GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-07 21:30:45, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NM_001014443            2315 bp    mRNA    linear   PRI 26-NOV-2019
DEFINITION  Homo sapiens ubiquitin specific peptidase 21 (USP21), transcript
            variant 3, mRNA.
ACCESSION   NM_001014443
VERSION     NM_001014443.3
KEYWORDS    RefSeq; MANE Select.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2315)
  AUTHORS   Hou P, Ma X, Zhang Q, Wu CJ, Liao W, Li J, Wang H, Zhao J, Zhou X,
            Guan C, Ackroyd J, Jiang S, Zhang J, Spring DJ, Wang YA and DePinho
            RA.
  TITLE     USP21 deubiquitinase promotes pancreas cancer cell stemness via Wnt
            pathway activation
  JOURNAL   Genes Dev. 33 (19-20), 1361-1366 (2019)
   PUBMED   31488580
  REMARK    GeneRIF: work identifies and validates USP21 as a PDAC oncogene
REFERENCE   2  (bases 1 to 2315)
  AUTHORS   Liu J, Kruswick A, Dang H, Tran AD, Kwon SM, Wang XW and
            Oberdoerffer P.
  TITLE     Ubiquitin-specific protease 21 stabilizes BRCA2 to control DNA
            repair and tumor growth
  JOURNAL   Nat Commun 8 (1), 137 (2017)
   PUBMED   28743957
  REMARK    GeneRIF: USP21 interacts with, deubiquitinates and stabilizes BRCA2
            to promote efficient RAD51 loading at DNA double-strand breaks.
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 2315)
  AUTHORS   Chen Y, Wang L, Jin J, Luan Y, Chen C, Li Y, Chu H, Wang X, Liao G,
            Yu Y, Teng H, Wang Y, Pan W, Fang L, Liao L, Jiang Z, Ge X, Li B
            and Wang P.
  TITLE     p38 inhibition provides anti-DNA virus immunity by regulation of
            USP21 phosphorylation and STING activation
  JOURNAL   J. Exp. Med. 214 (4), 991-1010 (2017)
   PUBMED   28254948
  REMARK    GeneRIF: a critical role of p38-mediated USP21 phosphorylation in
            regulating STING-mediated antiviral functions and identifies
            p38-USP21 axis as an important pathway that DNA virus adopts to
            avoid innate immunity responses.
REFERENCE   4  (bases 1 to 2315)
  AUTHORS   Kwon SK, Lee DH, Kim SY, Park JH, Choi J and Baek KH.
  TITLE     Ubiquitin-specific protease 21 regulating the K48-linked
            polyubiquitination of NANOG
  JOURNAL   Biochem. Biophys. Res. Commun. 482 (4), 1443-1448 (2017)
   PUBMED   27956178
  REMARK    GeneRIF: USP21 specifically regulates the Lys48-linked
            polyubiquitination and stability of NANOG
REFERENCE   5  (bases 1 to 2315)
  AUTHORS   Heride C, Rigden DJ, Bertsoulaki E, Cucchi D, De Smaele E, Clague
            MJ and Urbe S.
  TITLE     The centrosomal deubiquitylase USP21 regulates Gli1 transcriptional
            activity and stability
  JOURNAL   J. Cell. Sci. 129 (21), 4001-4013 (2016)
   PUBMED   27621083
  REMARK    GeneRIF: USP21 recruits and stabilises Gli1 at the centrosome.
REFERENCE   6  (bases 1 to 2315)
  AUTHORS   Urbe S, Liu H, Hayes SD, Heride C, Rigden DJ and Clague MJ.
  TITLE     Systematic survey of deubiquitinase localization identifies USP21
            as a regulator of centrosome- and microtubule-associated functions
  JOURNAL   Mol. Biol. Cell 23 (6), 1095-1103 (2012)
   PUBMED   22298430
  REMARK    GeneRIF: Study observed a reduction in the number of A549 cells
            developing a primary cilium upon serum starvation when USP21 was
            depleted with two independent siRNA oligos.
REFERENCE   7  (bases 1 to 2315)
  AUTHORS   Ye Y, Akutsu M, Reyes-Turcu F, Enchev RI, Wilkinson KD and Komander
            D.
  TITLE     Polyubiquitin binding and cross-reactivity in the USP domain
            deubiquitinase USP21
  JOURNAL   EMBO Rep. 12 (4), 350-357 (2011)
   PUBMED   21399617
  REMARK    GeneRIF: Study report that USP21 cleaves Ub polymers, and with
            reduced activity also targets ISG15, but is inactive against NEDD8.
REFERENCE   8  (bases 1 to 2315)
  AUTHORS   Xu G, Tan X, Wang H, Sun W, Shi Y, Burlingame S, Gu X, Cao G, Zhang
            T, Qin J and Yang J.
  TITLE     Ubiquitin-specific peptidase 21 inhibits tumor necrosis factor
            alpha-induced nuclear factor kappaB activation via binding to and
            deubiquitinating receptor-interacting protein 1
  JOURNAL   J. Biol. Chem. 285 (2), 969-978 (2010)
   PUBMED   19910467
  REMARK    GeneRIF: USP21 plays an important role in the down-regulation of
            TNFalpha-induced NF-kappaB activation through deubiquitinating
            RIP1.
REFERENCE   9  (bases 1 to 2315)
  AUTHORS   Gong L, Kamitani T, Millas S and Yeh ET.
  TITLE     Identification of a novel isopeptidase with dual specificity for
            ubiquitin- and NEDD8-conjugated proteins
  JOURNAL   J. Biol. Chem. 275 (19), 14212-14216 (2000)
   PUBMED   10799498
REFERENCE   10 (bases 1 to 2315)
  AUTHORS   Smith TS and Southan C.
  TITLE     Sequencing, tissue distribution and chromosomal assignment of a
            novel ubiquitin-specific protease USP23
  JOURNAL   Biochim. Biophys. Acta 1490 (1-2), 184-188 (2000)
   PUBMED   10786635
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from BI755746.1, BC090946.1,
            AF177758.1 and AI038040.1.
            On Nov 23, 2018 this sequence version replaced NM_001014443.2.
            
            Summary: This gene encodes a member of the C19 peptidase family,
            also known as family 2 of ubiquitin carboxy-terminal hydrolases.
            The encoded protein cleaves ubiquitin from ubiquitinated proteins
            for recycling in intracellular protein degradation. The encoded
            protein is also able to release NEDD8, a ubiquitin-like protein,
            from NEDD8-conjugated proteins. This gene has been referred to as
            USP16 and USP23 but is now known as USP21. Alternatively spliced
            transcript variants encoding different isoforms have been found for
            this gene. [provided by RefSeq, Feb 2016].
            
            Transcript Variant: This variant (3) differs in the 5' UTR and
            coding sequence compared to variant 4. The resulting isoform (c) is
            shorter at the N-terminus compared to isoform a. Variants 1 and 3
            both encode the same isoform (c).
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR3476690.822388.1,
                                           SRR1163657.189286.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA1965299, SAMEA1966682
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            MANE Ensembl match     :: ENST00000368002.8/ ENSP00000356981.3
            RefSeq Select criteria :: based on conservation, expression
            ##RefSeq-Attributes-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-16                BI755746.1         51-66
            17-465              BC090946.1         1-449
            466-2122            AF177758.1         212-1868
            2123-2315           AI038040.1         8-200               c
FEATURES             Location/Qualifiers
     source          1..2315
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1q23.3"
     gene            1..2315
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /note="ubiquitin specific peptidase 21"
                     /db_xref="GeneID:27005"
                     /db_xref="HGNC:HGNC:12620"
                     /db_xref="MIM:604729"
     exon            1..179
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       7
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366304902"
     variation       9
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1377400748"
     variation       10
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1310181850"
     variation       11
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1444658382"
     variation       15
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1352828505"
     variation       20
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978508891"
     variation       21..23
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1486278284"
     variation       22
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1406430390"
     variation       23
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1368060770"
     variation       27..35
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="ggcggc"
                     /replace="ggcggcggc"
                     /db_xref="dbSNP:1162249922"
     variation       28
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1557999285"
     variation       29
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199955506"
     variation       30
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:574535198"
     variation       32
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1178561456"
     variation       33
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1468340643"
     variation       34
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:925262965"
     variation       36
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1221721570"
     variation       37
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1490702404"
     variation       38
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1426903854"
     variation       39
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1289451839"
     variation       40
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:936759820"
     variation       44
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1185325919"
     variation       46
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225683381"
     variation       49
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1371506111"
     variation       50
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1279011326"
     variation       51
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1437223096"
     variation       59
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1243629515"
     variation       62
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:944619354"
     variation       63
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1438890927"
     variation       67
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1156588596"
     variation       68
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1038920475"
     variation       69
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1161783645"
     variation       74
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1365200626"
     variation       76
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:947814268"
     variation       77
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:900304631"
     variation       78
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:895352220"
     variation       80
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112604935"
     variation       83
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1266171865"
     variation       88
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1403220877"
     variation       89
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198586585"
     variation       91
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:886119324"
     variation       93..99
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="gggggg"
                     /replace="ggggggg"
                     /replace="gggggggg"
                     /db_xref="dbSNP:1262243998"
     variation       93
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1004583454"
     variation       94
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1046673372"
     variation       95
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:886704992"
     variation       98
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:537144107"
     variation       105
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1031113402"
     variation       105
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1232767863"
     variation       113
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1557999516"
     variation       114
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750709377"
     variation       116..136
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="gggggtggccctgaactgggg"
                     /replace="gggggtggccctgaactggggggtggccctgaactgggg"
                     /db_xref="dbSNP:1176257500"
     variation       116
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1325786979"
     variation       117
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1426589101"
     variation       120
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1204345281"
     variation       133
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:956987927"
     variation       134
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1015679303"
     variation       137
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:986858621"
     variation       140
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757153392"
     variation       144
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1263687993"
     variation       151
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368750833"
     variation       157
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:995292059"
     variation       159
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1485385009"
     variation       161
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:556790397"
     variation       163
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:953881564"
     variation       170
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1462855011"
     variation       177
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1261310605"
     exon            180..320
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       180
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225697702"
     variation       188
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1327147951"
     variation       192
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1246389243"
     variation       193
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:902272912"
     variation       200
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1026987933"
     variation       202..203
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1314708972"
     variation       204
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1436120237"
     variation       205
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346169789"
     variation       207
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:935058194"
     variation       213
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1319861874"
     variation       220
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1398655796"
     variation       228
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:536378233"
     variation       229
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1053552211"
     variation       232
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745638742"
     variation       242
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772090699"
     variation       245
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481143850"
     variation       253
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1427069093"
     variation       258
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1190556294"
     variation       261
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1217388792"
     variation       275
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1486039465"
     variation       282
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1242193032"
     misc_feature    288..290
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /note="upstream in-frame stop codon"
     variation       289
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1461298373"
     variation       309
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:552527785"
     variation       315
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218213237"
     variation       320
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1463748015"
     exon            321..941
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       325
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1379858238"
     variation       327
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373250780"
     variation       332
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745980122"
     variation       333
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1376418783"
     variation       339
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758436746"
     CDS             342..2039
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /EC_number="3.4.19.12"
                     /note="isoform c is encoded by transcript variant 3;
                     ubiquitin specific protease 21; ubiquitin thiolesterase
                     21; ubiquitin-specific processing protease 21;
                     deubiquitinating enzyme 21; ubiquitin carboxyl-terminal
                     hydrolase 21; ubiquitin-specific protease 16;
                     NEDD8-specific protease; ubiquitin thioesterase 21"
                     /codon_start=1
                     /product="ubiquitin carboxyl-terminal hydrolase 21 isoform
                     c"
                     /protein_id="NP_001014443.1"
                     /db_xref="CCDS:CCDS30920.1"
                     /db_xref="GeneID:27005"
                     /db_xref="HGNC:HGNC:12620"
                     /db_xref="MIM:604729"
                     /translation="
MPQASEHRLGRTREPPVNIQPRVGSKLPFAPRARSKERRNPASGPNPMLRPLPPRPGLPDERLKKLELGRGRTSGPRPRGPLRADHGVPLPGSPPPTVALPLPSRTNLARSKSVSSGDLRPMGIALGGHRGTGELGAALSRLALRPEPPTLRRSTSLRRLGGFPGPPTLFSIRTEPPASHGSFHMISARSSEPFYSDDKMAHHTLLLGSGHVGLRNLGNTCFLNAVLQCLSSTRPLRDFCLRRDFRQEVPGGGRAQELTEAFADVIGALWHPDSCEAVNPTRFRAVFQKYVPSFSGYSQQDAQEFLKLLMERLHLEINRRGRRAPPILANGPVPSPPRRGGALLEEPELSDDDRANLMWKRYLEREDSKIVDLFVGQLKSCLKCQACGYRSTTFEVFCDLSLPIPKKGFAGGKVSLRDCFNLFTKEEELESENAPVCDRCRQKTRSTKKLTVQRFPRILVLHLNRFSASRGSIKKSSVGVDFPLQRLSLGDFASDKAGSPVYQLYALCNHSGSVHYGHYTALCRCQTGWHVYNDSRVSPVSENQVASSEGYVLFYQLMQEPPRCL"
     misc_feature    741..797
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9UK80.1);
                     Region: Nuclear export signal"
     misc_feature    975..2006
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /note="Ubiquitin carboxyl-terminal hydrolase; Region: UCH;
                     pfam00443"
                     /db_xref="CDD:278850"
     misc_feature    978..2009
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /note="A subfamily of peptidase C19. Peptidase C19
                     contains ubiquitinyl hydrolases. They are intracellular
                     peptidases that remove ubiquitin molecules from
                     polyubiquinated peptides by cleavage of isopeptide bonds.
                     They hydrolyze bonds involving the carboxyl...; Region:
                     Peptidase_C19R; cd02674"
                     /db_xref="CDD:239139"
     misc_feature    order(987..989,1002..1004,1893..1895,1941..1943)
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /note="active site"
                     /db_xref="CDD:239139"
     variation       343
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780262251"
     variation       357
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747180723"
     variation       359
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140487526"
     variation       363
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780961535"
     variation       364
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199737344"
     variation       365
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772975124"
     variation       366
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147848740"
     variation       371
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770506309"
     variation       372
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149985789"
     variation       373
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780111343"
     variation       374
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1355773989"
     variation       378
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764589289"
     variation       379
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116557343"
     variation       381
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762032221"
     variation       382
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1027833821"
     variation       388
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747118690"
     variation       389
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765801629"
     variation       390
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1376338644"
     variation       393
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1294349075"
     variation       395
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:953519657"
     variation       396
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1396716119"
     variation       397
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1433024995"
     variation       406
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750832234"
     variation       408
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780099574"
     variation       415..440
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="cc"
                     /replace="ccaagctaccatttgcccccagggcc"
                     /db_xref="dbSNP:1215143851"
     variation       419
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751846238"
     variation       424
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755162566"
     variation       427
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1319707254"
     variation       429
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780900838"
     variation       430
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748000177"
     variation       431
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1469387885"
     variation       432
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1206250200"
     variation       433
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769407463"
     variation       435
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:575048074"
     variation       438
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188873901"
     variation       440
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749224489"
     variation       441
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770632791"
     variation       442
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369560591"
     variation       444
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759307340"
     variation       452
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149171020"
     variation       453
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:544093165"
     variation       454
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372804422"
     variation       460
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:765465616"
     variation       462
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1048478827"
     variation       466
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751000774"
     variation       467
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773739033"
     variation       468
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:554785282"
     variation       471
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755003081"
     variation       479
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:781510108"
     variation       481
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752802166"
     variation       482
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777424873"
     variation       484
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:976462968"
     variation       489
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749277844"
     variation       490
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:115968198"
     variation       492
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745399364"
     variation       493
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771414801"
     variation       496
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:935089193"
     variation       500
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1391427229"
     variation       501
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775224335"
     variation       502
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1158710471"
     variation       504
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746631922"
     variation       505
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377369830"
     variation       506
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202128032"
     variation       511
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558001075"
     variation       512
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773418847"
     variation       517
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456218383"
     variation       526..527
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1366896376"
     variation       526
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:947870525"
     variation       529
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1313249351"
     variation       530
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1357211200"
     variation       533
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:560488704"
     variation       536
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138981004"
     variation       538
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252824621"
     variation       539
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373370594"
     variation       549
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201630346"
     variation       550
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759623543"
     variation       552
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767479799"
     variation       555
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753029463"
     variation       556
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1282831113"
     variation       559
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145921869"
     variation       560
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370790417"
     variation       562
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757075486"
     variation       564
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778995626"
     variation       568
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745744328"
     variation       570
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757988113"
     variation       571
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779429015"
     variation       573
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1174194982"
     variation       575
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746718961"
     variation       579
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1427606378"
     variation       582
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1014931023"
     variation       589
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373004398"
     variation       596
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1396133231"
     variation       601
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776218601"
     variation       602
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1443996437"
     variation       603
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1272565073"
     variation       605
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1346015833"
     variation       610
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749685785"
     variation       611
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:137880709"
     variation       612
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:34779722"
     variation       613
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1422204303"
     variation       614
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147394083"
     variation       616
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775409507"
     variation       618
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:994956917"
     variation       619
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760755383"
     variation       620
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370862481"
     variation       621
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:186717254"
     variation       624
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754044354"
     variation       626
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454777466"
     variation       627
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765114499"
     variation       628
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:976976354"
     variation       630
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1396849490"
     variation       634
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1430565611"
     variation       636
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1027738645"
     variation       638
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1447632624"
     variation       645
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750456510"
     variation       647
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769907409"
     variation       650
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1420043006"
     variation       654
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758241325"
     variation       655
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1321190857"
     variation       658
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1558001478"
     variation       662
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367894011"
     variation       666
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372425350"
     variation       667
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751053740"
     variation       668
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375476473"
     variation       670
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763201934"
     variation       674
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1228387345"
     variation       680
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372271090"
     variation       681
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1442728637"
     variation       688
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1341917803"
     variation       699
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:191180673"
     variation       700
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779217194"
     variation       704
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1468938610"
     variation       705
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1215606462"
     variation       706
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746436438"
     variation       707..710
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1558001601"
     variation       708
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772474679"
     variation       718
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776021910"
     variation       719
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760671742"
     variation       723
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200067760"
     variation       729
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768795185"
     variation       730
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3813616"
     variation       731
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1230716480"
     variation       733
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762124989"
     variation       737
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375923326"
     variation       738
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750167338"
     variation       745
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1456713893"
     variation       749
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762760965"
     variation       750
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1013474720"
     variation       751
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766259751"
     variation       754
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1328520627"
     variation       758
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369057043"
     variation       760
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751449721"
     variation       762
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754462761"
     variation       763
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148485578"
     variation       764
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755738229"
     variation       769
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1266239809"
     variation       770
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1245748978"
     variation       771
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777352567"
     variation       772
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:529747030"
     variation       774..799
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="cggcctgagccacccactttgagacg"
                     /replace="cggcctgagccacccactttgagacggcctgagccacccactttgaga
                     cg"
                     /db_xref="dbSNP:1284907469"
     variation       774
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371692736"
     variation       775
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151044234"
     variation       778
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:566090442"
     variation       779
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143739061"
     variation       787
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762176011"
     variation       790
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1409055622"
     variation       792
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375288621"
     variation       798
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1229292579"
     variation       799
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773447985"
     variation       800
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149047051"
     variation       801
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766142083"
     variation       804
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1312644544"
     variation       805
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751515613"
     variation       806
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369085261"
     variation       810
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752222593"
     variation       812
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:897868457"
     variation       813
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:994821674"
     variation       814
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373262739"
     variation       816
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763740106"
     variation       817
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753471183"
     variation       823
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1352734116"
     variation       825
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1412853864"
     variation       828
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376196870"
     variation       829
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1279258107"
     variation       836
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1485885239"
     variation       841
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140569144"
     variation       842
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369956021"
     variation       844
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1008016886"
     variation       845
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1418193867"
     variation       846
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1431952162"
     variation       848
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747512665"
     variation       850
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1181881199"
     variation       853
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752768895"
     variation       858
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755520314"
     variation       859
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1173574908"
     variation       862
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1187533955"
     variation       864
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1376390838"
     variation       867
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1019119107"
     variation       868
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1306606470"
     variation       869
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:966602309"
     variation       870
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373371747"
     variation       875
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748273705"
     variation       880
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1309233875"
     variation       881
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1329422898"
     variation       893
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1231920757"
     variation       895
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1302612528"
     variation       900
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1348279732"
     variation       902
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538169930"
     variation       903
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1272278343"
     variation       906
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760197993"
     variation       907
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749514583"
     variation       910
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377456378"
     variation       912
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759274012"
     variation       917
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777112723"
     variation       918
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1193513330"
     variation       920
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767469808"
     variation       922
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1339794100"
     variation       927
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775338931"
     variation       929
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456002905"
     variation       933
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554465394"
     variation       935
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149224884"
     variation       936
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868304743"
     variation       937
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753499138"
     variation       939
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756904192"
     exon            942..1001
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       942
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1396873393"
     variation       943
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1442934691"
     variation       951
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143385078"
     variation       953
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1472977202"
     variation       957..961
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="ct"
                     /replace="cttct"
                     /db_xref="dbSNP:747526943"
     variation       962
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1382540549"
     variation       969
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:927307916"
     variation       974
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768093328"
     variation       980
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1472461967"
     variation       981
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1353163687"
     variation       984
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268579487"
     variation       985
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776184092"
     variation       995
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1273193261"
     variation       999
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:769200434"
     variation       1000
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763336520"
     variation       1001
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761180075"
     exon            1002..1122
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       1003
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1408890590"
     variation       1016
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769131942"
     variation       1017
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1161217307"
     variation       1020
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1394922866"
     variation       1023
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1373339540"
     variation       1035
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168804171"
     variation       1042
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773060192"
     variation       1043
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762692645"
     variation       1044
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768041063"
     variation       1047
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1245839165"
     variation       1050
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:753130907"
     variation       1051
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1297104547"
     variation       1058
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760903800"
     variation       1060
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764663340"
     variation       1062
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1301919209"
     variation       1064
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754240232"
     variation       1073
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757415336"
     variation       1076
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1258110666"
     variation       1078
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1282983608"
     variation       1082
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198718838"
     variation       1086
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778958998"
     variation       1098
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750682009"
     variation       1101
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758599365"
     variation       1102
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780201653"
     variation       1104
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1180391261"
     variation       1106
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1393162113"
     variation       1112
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746853481"
     variation       1115
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768269159"
     exon            1123..1234
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       1123
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:896779149"
     variation       1127
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780848147"
     variation       1142
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748159936"
     variation       1145
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:938964861"
     variation       1148
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756140031"
     variation       1153
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777811005"
     variation       1154
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1271190505"
     variation       1159
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111293389"
     variation       1160
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748807359"
     variation       1161
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1231763107"
     variation       1166
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770504318"
     variation       1169
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774111165"
     variation       1175
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:896162583"
     variation       1177
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1291892207"
     variation       1186
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1279396976"
     variation       1192
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145716263"
     variation       1193
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1332394066"
     variation       1196
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115167858"
     variation       1200
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1192180828"
     variation       1208
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769102661"
     variation       1219
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776837325"
     variation       1221
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765765976"
     variation       1223
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1416462575"
     variation       1229
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1461537240"
     exon            1235..1390
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       1238
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:377383966"
     variation       1239
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779718932"
     variation       1241
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361631774"
     variation       1247
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748518200"
     variation       1250
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770085988"
     variation       1257
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1248893750"
     variation       1268
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:988786204"
     variation       1271
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773767393"
     variation       1274
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750344599"
     variation       1275
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1393725038"
     variation       1276
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:546385110"
     variation       1278..1283
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="ctacac"
                     /db_xref="dbSNP:773953398"
     variation       1278
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376234730"
     variation       1281
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:771042561"
     variation       1283
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370766364"
     variation       1290
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759618282"
     variation       1291
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:968776738"
     variation       1292
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767635139"
     variation       1294
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200765643"
     variation       1296
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760601517"
     variation       1300
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763976152"
     variation       1303
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17356051"
     variation       1305..1310
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace=""
                     /replace="cgccgg"
                     /db_xref="dbSNP:1279356912"
     variation       1305
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200512435"
     variation       1306
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749934766"
     variation       1307
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757859694"
     variation       1308
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114213404"
     variation       1309
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199718002"
     variation       1316
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:778084340"
     variation       1318
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1239657969"
     variation       1319
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1240523510"
     variation       1323
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147410329"
     variation       1324
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771367592"
     variation       1330
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774852233"
     variation       1332
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759545435"
     variation       1338
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772175471"
     variation       1341
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1057511684"
     variation       1347
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1127525"
     variation       1348
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357198951"
     variation       1350
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760947213"
     variation       1351
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1311982602"
     variation       1352
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1333471250"
     variation       1353
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148729808"
     variation       1354
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753705815"
     variation       1356
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:976062697"
     variation       1357
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761658917"
     variation       1359
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765093090"
     variation       1360
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1234929296"
     variation       1362
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199576715"
     variation       1366
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:192656343"
     variation       1373
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750318425"
     variation       1374
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757904173"
     variation       1379
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558004714"
     variation       1380
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1006419712"
     variation       1382
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1238217392"
     exon            1391..1455
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       1395
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773091334"
     variation       1396
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:762919205"
     variation       1402
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765859146"
     variation       1409
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1382221445"
     variation       1410
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1203698456"
     variation       1419
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146775306"
     variation       1420
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:754447783"
     variation       1421
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767167238"
     variation       1422
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752329005"
     variation       1423
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1374428530"
     variation       1428
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1474942459"
     variation       1434
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1165785436"
     variation       1435
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757626220"
     exon            1456..1559
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       1457
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1196376610"
     variation       1463
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1254432738"
     variation       1481
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144266041"
     variation       1487
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755177810"
     variation       1497
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781391210"
     variation       1498
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306960209"
     variation       1509
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1355081464"
     variation       1510
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748371306"
     variation       1517
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1278647056"
     variation       1519
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770080450"
     variation       1523
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777822343"
     variation       1524
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749117248"
     variation       1526
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770696712"
     variation       1541
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774335235"
     variation       1548
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759435509"
     variation       1550
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1237443922"
     variation       1553
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1440253856"
     variation       1556
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771616544"
     exon            1560..1646
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       1560
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752855778"
     variation       1562
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116296675"
     variation       1564
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778073280"
     variation       1571
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150282425"
     variation       1574
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1211991428"
     variation       1576
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778654529"
     variation       1581
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1005739854"
     variation       1582
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220488162"
     variation       1583
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745611981"
     variation       1590
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866698810"
     variation       1591
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772025737"
     variation       1603
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775224656"
     variation       1605
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1558006266"
     variation       1610
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200752473"
     variation       1628
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760245330"
     variation       1631
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:947661179"
     variation       1632
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1017092745"
     variation       1633
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778075451"
     variation       1634
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776411574"
     variation       1636
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:766900223"
     variation       1643
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1361137900"
     exon            1647..1725
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       1647
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145866434"
     variation       1656
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759996638"
     variation       1657
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1263519908"
     variation       1662
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767763815"
     variation       1663
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776101713"
     variation       1668
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1486685028"
     variation       1675
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761061289"
     variation       1676
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1362626583"
     variation       1693
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764610442"
     variation       1694
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543394546"
     variation       1697
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1333581784"
     variation       1698
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374407631"
     variation       1709
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1448635786"
     variation       1710
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765458506"
     variation       1711
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377194833"
     variation       1718
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184941830"
     variation       1719
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1014252597"
     variation       1722
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1477554614"
     exon            1726..1833
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       1734
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868728667"
     variation       1735
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1378901679"
     variation       1743
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1231585601"
     variation       1745
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764510874"
     variation       1750
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:111461715"
     variation       1751
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773005306"
     variation       1754
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:761937444"
     variation       1758
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765296944"
     variation       1759
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:762764076"
     variation       1762
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1179877735"
     variation       1771
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536466461"
     variation       1774
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763064946"
     variation       1777
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:978470909"
     variation       1784
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1371245954"
     variation       1787
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1378369259"
     variation       1790
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1467782864"
     variation       1793
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1166227643"
     variation       1797
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766575729"
     variation       1798
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1192907648"
     variation       1799
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1475411289"
     variation       1800
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751343904"
     variation       1806
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:987643303"
     variation       1807
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1332006216"
     variation       1809
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1402409139"
     variation       1819
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866838339"
     variation       1827..1829
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:757073748"
     variation       1829
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771536058"
     variation       1833
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:865938309"
     exon            1834..1948
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       1841
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262682222"
     variation       1842
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756139933"
     variation       1850
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777810884"
     variation       1851
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753290580"
     variation       1853
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767518085"
     variation       1867
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373253684"
     variation       1868
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1029807161"
     variation       1873
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1236492617"
     variation       1878
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:557777574"
     variation       1880
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1368794125"
     variation       1886
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778485772"
     variation       1888
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1156631087"
     variation       1892
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1359430515"
     variation       1900
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745529060"
     variation       1904
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577574792"
     variation       1910
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1469273472"
     variation       1912
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781514698"
     variation       1925
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1395928110"
     variation       1930
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314015452"
     variation       1941
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748464692"
     variation       1943
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1002706050"
     variation       1946
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200656986"
     variation       1947
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770318696"
     exon            1949..2315
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /inference="alignment:Splign:2.1.0"
     variation       1949
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373928254"
     variation       1953
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756415420"
     variation       1954
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778205345"
     variation       1958
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749801465"
     variation       1970
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1432237905"
     variation       1974
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3203747"
     variation       1985
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770960871"
     variation       1991
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:908584792"
     variation       1994
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745899561"
     variation       1995
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772424636"
     variation       1999
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:775794234"
     variation       2003
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760603430"
     variation       2007
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1349401801"
     variation       2008
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:938612558"
     variation       2010
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35194262"
     variation       2013
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:763944802"
     variation       2015
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1367169046"
     variation       2016
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776471937"
     variation       2017
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377308026"
     variation       2022
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1316186999"
     variation       2025
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749981017"
     variation       2026
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1257292777"
     variation       2027
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371171675"
     variation       2028
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766035942"
     variation       2029
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751201926"
     variation       2030
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142766324"
     variation       2034
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1297811532"
     variation       2043
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1191457758"
     variation       2045
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1127539"
     variation       2047..2048
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1430746167"
     variation       2049
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1476530479"
     variation       2050
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749813212"
     variation       2052
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1424886998"
     variation       2059
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1418472127"
     variation       2065
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:757810362"
     variation       2067
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779217831"
     variation       2070
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:745955405"
     variation       2076
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772263944"
     variation       2078
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775919041"
     variation       2079
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747202481"
     variation       2080
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1359248786"
     variation       2081
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1218030997"
     variation       2085
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:551498235"
     variation       2086
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1486409248"
     variation       2088
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1318507132"
     variation       2089
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776507876"
     variation       2092
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:904309207"
     variation       2096
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1197999850"
     variation       2099
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1265956574"
     variation       2109
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565240420"
     variation       2113
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1051709484"
     variation       2114
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1307614006"
     variation       2126
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539715797"
     variation       2128
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:530812049"
     variation       2135
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:891283550"
     variation       2143
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1009811926"
     variation       2144
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:998572897"
     variation       2145
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1021142323"
     variation       2148
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:551225479"
     variation       2149
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1301362286"
     variation       2150
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1127571"
     variation       2154
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769313034"
     variation       2164
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:890104582"
     variation       2165
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:567878891"
     variation       2166
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1428166121"
     variation       2171
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1170719953"
     variation       2172..2179
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="ttttttt"
                     /replace="tttttttt"
                     /replace="ttttttttt"
                     /db_xref="dbSNP:1166046856"
     variation       2173
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1476420184"
     variation       2174
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1008552176"
     variation       2179
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1371335057"
     variation       2183..2188
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="aa"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /db_xref="dbSNP:1017885701"
     variation       2188
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:556512200"
     variation       2189
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1196215402"
     variation       2190
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233155550"
     variation       2191
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:958705021"
     variation       2193
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1028199685"
     variation       2196
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:991222856"
     variation       2205
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547193686"
     variation       2207
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1388419772"
     variation       2210
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:983470591"
     variation       2223
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3402"
     variation       2226
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1228019988"
     variation       2234
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:939377771"
     variation       2246
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:971217557"
     variation       2248
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1311466730"
     variation       2252..2254
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1444693359"
     variation       2256
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1364227809"
     variation       2257
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225821605"
     variation       2259
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1327213476"
     variation       2272
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368385818"
     variation       2274
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1459765488"
     variation       2282
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749364714"
     variation       2290
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1164539783"
     variation       2294
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:915862475"
     variation       2302..2307
                     /gene="USP21"
                     /gene_synonym="USP16; USP23"
                     /replace="tta"
                     /replace="ttatta"
                     /db_xref="dbSNP:1409753548"
ORIGIN      
ggtggccgggcgggaccaacaaagatggcggcggcccctgcggcgggagcgatctgggcaacggctgcggctaaagctgcagccgggcccacgggggggctgcacgggggtagtagggggtggccctgaactggggcctggccctggctggcctctcccgccgcctcactgggggacaggtactggggatacgatggctgattcgatagatctggttcctgccctcagtgcgtatactgctccccactttcgttgatgtggtagtggtgatgactgagccaaccacctaatgtggaaatgagaggacagcaagattgtgggtccagcctgtggtgtccacaatgccccaggcctctgagcaccgcctgggccgtacccgagagccacctgttaatatccagccccgagtgggatccaagctaccatttgcccccagggcccgcagcaaggagcgcagaaacccagcctctgggccaaaccccatgttacgacctctgcctccccggccaggtctgcctgatgaacggctcaagaaactggagctgggacggggacggacctcaggccctcgtcccagaggcccccttcgagcagatcatggggttcccctgcctggctcaccacccccaacagtggctttgcctctcccatctcggaccaacttagcccgttccaagtctgtgagcagtggggacttgcgtccaatggggattgccttgggagggcaccgtggcaccggagagcttggggctgcactgagccgcttggccctccggcctgagccacccactttgagacgtagcacttctctccgccgcctagggggctttcctggaccccctaccctgttcagcatacggacagagccccctgcttcccatggctccttccacatgatatccgcccggtcctctgagcctttctactctgatgacaagatggctcatcacacactccttctgggctctggtcatgttggccttcgaaacctgggaaacacgtgcttcctgaatgctgtgctgcagtgtctgagcagcactcgacctcttcgggacttctgtctgagaagggacttccggcaagaggtgcctggaggaggccgagcccaagagctcactgaagcctttgcagatgtgattggtgccctctggcaccctgactcctgcgaagctgtgaatcctactcgattccgagctgtcttccagaaatatgttccctccttctctggatacagccagcaggatgcccaagagttcctgaagctcctcatggagcggctacaccttgaaatcaaccgccgaggccgccgggctccaccgatacttgccaatggtccagttccctctccaccccgccgaggaggggctctgctagaagaacctgagttaagtgatgatgaccgagccaacctaatgtggaaacgttacctggagcgagaggacagcaagattgtggacctgtttgtgggccagttgaaaagttgtctcaagtgccaggcctgtgggtatcgctccacgaccttcgaggttttttgtgacctgtccctgcccatccccaagaaaggatttgctgggggcaaggtgtctctgcgggattgtttcaaccttttcactaaggaagaagagctagagtcggagaatgccccagtgtgtgaccgatgtcggcagaaaactcgaagtaccaaaaagttgacagtacaaagattccctcgaatcctcgtgctccatctgaatcgattttctgcctcccgaggctccatcaaaaaaagttcagtaggtgtagactttccactgcagcgactgagcctaggggactttgccagtgacaaagccggaagtcctgtataccagctgtatgccctttgcaaccactcaggcagcgtccactatggccactacacagccctgtgccggtgccagactggttggcatgtctacaatgactctcgtgtctcccctgtcagtgaaaaccaggtggcatccagcgagggctacgtgctgttctaccaactgatgcaggagccaccccggtgcctgtgacacctctaagctctggcacctgtgaagccctttaaacacccttaagccccaggctccccgtttacctcagagacgtctatttttgtgtctttttaatcggggaggggggagggggtggttgtagctccattattttttttattaaaaaatacccttccacctggaggctcccttgtctcccagccccatgtacaaagctcaccaagcccctgcccatgtacagcccccagaccctctgcaatatcactttttgtgaataaatttattaagaaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]