GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:39:34, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NM_001025290             659 bp    mRNA    linear   PRI 01-MAY-2019
DEFINITION  Homo sapiens developmental pluripotency associated 5 (DPPA5), mRNA.
ACCESSION   NM_001025290 XM_291161
VERSION     NM_001025290.3
KEYWORDS    RefSeq; MANE Select.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 659)
  AUTHORS   Qian X, Kim JK, Tong W, Villa-Diaz LG and Krebsbach PH.
  TITLE     DPPA5 Supports Pluripotency and Reprogramming by Regulating NANOG
            Turnover
  JOURNAL   Stem Cells 34 (3), 588-600 (2016)
   PUBMED   26661329
  REMARK    GeneRIF: Our study provides new insight into the function of DPPA5
            and NANOG regulation in human pluripotent stem cell .
REFERENCE   2  (bases 1 to 659)
  AUTHORS   Aoki T, Ohnishi H, Oda Y, Tadokoro M, Sasao M, Kato H, Hattori K
            and Ohgushi H.
  TITLE     Generation of induced pluripotent stem cells from human
            adipose-derived stem cells without c-MYC
  JOURNAL   Tissue Eng Part A 16 (7), 2197-2206 (2010)
   PUBMED   20146561
REFERENCE   3  (bases 1 to 659)
  AUTHORS   Tian X, Pascal G, Fouchecourt S, Pontarotti P and Monget P.
  TITLE     Gene birth, death, and divergence: the different scenarios of
            reproduction-related gene evolution
  JOURNAL   Biol. Reprod. 80 (4), 616-621 (2009)
   PUBMED   19129511
  REMARK    Review article
REFERENCE   4  (bases 1 to 659)
  AUTHORS   Dansranjavin T, Krehl S, Mueller T, Mueller LP, Schmoll HJ and
            Dammann RH.
  TITLE     The role of promoter CpG methylation in the epigenetic control of
            stem cell related genes during differentiation
  JOURNAL   Cell Cycle 8 (6), 916-924 (2009)
   PUBMED   19221495
REFERENCE   5  (bases 1 to 659)
  AUTHORS   Pierre A, Gautier M, Callebaut I, Bontoux M, Jeanpierre E,
            Pontarotti P and Monget P.
  TITLE     Atypical structure and phylogenomic evolution of the new eutherian
            oocyte- and embryo-expressed KHDC1/DPPA5/ECAT1/OOEP gene family
  JOURNAL   Genomics 90 (5), 583-594 (2007)
   PUBMED   17913455
REFERENCE   6  (bases 1 to 659)
  AUTHORS   Shen L, Kondo Y, Guo Y, Zhang J, Zhang L, Ahmed S, Shu J, Chen X,
            Waterland RA and Issa JP.
  TITLE     Genome-wide profiling of DNA methylation reveals a class of
            normally methylated CpG island promoters
  JOURNAL   PLoS Genet. 3 (10), 2023-2036 (2007)
   PUBMED   17967063
REFERENCE   7  (bases 1 to 659)
  AUTHORS   Lagarkova MA, Volchkov PY, Lyakisheva AV, Philonenko ES and Kiselev
            SL.
  TITLE     Diverse epigenetic profile of novel human embryonic stem cell lines
  JOURNAL   Cell Cycle 5 (4), 416-420 (2006)
   PUBMED   16479162
REFERENCE   8  (bases 1 to 659)
  AUTHORS   Western P, Maldonado-Saldivia J, van den Bergen J, Hajkova P,
            Saitou M, Barton S and Surani MA.
  TITLE     Analysis of Esg1 expression in pluripotent cells and the germline
            reveals similarities with Oct4 and Sox2 and differences between
            human pluripotent cell lines
  JOURNAL   Stem Cells 23 (10), 1436-1442 (2005)
   PUBMED   16166252
REFERENCE   9  (bases 1 to 659)
  AUTHORS   Adjaye J, Huntriss J, Herwig R, BenKahla A, Brink TC, Wierling C,
            Hultschig C, Groth D, Yaspo ML, Picton HM, Gosden RG and Lehrach H.
  TITLE     Primary differentiation in the human blastocyst: comparative
            molecular portraits of inner cell mass and trophectoderm cells
  JOURNAL   Stem Cells 23 (10), 1514-1525 (2005)
   PUBMED   16081659
REFERENCE   10 (bases 1 to 659)
  AUTHORS   Kim SK, Suh MR, Yoon HS, Lee JB, Oh SK, Moon SY, Moon SH, Lee JY,
            Hwang JH, Cho WJ and Kim KS.
  TITLE     Identification of developmental pluripotency associated 5
            expression in human pluripotent stem cells
  JOURNAL   Stem Cells 23 (4), 458-462 (2005)
   PUBMED   15790765
  REMARK    GeneRIF: Dppa5 is specifically and differentially expressed in
            human cells that have pluripotency and can be used as a marker of
            pluripotent stem cells.
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from BC137549.1 and AI365263.1.
            On Nov 22, 2018 this sequence version replaced NM_001025290.2.
            
            Summary: This gene encodes a protein that may function in the
            control of cell pluripotency and early embryogenesis. Expression of
            this gene is a specific marker for pluripotent stem cells.
            Pseudogenes of this gene are located on the short arm of chromosome
            10 and the long arm of chromosomes 14 and 19. [provided by RefSeq,
            Dec 2010].
            
            ##Evidence-Data-START##
            Transcript exon combination :: BX092581.1, BC137549.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA1968968, SAMEA2148093
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            MANE Ensembl match     :: ENST00000370370.4/ ENSP00000359396.3
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-422               BC137549.1         1-422
            423-659             AI365263.1         2-238               c
FEATURES             Location/Qualifiers
     source          1..659
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="6"
                     /map="6q13"
     gene            1..659
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /note="developmental pluripotency associated 5"
                     /db_xref="GeneID:340168"
                     /db_xref="HGNC:HGNC:19201"
                     /db_xref="MIM:611111"
     exon            1..163
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /inference="alignment:Splign:2.1.0"
     variation       1
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375979745"
     misc_feature    4..6
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /note="upstream in-frame stop codon"
     variation       4
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1485484843"
     variation       6..8
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace=""
                     /replace="ggc"
                     /db_xref="dbSNP:760701094"
     variation       6
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1261292450"
     variation       11
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377757876"
     variation       12
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747323151"
     variation       14
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1382696875"
     variation       17
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1233471692"
     variation       18
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1357011596"
     variation       20
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779914733"
     variation       22
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1442895420"
     variation       23
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:971482717"
     variation       25
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:758069908"
     variation       27
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745406323"
     variation       28
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374437671"
     variation       30
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1237156238"
     variation       34
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1014619714"
     variation       35
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756669895"
     variation       44
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1164328111"
     variation       48
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1475634582"
     variation       50
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1420345853"
     variation       51
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1191208316"
     CDS             52..402
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /note="embryonal stem cell specific gene 1"
                     /codon_start=1
                     /product="developmental pluripotency-associated 5 protein"
                     /protein_id="NP_001020461.1"
                     /db_xref="CCDS:CCDS34483.1"
                     /db_xref="GeneID:340168"
                     /db_xref="HGNC:HGNC:19201"
                     /db_xref="MIM:611111"
                     /translation="
MGTLPARRHIPPWVKVPEDLKDPEVFQVQTRLLKAIFGPDGSRIPYIEQVSKAMLELKALESSDLTEVVVYGSYLYKLRTKWMLQSMAEWHRQRQERGMLKLAEAMNALELGPWMK"
     misc_feature    79..321
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /note="KH-like RNA-binding domain; Region: MOEP19;
                     pfam16005"
                     /db_xref="CDD:318262"
     misc_feature    order(154..156,178..180,184..192,199..207,274..279,
                     286..288,298..300,307..312,319..321)
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:240613"
     variation       54
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:983502319"
     variation       56
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1427771623"
     variation       57
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:537827943"
     variation       59
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268502178"
     variation       60
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:951645846"
     variation       62
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1188141701"
     variation       63
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:570647424"
     variation       65
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456999801"
     variation       66
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1179297144"
     variation       67
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:552630054"
     variation       70
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369669340"
     variation       71
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766577013"
     variation       72
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773259184"
     variation       77..80
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="at"
                     /replace="atat"
                     /db_xref="dbSNP:1162564166"
     variation       80
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1470236831"
     variation       82
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538307015"
     variation       83
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761734129"
     variation       84
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772155132"
     variation       85
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1384373407"
     variation       88
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769275469"
     variation       93
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747448130"
     variation       94..96
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:774211446"
     variation       97
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1562272273"
     variation       100
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:775970059"
     variation       103
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1462976045"
     variation       110
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:771668130"
     variation       114
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1166303145"
     variation       115
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866806254"
     variation       118
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866482070"
     variation       128
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:56200340"
     variation       133
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116183617"
     variation       134
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371756094"
     variation       135
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1221086335"
     variation       136
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1353864761"
     variation       140
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756793571"
     variation       141
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748736595"
     variation       142
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1252349128"
     variation       144
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1193694708"
     variation       145
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1469475521"
     variation       149
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777744208"
     variation       152
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:756041213"
     variation       163
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752529165"
     exon            164..343
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /inference="alignment:Splign:2.1.0"
     variation       166
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:563144548"
     variation       167
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1238480576"
     variation       168
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1476112535"
     variation       171
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:759749430"
     variation       172
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1362554932"
     variation       180
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:774064430"
     variation       184
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1413178353"
     variation       188
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1188643328"
     variation       189
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770474760"
     variation       190
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1460308655"
     variation       191
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:966864136"
     variation       193
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192662793"
     variation       196
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:893089236"
     variation       197
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:777233619"
     variation       199
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1157461946"
     variation       204
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1470252233"
     variation       207..208
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:762910177"
     variation       210
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1185271415"
     variation       215
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1474688696"
     variation       216
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769245148"
     variation       217
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748115453"
     variation       218
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:780925724"
     variation       222
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754817609"
     variation       223
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751301021"
     variation       226
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1304913341"
     variation       231
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150361207"
     variation       238
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1281367302"
     variation       239
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1178648469"
     variation       243
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252290620"
     variation       244
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:757518411"
     variation       246
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754015855"
     variation       248..249
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:774935799"
     variation       248
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764295310"
     variation       249
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:550609190"
     variation       250
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:532126987"
     variation       255
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:565020971"
     variation       264
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753256227"
     variation       266
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1486404354"
     variation       268
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1198250246"
     variation       271
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767856269"
     variation       276
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760006046"
     variation       278
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:964945017"
     variation       283
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774576711"
     variation       285
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770611066"
     variation       286
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762572419"
     variation       287
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:540328289"
     variation       295
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748677174"
     variation       297
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769296485"
     variation       301
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747598051"
     variation       303
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141835527"
     variation       304
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372341276"
     variation       307
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1477817368"
     variation       308
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1172083598"
     variation       309
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1211947565"
     variation       310
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1256561622"
     variation       312
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235140672"
     variation       315
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746857677"
     variation       322
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274106087"
     variation       326
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:890460979"
     variation       330
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141223599"
     variation       332
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758222466"
     variation       339
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1282821714"
     variation       340
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1297686018"
     exon            344..659
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /inference="alignment:Splign:2.1.0"
     variation       344
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772000557"
     variation       345
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745603346"
     variation       352
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1392564494"
     variation       353
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12200929"
     variation       358
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1477954934"
     variation       367
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1454233763"
     variation       370
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202225803"
     variation       372
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1395724716"
     variation       373
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756401898"
     variation       374
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1010248664"
     variation       375
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:73754622"
     variation       377
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1190841932"
     variation       378
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777330080"
     variation       379
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1232580746"
     variation       384
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1204948209"
     variation       387..389
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:780776613"
     variation       387
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755037198"
     variation       388
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564883537"
     variation       400
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1445985204"
     variation       403
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766813622"
     variation       409..413
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="ttcca"
                     /replace="ttccattcca"
                     /db_xref="dbSNP:770628324"
     variation       410
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758819995"
     variation       412
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757900680"
     variation       414
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200196148"
     variation       415
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1188779881"
     variation       417
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:761345763"
     variation       421
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1279843084"
     variation       422..423
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1202125194"
     variation       430
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776293984"
     variation       433
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1372734716"
     variation       436
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1311467176"
     variation       438
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200904292"
     variation       445
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759070060"
     variation       446
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1425273754"
     variation       447
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1178307981"
     variation       448
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1417474466"
     variation       454
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:879200675"
     variation       466
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1400025788"
     variation       469
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1156889710"
     variation       470
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1346725973"
     variation       477
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1435487591"
     variation       478
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:886250322"
     variation       490
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1047527915"
     variation       491
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:930410366"
     variation       494
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1182041542"
     variation       496
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1035925295"
     variation       497
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:920326044"
     variation       500
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1222531678"
     variation       501
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1287012097"
     variation       503
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1318069227"
     variation       506
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1213414629"
     variation       512
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1038759637"
     variation       527
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1002738363"
     variation       529
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1466814101"
     variation       536
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:560801490"
     variation       537
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1246775532"
     variation       542
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:943023060"
     variation       549
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1156329947"
     variation       551
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1410025478"
     variation       558
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1457711936"
     variation       567..573
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="ttgt"
                     /replace="ttgttgt"
                     /db_xref="dbSNP:1392096731"
     variation       569
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1163869752"
     variation       588
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1041652773"
     variation       594
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369093519"
     variation       603
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1335222629"
     variation       607..612
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="tttt"
                     /replace="ttttt"
                     /replace="tttttt"
                     /db_xref="dbSNP:1281380859"
     variation       608
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:911486295"
     variation       610
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1440050147"
     variation       613
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371129787"
     variation       614..619
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="tttttt"
                     /replace="tttttttttt"
                     /db_xref="dbSNP:1335930153"
     variation       617..618
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:376865248"
     variation       617
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:563289316"
     variation       620..623
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace=""
                     /replace="ccca"
                     /db_xref="dbSNP:1275586214"
     variation       628
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:367701006"
     variation       638..642
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="aa"
                     /replace="aataa"
                     /db_xref="dbSNP:1227173796"
     variation       647
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:765257977"
     variation       651
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1178969765"
     variation       655
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:76770796"
     variation       659
                     /gene="DPPA5"
                     /gene_synonym="ESG1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1472870653"
ORIGIN      
gattaggcctggtttgcgctggagagtggtcttggttgtgagggtcataagatgggaactctcccggcacgtagacatatcccgccgtgggtgaaagttcccgaagacctgaaagatccagaggtgttccaggtccagacgcggctgctgaaagccattttcggcccggacggatctcgaatcccttacatcgagcaggtgagcaaggccatgctcgagctgaaggctctggagtcttcagacctcaccgaggtcgtggtttacggctcctatttgtacaagctccggaccaagtggatgctccagtccatggctgagtggcaccgccagcgccaggagcgagggatgctcaaacttgccgaagccatgaatgccctcgaactaggcccttggatgaagtgaaccagtttccagccaatgcaatgaagccgggttgcagagattaggttgtggccagagctagagtgattccttaagcttgttttaaaatctgctccagcctaaagagttaagggaaaaccatttgttcccttaaagagttaagggaaaacccttggctctgagtcttgttgtgaatatttctttgatgattgttaataaaaagtgttttttcttttttcccatttttaaaaataacaataaagttttaaataagttga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]