GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-10-17 15:25:13, GGRNA.v2 : RefSeq release 207 (Jul, 2021)

LOCUS       NM_001108142            4741 bp    mRNA    linear   ROD 10-APR-2021
DEFINITION  Rattus norvegicus SID1 transmembrane family, member 2 (Sidt2),
            mRNA.
ACCESSION   NM_001108142 XM_001068825
VERSION     NM_001108142.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 4741)
  AUTHORS   Takahashi M, Contu VR, Kabuta C, Hase K, Fujiwara Y, Wada K and
            Kabuta T.
  TITLE     SIDT2 mediates gymnosis, the uptake of naked single-stranded
            oligonucleotides into living cells
  JOURNAL   RNA Biol 14 (11), 1534-1543 (2017)
   PUBMED   28277980
REFERENCE   2  (bases 1 to 4741)
  AUTHORS   Contu VR, Hase K, Kozuka-Hata H, Oyama M, Fujiwara Y, Kabuta C,
            Takahashi M, Hakuno F, Takahashi SI, Wada K and Kabuta T.
  TITLE     Lysosomal targeting of SIDT2 via multiple YxxPhi motifs is required
            for SIDT2 function in the process of RNautophagy
  JOURNAL   J Cell Sci 130 (17), 2843-2853 (2017)
   PUBMED   28724756
REFERENCE   3  (bases 1 to 4741)
  AUTHORS   Aizawa S, Fujiwara Y, Contu VR, Hase K, Takahashi M, Kikuchi H,
            Kabuta C, Wada K and Kabuta T.
  TITLE     Lysosomal putative RNA transporter SIDT2 mediates direct uptake of
            RNA by lysosomes
  JOURNAL   Autophagy 12 (3), 565-578 (2016)
   PUBMED   27046251
REFERENCE   4  (bases 1 to 4741)
  AUTHORS   Gao J, Yu C, Xiong Q, Zhang Y and Wang L.
  TITLE     Lysosomal integral membrane protein Sidt2 plays a vital role in
            insulin secretion
  JOURNAL   Int J Clin Exp Pathol 8 (12), 15622-15631 (2015)
   PUBMED   26884831
  REMARK    GeneRIF: Sdit2 may play a vital role in the regulation of insulin
            secretion via two SNARE proteins synap1 and syanp3.
            Publication Status: Online-Only
REFERENCE   5  (bases 1 to 4741)
  AUTHORS   Li W, Koutmou KS, Leahy DJ and Li M.
  TITLE     Systemic RNA Interference Deficiency-1 (SID-1) Extracellular Domain
            Selectively Binds Long Double-stranded RNA and Is Required for RNA
            Transport by SID-1
  JOURNAL   J Biol Chem 290 (31), 18904-18913 (2015)
   PUBMED   26067272
REFERENCE   6  (bases 1 to 4741)
  AUTHORS   Gao J, Gu X, Mahuran DJ, Wang Z and Zhang H.
  TITLE     Impaired glucose tolerance in a mouse model of sidt2 deficiency
  JOURNAL   PLoS One 8 (6), e66139 (2013)
   PUBMED   23776622
  REMARK    Publication Status: Online-Only
REFERENCE   7  (bases 1 to 4741)
  AUTHORS   Jialin G, Xuefan G and Huiwen Z.
  TITLE     SID1 transmembrane family, member 2 (Sidt2): a novel lysosomal
            membrane protein
  JOURNAL   Biochem Biophys Res Commun 402 (4), 588-594 (2010)
   PUBMED   20965152
REFERENCE   8  (bases 1 to 4741)
  AUTHORS   Schroder B, Wrocklage C, Pan C, Jager R, Kosters B, Schafer H,
            Elsasser HP, Mann M and Hasilik A.
  TITLE     Integral and associated lysosomal membrane proteins
  JOURNAL   Traffic 8 (12), 1676-1686 (2007)
   PUBMED   17897319
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from CH473975.1.
            On Oct 4, 2007 this sequence version replaced XM_001068825.1.
            
            ##Evidence-Data-START##
            RNAseq introns :: mixed/partial sample support SAMD00132261,
                              SAMD00132262 [ECO:0000350]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..4741
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /db_xref="taxon:10116"
                     /chromosome="8"
                     /map="8q22"
     gene            1..4741
                     /gene="Sidt2"
                     /gene_synonym="RGD1308311"
                     /note="SID1 transmembrane family, member 2"
                     /db_xref="GeneID:315617"
                     /db_xref="RGD:1308311"
     exon            1..1001
                     /gene="Sidt2"
                     /gene_synonym="RGD1308311"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    402..404
                     /gene="Sidt2"
                     /gene_synonym="RGD1308311"
                     /note="upstream in-frame stop codon"
     CDS             441..3380
                     /gene="Sidt2"
                     /gene_synonym="RGD1308311"
                     /codon_start=1
                     /product="SID1 transmembrane family member 2"
                     /protein_id="NP_001101612.1"
                     /db_xref="GeneID:315617"
                     /db_xref="RGD:1308311"
                     /translation="
MTSAGGRSPAVYRGAAPGGPEFCAASAALKGPASGKPTGQGHRRLGSPGASGRRVSSRAGPGWGCGSRCRPREPGSARGPGAAPGRGRVLSQAGVKVLVPVRCWKLLRQPQRARSPSRRQPPPPRAMIAWRLPLCVLLVAAVESHLGALGPKNVSQKDAEFERTYADDVNSELVNIYTFNHTVTRNRTEGVRVSVNVLNKQKGAPLLFVVRQKEAVVSFQVPLILRGLYQRKYLYQKVERTLCQPPTKNESEIQFFYVDVSTLSPVNTTYQLRVNRVDNFVLRTGELFTFNTTAAQPQYFKYEFPDGVDSVIVKVTSKKAFPCSVISIQDVLCPVYDLDNNVAFIGMYQTMTKKAAITVQRKDFPSNSFYVVVVVKTEDQACGGSLPFYPFVEDEPVDQGHRQKTLSVLVSQAVTSEAYVGGMLFCLGIFLSFYLLTVLLACWENWRQRKKTLLVAIDRACPESGHPRVLADSFPGSAPYEGYNYGSFENGSGSTDGLVESTGSGDLSYSYQGHDQFKRRLPSGQMRQLCIAMDRSFDPVGARPRLDSMSSVEEDDYDTLTDIDSDKNVIRTKQYLCVADLARKDKRVLRKKYQIYFWNIATIAVFYALPVVQLVITYQTVVNVTGNQDICYYNFLCAHPLGNLSAFNNILSNLGYILLGLLFLLIILQREINHNRALLRNDLYALECGIPKHFGLFYAMGTALMMEGLLSACYHVCPNYTNFQFDTSFMYMIAGLCMLKLYQKRHPDINASAYSAYACLAIVIFFSVLGVVFGKGNTAFWIVFSVIHIISTLLLSTQLYYMGRWKLDSGIFRRILHVLYTDCIRQCSGPLYTDRMVLLVMGNIINWSLAAYGLIMRPNDFASYLLAIGICNLLLYFAFYIIMKLRSGERIKLIPLLCIVCTSVVWGFALFFFFQGLSTWQKTPAESREHNRDCILLDFFDDHDIWHFLSSIAMFGSFLVLLTLDDDLDTVQRDKIYVF"
     misc_feature    570..>731
                     /gene="Sidt2"
                     /gene_synonym="RGD1308311"
                     /note="Domain of unknown function (DUF4680); Region:
                     DUF4680; pfam15730"
                     /db_xref="CDD:292358"
     misc_feature    1332..3377
                     /gene="Sidt2"
                     /gene_synonym="RGD1308311"
                     /note="dsRNA-gated channel SID-1; Region: SID-1_RNA_chan;
                     pfam13965"
                     /db_xref="CDD:290673"
     exon            1002..1123
                     /gene="Sidt2"
                     /gene_synonym="RGD1308311"
                     /inference="alignment:Splign:2.1.0"
     exon            1124..1288
                     /gene="Sidt2"
                     /gene_synonym="RGD1308311"
                     /inference="alignment:Splign:2.1.0"
     exon            1289..1334
                     /gene="Sidt2"
                     /gene_synonym="RGD1308311"
                     /inference="alignment:Splign:2.1.0"
     exon            1335..1436
                     /gene="Sidt2"
                     /gene_synonym="RGD1308311"
                     /inference="alignment:Splign:2.1.0"
     exon            1437..1520
                     /gene="Sidt2"
                     /gene_synonym="RGD1308311"
                     /inference="alignment:Splign:2.1.0"
     exon            1521..1620
                     /gene="Sidt2"
                     /gene_synonym="RGD1308311"
                     /inference="alignment:Splign:2.1.0"
     exon            1621..1686
                     /gene="Sidt2"
                     /gene_synonym="RGD1308311"
                     /inference="alignment:Splign:2.1.0"
     exon            1687..1780
                     /gene="Sidt2"
                     /gene_synonym="RGD1308311"
                     /inference="alignment:Splign:2.1.0"
     exon            1781..1833
                     /gene="Sidt2"
                     /gene_synonym="RGD1308311"
                     /inference="alignment:Splign:2.1.0"
     exon            1834..1905
                     /gene="Sidt2"
                     /gene_synonym="RGD1308311"
                     /inference="alignment:Splign:2.1.0"
     exon            1906..1977
                     /gene="Sidt2"
                     /gene_synonym="RGD1308311"
                     /inference="alignment:Splign:2.1.0"
     exon            1978..2040
                     /gene="Sidt2"
                     /gene_synonym="RGD1308311"
                     /inference="alignment:Splign:2.1.0"
     exon            2041..2159
                     /gene="Sidt2"
                     /gene_synonym="RGD1308311"
                     /inference="alignment:Splign:2.1.0"
     exon            2160..2233
                     /gene="Sidt2"
                     /gene_synonym="RGD1308311"
                     /inference="alignment:Splign:2.1.0"
     exon            2234..2300
                     /gene="Sidt2"
                     /gene_synonym="RGD1308311"
                     /inference="alignment:Splign:2.1.0"
     exon            2301..2374
                     /gene="Sidt2"
                     /gene_synonym="RGD1308311"
                     /inference="alignment:Splign:2.1.0"
     exon            2375..2498
                     /gene="Sidt2"
                     /gene_synonym="RGD1308311"
                     /inference="alignment:Splign:2.1.0"
     exon            2499..2616
                     /gene="Sidt2"
                     /gene_synonym="RGD1308311"
                     /inference="alignment:Splign:2.1.0"
     exon            2617..2753
                     /gene="Sidt2"
                     /gene_synonym="RGD1308311"
                     /inference="alignment:Splign:2.1.0"
     exon            2754..2862
                     /gene="Sidt2"
                     /gene_synonym="RGD1308311"
                     /inference="alignment:Splign:2.1.0"
     exon            2863..2939
                     /gene="Sidt2"
                     /gene_synonym="RGD1308311"
                     /inference="alignment:Splign:2.1.0"
     exon            2940..2986
                     /gene="Sidt2"
                     /gene_synonym="RGD1308311"
                     /inference="alignment:Splign:2.1.0"
     exon            2987..3092
                     /gene="Sidt2"
                     /gene_synonym="RGD1308311"
                     /inference="alignment:Splign:2.1.0"
     exon            3093..3203
                     /gene="Sidt2"
                     /gene_synonym="RGD1308311"
                     /inference="alignment:Splign:2.1.0"
     exon            3204..3317
                     /gene="Sidt2"
                     /gene_synonym="RGD1308311"
                     /inference="alignment:Splign:2.1.0"
     exon            3318..4741
                     /gene="Sidt2"
                     /gene_synonym="RGD1308311"
                     /inference="alignment:Splign:2.1.0"
     STS             4562..4727
                     /gene="Sidt2"
                     /gene_synonym="RGD1308311"
                     /standard_name="RH136962"
                     /db_xref="UniSTS:219051"
ORIGIN      
cgacagctgagcttcgttcagtgggcaggcgcttcttcggtttttatgaaccaatgaggaaaaaaaatgaagttggggtaatggtttgggggaacaattcctgcttgagcagagacaatctgtcaacaagacccagcacttactgggcactgtgaaactatcctgaaacgccaacaccaagcagtagaggcatgaggaggatcaggagttcaagattctccaagcgaacataaccagttccaggatagcctgggttatgtgagcctccgtctcaaaaaaacaaaaacgcggaccacaacaccaagaatccaacacttagttatccttcgtggaaaaaatatcactctagacgcccacaggactgcgaaggaaggaggtggcgacggtgcgtgggaagcagttagacgaggtctggccctttaaatccgcgtcggtttcccatgacgtcagcgggcgggcgcagccccgctgtttaccgcggcgcggcgcctggtggccccgagttctgtgccgcgtccgccgcccttaaagggcccgcgtccgggaagcctacgggccagggccaccgccgcctcggctctccgggcgcgagcggacgccgggtctccagccgggctgggccgggctggggttgcgggtcgcggtgccgcccacgcgagccggggtccgcgcgaggcccaggagcggctccagggaggggacgcgtcctatctcaggccggggttaaagttctggtcccggtgagatgctggaagctgctgcggcagccgcaacgcgcccggtcgccgtcccgtcgccagcccccgccgccccgggccatgatcgcctggcgtctgcccttgtgcgtgctcctggtggccgccgtcgagagccacctgggggctctggggcccaagaacgtctcgcagaaagacgcggagtttgagcgcacctacgcggacgacgtcaacagcgagctagtcaacatctacaccttcaaccacaccgtgacccgcaaccggaccgagggcgtgcgagtgtctgtgaacgtcctgaacaaacagaaaggggcgcctttgctgttcgtggtccgccagaaggaggctgttgtgtccttccaggtgcccctaatcctgcgagggctataccagcgtaagtacctctaccaaaaagttgaacgaactctgtgtcagccccccaccaagaatgagtctgagatccagtttttctatgtggatgtgtctaccctgtcaccagtcaataccacttaccagctccgagtcaaccgtgtggacaatttcgtgctcaggactggggagctgtttaccttcaataccactgcagcccaaccccagtacttcaaatacgagtttcctgatggtgtggactctgtcattgtcaaggtgacctccaagaaggccttcccctgctctgtcatctccatccaggatgtcctgtgcccagtctatgatcttgacaacaatgtagccttcatcggcatgtaccagacaatgactaagaaggcagccatcactgtgcagaggaaagacttccccagcaacagtttttatgtggtggtggtggtgaagactgaggaccaggcctgcggggggtccttgcccttctaccctttcgtggaagatgaaccagtggatcaagggcaccgtcagaaaaccctgtcagtgctggtctctcaggctgtcacttctgaggcctacgttggtgggatgctcttttgcctgggcatattcctgtcgttctacctgctgactgtgctgctggcctgttgggagaactggaggcaaaggaagaagaccttgctggtggccatagaccgagcctgcccagaaagcggtcaccctcgggtcttggctgattcgtttcctggcagtgccccctatgagggttacaactatggctcctttgagaatggttccggatccactgacgggttggttgaaagcacaggttcaggggacctctcctacagttaccaggggcacgaccagttcaagcggcgccttccctctggccagatgcggcagctgtgcattgccatggaccgctcctttgacccagtgggagctcggccacgactggactccatgagctccgtggaagaggatgactatgacacactgactgacatcgactcagacaaaaacgtcattcgaaccaagcaatacctctgtgtggctgatctggcacgaaaggacaaacgtgttttacggaaaaagtaccagatttacttctggaacatagccaccattgcagtcttctacgcccttcctgtggtgcagctggtgatcacctaccagacggtggtgaatgtcacggggaaccaggacatctgctactacaacttcctctgtgcccacccactgggcaacctcagcgccttcaacaacatcctcagcaacctggggtacattctgcttggtctgctcttcctgctcatcatcctgcagcgggagatcaatcataaccgggccctgctgagaaatgacctctatgctctggagtgtgggatccccaaacactttggtctattttatgccatgggcacagcgttgatgatggaggggctactgagtgcctgttaccacgtctgccccaactacaccaacttccagttcgatacctcgttcatgtacatgattgctggcctctgcatgctgaagctctaccagaagcggcacccagatatcaacgccagcgcctacagcgcatacgcctgcctggccattgtgatcttcttctccgtcctgggtgtggtttttggcaaagggaacacagccttctggatcgtcttctcagtcatccatatcatttccacgcttctcctcagcactcagctgtattacatgggccgctggaagctggactccggaatcttccgccgcatccttcatgtgctctacacagactgcatccggcagtgcagcgggcccctttacacggaccgcatggtgcttctggtcatgggcaacattatcaactggtcgctggctgcctacggactcatcatgcgcccaaatgactttgcgtcctacttgctggcaattggcatctgcaacttgctgctgtattttgctttctacatcattatgaagctccggagcggcgagaggatcaagctcatccctctgctctgcatcgtgtgcacctccgtggtctggggcttcgcactcttcttcttcttccagggactcagcacgtggcagaaaacccccgcagagtccagggagcacaaccgagactgcatcctccttgacttctttgatgaccacgacatctggcacttcctgtcctccattgctatgtttgggtccttcctggttttattgacgttggatgacgacttggacactgtacagcgggacaagatctatgtcttctagcagcgtctgtggtccaggcttcacttcatgggcccagcgcctctgcgtcaccttccagttgccacaggagcaccaagggtgtgagtcccagctctgctacccagcactggacgtcgtggcaagacagcgagttccagctcaggcctgactcaggacagttactggtgacactgaaccttgcagttacctctgctgcggaggaggcctgctccgcaaccccagacactggccaaattgctgctgcttgcttctcagtgtccggtcctccccaggaccctggtctgtccatctgtcttgtttatccactggctctccatttgtccctttggagaggaaggcaggaagtcaatgtcctgcccccttcatgccttgcattctacccatcccttccctccttttggcctaggacacagcctttcttcttcccgtgctctgccccaggacatagtctggtgcctgattctctgtccagcaccaggacctacattctccctgggtctgtagctggctatcactgcccactctggcctgccaggatggatgcaggtaggagactttgggggctggccggctggtgccaggctttcggtgctaaggcccacaaggggtctaggtacgaccctcctccctgacctgtgcgtggagctggctctacagcagtgagggccagcccaggctgaatcttttgatctggggactgaattcagaggccacctcatcctaccagccactagaatgatgccagcaccggggttggtgggaagtggcaacttactgtcctcttccgtaccctcagtcctgccaagccccagatgggggcccctcagtgccattgacactgcccaagaatgtccagaggccatgggatggtgccaagcacacaaccccttttgcctctttcaggggagcaggagtcccagtgcctgtcttagaaagggagggacatgccaagtccctgtgagtccttagtcctgtctcaccaaaggactcagggctggtttctgagtttccgtccagtatttagccaagttctgtgttagtcacataggcctaagagccttgacgtttacagagtcacccagctctggcccctggccactctggtccttggcgtttacagagtcacccagctctaggccccggccactctagtccttggctatccttcactccaccaggtccattccagatgccaagagtcctctccaccatggttttctagctcttgggctgggagaagaggcaggtctgggcctttgtttctgagctctgttctgtgttcctccatgctacggttgcaattctgttttctatgaacgagtgcattcaataaagacagcccgacctgggatctggtctta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]