcccggcgcgcagcgcctggtccgcgtgccggtgctctaccacgagagtcccccggccgccacggggcccacgctgcccttcccgctggctccgcctgcacccgcgccgccgccgccgctgctcggtttctcgggcgcgcttgcctacccgctggccgccttccccgccgccgcctcggtgcccttccttcgcgcgcagatgccggggctagtgtgagccggcgccctccatgcaggggcgccgggaggaggcggtgagaggaaggcgccatgcgcctcacgcagttcctcgggcgaccgtctccgtgggcagctgctccagagtgtacccagtgtaccgagtgtactgagtgtaccggacggcggcagcggggactctcagctagctgcaggactgaagacccgttccaatagaaagcggtggccggcaccgagtgctgagcagctgcgggctccgcagcagcaaacggacacttggagtgggctggccaagggaccgcatggcgactatccctgaggcaatcttgcccctaactcagaatgtccttttctcaggagggacctcgcaggaacccttccaagggacaatacagagagccgcggggggccttgggacaactgatcttgggtttcactcttgggtggccttggttctcttggcttgatgaagacttttttttttctgtgatgaatctacttctttgcatatggaataaaaagggacgttttctgga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]