GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-10-29 03:52:59, GGRNA.v2 : RefSeq release 207 (Jul, 2021)

LOCUS       NM_001105739            1230 bp    mRNA    linear   ROD 02-OCT-2017
DEFINITION  Rattus norvegicus paired related homeobox 2 (Prrx2), mRNA.
ACCESSION   NM_001105739 XM_001079701 XM_238327
VERSION     NM_001105739.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1230)
  AUTHORS   Higuchi M, Kato T, Yoshida S, Ueharu H, Nishimura N and Kato Y.
  TITLE     PRRX1- and PRRX2-positive mesenchymal stem/progenitor cells are
            involved in vasculogenesis during rat embryonic pituitary
            development
  JOURNAL   Cell Tissue Res. 361 (2), 557-565 (2015)
   PUBMED   25795141
  REMARK    GeneRIF: PRRX1- and PRRX2-positive mesenchymal stem/progenitor
            cells are present at the periphery of the embryonic pituitary and
            participate in pituitary vasculogenesis by differentiation into
            vascular endothelial cells and pericytes.
REFERENCE   2  (bases 1 to 1230)
  AUTHORS   Ueharu H, Higuchi M, Nishimura N, Yoshida S, Shibuya S, Sensui K,
            Kato T and Kato Y.
  TITLE     Expression of Kruppel-like factor 6, KLF6, in rat pituitary
            stem/progenitor cells and its regulation of the PRRX2 gene
  JOURNAL   J. Reprod. Dev. 60 (4), 304-311 (2014)
   PUBMED   24881871
  REMARK    GeneRIF: expression stimulated by Klf6
REFERENCE   3  (bases 1 to 1230)
  AUTHORS   Higuchi M, Kato T, Chen M, Yako H, Yoshida S, Kanno N and Kato Y.
  TITLE     Temporospatial gene expression of Prx1 and Prx2 is involved in
            morphogenesis of cranial placode-derived tissues through
            epithelio-mesenchymal interaction during rat embryogenesis
  JOURNAL   Cell Tissue Res. 353 (1), 27-40 (2013)
   PUBMED   23644741
  REMARK    GeneRIF: PRX proteins, especially PRX2, play a role in the
            morphogenesis of the primordial tissues formed by the
            epithelio-mesenchymal interaction and that neural crest cells
            contribute to the morphogenesis of tissues derived from the cranial
            placode.
REFERENCE   4  (bases 1 to 1230)
  AUTHORS   Susa T, Kato T, Yoshida S, Yako H, Higuchi M and Kato Y.
  TITLE     Paired-related homeodomain proteins Prx1 and Prx2 are expressed in
            embryonic pituitary stem/progenitor cells and may be involved in
            the early stage of pituitary differentiation
  JOURNAL   J. Neuroendocrinol. 24 (9), 1201-1212 (2012)
   PUBMED   22577874
  REMARK    GeneRIF: data indicate that PRXs are produced in the pituitary
            progenitor cells and may play roles in the process of terminal
            differentiation during early pituitary organogenesis.
REFERENCE   5  (bases 1 to 1230)
  AUTHORS   Wissmuller S, Kosian T, Wolf M, Finzsch M and Wegner M.
  TITLE     The high-mobility-group domain of Sox proteins interacts with
            DNA-binding domains of many transcription factors
  JOURNAL   Nucleic Acids Res. 34 (6), 1735-1744 (2006)
   PUBMED   16582099
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 1230)
  AUTHORS   ten Berge D, Brouwer A, Korving J, Reijnen MJ, van Raaij EJ,
            Verbeek F, Gaffield W and Meijlink F.
  TITLE     Prx1 and Prx2 are upstream regulators of sonic hedgehog and control
            cell proliferation during mandibular arch morphogenesis
  JOURNAL   Development 128 (15), 2929-2938 (2001)
   PUBMED   11532916
REFERENCE   7  (bases 1 to 1230)
  AUTHORS   Bergwerff M, Gittenberger-de Groot AC, Wisse LJ, DeRuiter MC,
            Wessels A, Martin JF, Olson EN and Kern MJ.
  TITLE     Loss of function of the Prx1 and Prx2 homeobox genes alters
            architecture of the great elastic arteries and ductus arteriosus
  JOURNAL   Virchows Arch. 436 (1), 12-19 (2000)
   PUBMED   10664157
REFERENCE   8  (bases 1 to 1230)
  AUTHORS   Lu MF, Cheng HT, Kern MJ, Potter SS, Tran B, Diekwisch TG and
            Martin JF.
  TITLE     prx-1 functions cooperatively with another paired-related homeobox
            gene, prx-2, to maintain cell fates within the craniofacial
            mesenchyme
  JOURNAL   Development 126 (3), 495-504 (1999)
   PUBMED   9876178
REFERENCE   9  (bases 1 to 1230)
  AUTHORS   Lu MF, Cheng HT, Lacy AR, Kern MJ, Argao EA, Potter SS, Olson EN
            and Martin JF.
  TITLE     Paired-related homeobox genes cooperate in handplate and hindlimb
            zeugopod morphogenesis
  JOURNAL   Dev. Biol. 205 (1), 145-157 (1999)
   PUBMED   9882503
REFERENCE   10 (bases 1 to 1230)
  AUTHORS   ten Berge D, Brouwer A, Korving J, Martin JF and Meijlink F.
  TITLE     Prx1 and Prx2 in skeletogenesis: roles in the craniofacial region,
            inner ear and limbs
  JOURNAL   Development 125 (19), 3831-3842 (1998)
   PUBMED   9729491
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from CH474001.2.
            On or before Oct 3, 2007 this sequence version replaced
            XM_001079701.1, XM_238327.4.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
FEATURES             Location/Qualifiers
     source          1..1230
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /db_xref="taxon:10116"
                     /chromosome="3"
                     /map="3p12"
     gene            1..1230
                     /gene="Prrx2"
                     /gene_synonym="Prx2"
                     /note="paired related homeobox 2"
                     /db_xref="GeneID:113931"
                     /db_xref="RGD:1311471"
     STS             60..1116
                     /gene="Prrx2"
                     /gene_synonym="Prx2"
                     /db_xref="UniSTS:492889"
     misc_feature    95..97
                     /gene="Prrx2"
                     /gene_synonym="Prx2"
                     /note="upstream in-frame stop codon"
     CDS             155..901
                     /gene="Prrx2"
                     /gene_synonym="Prx2"
                     /codon_start=1
                     /product="paired mesoderm homeobox protein 2"
                     /protein_id="NP_001099209.1"
                     /db_xref="GeneID:113931"
                     /db_xref="RGD:1311471"
                     /translation="
MDSAAAAFALDPPAPGPGPPPAPGDCAQARKNFSVSHLLDLEEVAAAGRRAAGPVPGPEAREGAAREPSGGSSGSEAAPQDGECAAPGHGSATKRKKKQRRNRTTFNSSQLQALERVFERTHYPDAFVREELARRVNLSEARVQVWFQNRRAKFRRNERAMLATRSASLLKSYGQEAAIEQPVAPRPTTLSPDYLSWPASSPYSSVPPYSPGGSSPATPGVNMANSIASLRLKAKEFSLHHSQVPTVN"
     misc_feature    464..622
                     /gene="Prrx2"
                     /gene_synonym="Prx2"
                     /note="Homeobox domain; Region: Homeobox; pfam00046"
                     /db_xref="CDD:395001"
     misc_feature    <482..796
                     /gene="Prrx2"
                     /gene_synonym="Prx2"
                     /note="Homeodomain-containing transcription factor
                     [Transcription]; Region: COG5576"
                     /db_xref="CDD:227863"
     misc_feature    818..868
                     /gene="Prrx2"
                     /gene_synonym="Prx2"
                     /note="OAR domain; Region: OAR; pfam03826"
                     /db_xref="CDD:397759"
     STS             242..901
                     /gene="Prrx2"
                     /gene_synonym="Prx2"
                     /standard_name="Prrx2"
                     /db_xref="UniSTS:547298"
     STS             884..1099
                     /gene="Prrx2"
                     /gene_synonym="Prx2"
                     /standard_name="RH128429"
                     /db_xref="UniSTS:211737"
     STS             988..1111
                     /gene="Prrx2"
                     /gene_synonym="Prx2"
                     /standard_name="UniSTS:234365"
                     /db_xref="UniSTS:234365"
ORIGIN      
cgccccgacaaggggcgtgtggcctgggccgctggctagcgagcggcccgcccgttggggagggcagaaagttcgggtccccgaccgactgacttgagagccggcgcggcgaacagcgggaggcggcggcggccggcagaggcgcgcccggggcatggacagcgcggccgccgccttcgccttggacccgccagcgcccggcccggggcccccgcccgcacccggtgactgcgcccaggcgcgcaagaacttctcggtgagccacctcctggacctggaggaggtggcggctgccgggcgcagggctgcggggccggtgccggggcccgaggcgcgggagggagcggcgcgcgaaccgtccgggggcagcagcggcagcgaggcggcgccgcaggacggtgagtgcgcggcccccggccatggcagtgccaccaaacggaagaagaagcagcgtcggaatcgaaccacattcaacagcagccagctgcaggcgctggagcgtgtatttgagcgcacacactaccctgacgcctttgtgcgtgaagagctagcccgccgtgtcaacctcagtgaggcacgtgtccaagtctggttccagaaccgccgtgccaagtttcgccggaacgaacgtgccatgctggctacccgctctgcctcgctgctcaagtcttacggccaggaggcagccattgagcagcctgtggccccccgacctaccacactgagcccagattatctatcctggccagcatcgtccccctacagctcggtgcctccctacagccccggaggttcaagtcctgcaactcctggagtcaatatggccaacagcatcgctagccttcgcctcaaggccaaagagttcagcttacaccacagccaggtgcccacagtgaactgacaatgtgcactgggcccagcctccttcctggcccaatggcagaccgcagtaaaggaagtagccttgtccgtccctgtcctcagacaaactgggcagcctctcctgtgcctttttctccatcgcagctctctgagtcccagaggcctgttgggtactggaagcaacagttaaacaggtcactgctatggtggctgagattgtggcctaaggcccctggggtggcctggccagaaggcggagctggagtccgccaaggaactcacttacttatgtattaaaaccaaaaagcttttctctttaaggaataaaaacatttttcttaagctcca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]