2024-04-19 21:15:09, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001090563 1086 bp mRNA linear VRT 22-MAY-2022 DEFINITION Xenopus laevis distal-less homeobox 2 L homeolog (dlx2.L), mRNA. ACCESSION NM_001090563 VERSION NM_001090563.2 KEYWORDS RefSeq. SOURCE Xenopus laevis (African clawed frog) ORGANISM Xenopus laevis Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Amphibia; Batrachia; Anura; Pipoidea; Pipidae; Xenopodinae; Xenopus; Xenopus. REFERENCE 1 (bases 1 to 1086) AUTHORS Papalopulu N and Kintner C. TITLE Xenopus Distal-less related homeobox genes are expressed in the developing forebrain and are induced by planar signals JOURNAL Development 117 (3), 961-975 (1993) PUBMED 8100768 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from L09728.1. On Sep 24, 2016 this sequence version replaced NM_001090563.1. ##Evidence-Data-START## Transcript exon combination :: L09728.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMD00012419 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-1086 L09728.1 2-1087 FEATURES Location/Qualifiers source 1..1086 /organism="Xenopus laevis" /mol_type="mRNA" /db_xref="taxon:8355" /chromosome="9_10L" /map="9_10L" gene 1..1086 /gene="dlx2.L" /gene_synonym="dll4; dlx2; tes-1; tes1; X-dll2; X-dll4; Xdll4" /note="distal-less homeobox 2 L homeolog" /db_xref="GeneID:399264" /db_xref="Xenbase:XB-GENE-852896" exon 1..550 /gene="dlx2.L" /gene_synonym="dll4; dlx2; tes-1; tes1; X-dll2; X-dll4; Xdll4" /inference="alignment:Splign:2.1.0" misc_feature 25..27 /gene="dlx2.L" /gene_synonym="dll4; dlx2; tes-1; tes1; X-dll2; X-dll4; Xdll4" /note="upstream in-frame stop codon" CDS 226..1083 /gene="dlx2.L" /gene_synonym="dll4; dlx2; tes-1; tes1; X-dll2; X-dll4; Xdll4" /function="putative transcription factor" /note="putative transcription factor DLL4; XDLL-4" /codon_start=1 /product="homeobox protein DLL-4" /protein_id="NP_001084032.1" /db_xref="GeneID:399264" /db_xref="Xenbase:XB-GENE-852896" /translation="
MTGVFDSLAADMHSNHMPSSSYHSLHKSQESPTLPVSTATDSSYYTNQQQQQHCGAVSPYGQLGSYQFHGAAINGISYSTKSYDLSYTGSYSSYGPYGTSPSPPHNDQEKEDCEPEVRMVNGKPKKVRKPRTIYSSFQLAALQRRFQKTQYLALPERAELAASLGVTQTQVKIWFQNRRSKFKKMWKSGEIPSDQLPVGSESSPCSSPSASTATWDFGPHQRLQGATNGSALQSSNSASSPSPFLSNYSWYQTSNSAPHLQSNPLLQQHHLHHHPPAPISAGTIF"
misc_feature 274..366 /gene="dlx2.L" /gene_synonym="dll4; dlx2; tes-1; tes1; X-dll2; X-dll4; Xdll4" /note="propagated from UniProtKB/Swiss-Prot (P53775.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 310..546 /gene="dlx2.L" /gene_synonym="dll4; dlx2; tes-1; tes1; X-dll2; X-dll4; Xdll4" /note="Homeobox protein distal-less-like N terminal; Region: DLL_N; pfam12413" /db_xref="CDD:432536" misc_feature 511..570 /gene="dlx2.L" /gene_synonym="dll4; dlx2; tes-1; tes1; X-dll2; X-dll4; Xdll4" /note="propagated from UniProtKB/Swiss-Prot (P53775.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature order(607..621,625..627,676..678,694..696,733..735, 739..744,751..756,760..768,772..777) /gene="dlx2.L" /gene_synonym="dll4; dlx2; tes-1; tes1; X-dll2; X-dll4; Xdll4" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature 613..774 /gene="dlx2.L" /gene_synonym="dll4; dlx2; tes-1; tes1; X-dll2; X-dll4; Xdll4" /note="Homeobox domain; Region: Homeobox; pfam00046" /db_xref="CDD:425441" misc_feature order(613..615,622..624,742..744,751..756,763..765) /gene="dlx2.L" /gene_synonym="dll4; dlx2; tes-1; tes1; X-dll2; X-dll4; Xdll4" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" misc_feature 787..939 /gene="dlx2.L" /gene_synonym="dll4; dlx2; tes-1; tes1; X-dll2; X-dll4; Xdll4" /note="propagated from UniProtKB/Swiss-Prot (P53775.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" exon 551..735 /gene="dlx2.L" /gene_synonym="dll4; dlx2; tes-1; tes1; X-dll2; X-dll4; Xdll4" /inference="alignment:Splign:2.1.0" exon 736..1086 /gene="dlx2.L" /gene_synonym="dll4; dlx2; tes-1; tes1; X-dll2; X-dll4; Xdll4" /inference="alignment:Splign:2.1.0" ORIGIN
gcggtcgtgagcgattactccccctgagcttgtgtagcgacccaacccaccagctgcggagaacatgcgtccagcgtcctcccaccgcccggcccgtcgctcctgatcgctgctcccttgtctacttggtttattgaaagcgattgcattatagtttttggtgtctctcccgagcctgttgcagacccttcaacctttgctgtgtactccacagcccctaatactatgaccggagtgtttgacagcttggcagcagatatgcattccaaccacatgccctccagcagttaccacagtctgcacaagtcgcaggaatccccgacattgccggtgtctactgccacggacagcagctactacaccaaccaacagcagcagcagcactgcggggcagtctctccttatgggcagctcggatcctatcagttccatggcgctgccatcaatgggatttcttattcgaccaagtcgtacgatctgtcatacactggctcgtacagctcgtatgggccctatgggacaagtccttcccctcctcacaacgaccaggagaaggaagactgcgagcccgaggtcaggatggtcaatgggaagccgaagaaagtgcgcaagccccgcaccatctattccagtttccagctggcggccctccagcggcgatttcagaaaacccaatacctggcactgcccgagagagcggaactggcagcctcgctaggcgtgacccagacacaggtgaagatctggttccagaaccgccgctctaaattcaagaagatgtggaagagcggggagatcccgtcggatcagctccctgtaggcagcgaatcttccccctgtagctccccttctgcatctacagccacctgggacttcgggccgcaccagcggttgcagggagcaactaatgggtctgcccttcagagctccaattctgcctccagtcccagcccttttctgagcaactattcctggtatcaaacttccaattctgccccccacctccagtctaacccgttacttcaacagcatcatctccaccatcatccccccgctccaatatccgcagggaccatcttctagaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]