GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:11:35, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       NM_001008224            7081 bp    mRNA    linear   PRI 28-SEP-2019
DEFINITION  Homo sapiens uveal autoantigen with coiled-coil domains and ankyrin
            repeats (UACA), transcript variant 2, mRNA.
ACCESSION   NM_001008224
VERSION     NM_001008224.3
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 7081)
  AUTHORS   Sun B, Zhang Z, Dong C, Zhang Y, Yan C and Li S.
  CONSRTM   Medscape
  TITLE     (99)Tc(m)-octreotide scintigraphy and serum eye muscle antibodies
            in evaluation of active thyroid-associated ophthalmopathy
  JOURNAL   Eye (Lond) 31 (5), 668-676 (2017)
   PUBMED   28387769
REFERENCE   2  (bases 1 to 7081)
  AUTHORS   Lim S, Hwang S, Yu JH, Lim JW and Kim H.
  TITLE     Lycopene inhibits regulator of calcineurin 1-mediated apoptosis by
            reducing oxidative stress and down-regulating Nucling in neuronal
            cells
  JOURNAL   Mol Nutr Food Res 61 (5) (2017)
   PUBMED   27928873
  REMARK    GeneRIF: Lycopene inhibits RCAN1-mediated apoptosis by reducing ROS
            levels and by inhibiting NF-kappaB activation, Nucling induction,
            and the increase in apoptotic indices in neuronal cells.
REFERENCE   3  (bases 1 to 7081)
  AUTHORS   Dang HV, Sakai T, Pham TA, Tran DH, Yorita K, Shishido Y and Fukui
            K.
  TITLE     Nucling, a novel apoptosis-associated protein, controls mammary
            gland involution by regulating NF-kappaB and STAT3
  JOURNAL   J. Biol. Chem. 290 (40), 24626-24635 (2015)
   PUBMED   26269594
REFERENCE   4  (bases 1 to 7081)
  AUTHORS   Jung JY, Lee SR, Kim S, Chi SW, Bae KH, Park BC, Kim JH and Park
            SG.
  TITLE     Identification of novel binding partners for caspase-6 using a
            proteomic approach
  JOURNAL   J. Microbiol. Biotechnol. 24 (5), 714-718 (2014)
   PUBMED   24572280
REFERENCE   5  (bases 1 to 7081)
  AUTHORS   Gylfe AE, Katainen R, Kondelin J, Tanskanen T, Cajuso T, Hanninen
            U, Taipale J, Taipale M, Renkonen-Sinisalo L, Jarvinen H, Mecklin
            JP, Kilpivaara O, Pitkanen E, Vahteristo P, Tuupanen S, Karhu A and
            Aaltonen LA.
  TITLE     Eleven candidate susceptibility genes for common familial
            colorectal cancer
  JOURNAL   PLoS Genet. 9 (10), e1003876 (2013)
   PUBMED   24146633
REFERENCE   6  (bases 1 to 7081)
  AUTHORS   Cockman ME, Lancaster DE, Stolze IP, Hewitson KS, McDonough MA,
            Coleman ML, Coles CH, Yu X, Hay RT, Ley SC, Pugh CW, Oldham NJ,
            Masson N, Schofield CJ and Ratcliffe PJ.
  TITLE     Posttranslational hydroxylation of ankyrin repeats in IkappaB
            proteins by the hypoxia-inducible factor (HIF) asparaginyl
            hydroxylase, factor inhibiting HIF (FIH)
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 103 (40), 14767-14772 (2006)
   PUBMED   17003112
REFERENCE   7  (bases 1 to 7081)
  AUTHORS   Sakai T, Liu L, Teng X, Mukai-Sakai R, Shimada H, Kaji R, Mitani T,
            Matsumoto M, Toida K, Ishimura K, Shishido Y, Mak TW and Fukui K.
  TITLE     Nucling recruits Apaf-1/pro-caspase-9 complex for the induction of
            stress-induced apoptosis
  JOURNAL   J. Biol. Chem. 279 (39), 41131-41140 (2004)
   PUBMED   15271982
REFERENCE   8  (bases 1 to 7081)
  AUTHORS   Ohkura T, Taniguchi S, Yamada K, Nishio N, Okamura T, Yoshida A,
            Kamijou K, Fukata S, Kuma K, Inoue Y, Hisatome I, Senju S,
            Nishimura Y and Shigemasa C.
  TITLE     Detection of the novel autoantibody (anti-UACA antibody) in
            patients with Graves' disease
  JOURNAL   Biochem. Biophys. Res. Commun. 321 (2), 432-440 (2004)
   PUBMED   15358194
  REMARK    GeneRIF: UACA is a novel candidate for eye muscle autoantigens in
            thyroid-associated ophthalmopathy
REFERENCE   9  (bases 1 to 7081)
  AUTHORS   Beausoleil SA, Jedrychowski M, Schwartz D, Elias JE, Villen J, Li
            J, Cohn MA, Cantley LC and Gygi SP.
  TITLE     Large-scale characterization of HeLa cell nuclear phosphoproteins
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 101 (33), 12130-12135 (2004)
   PUBMED   15302935
REFERENCE   10 (bases 1 to 7081)
  AUTHORS   Yamada K, Senju S, Nakatsura T, Murata Y, Ishihara M, Nakamura S,
            Ohno S, Negi A and Nishimura Y.
  TITLE     Identification of a novel autoantigen UACA in patients with
            panuveitis
  JOURNAL   Biochem. Biophys. Res. Commun. 280 (4), 1169-1176 (2001)
   PUBMED   11162650
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AK055435.1, AF322916.1,
            BC016881.1, AB046781.2, BM693348.1, AC087699.11 and BU736944.1.
            On May 31, 2019 this sequence version replaced NM_001008224.2.
            
            Summary: This gene encodes a protein that contains ankyrin repeats
            and coiled coil domains and likely plays a role in apoptosis.
            Studies in rodents have implicated the encoded protein in the
            stimulation of apoptosis and the regulation of mammary gland
            involution, in which the mammary gland returns to its pre-pregnant
            state. This protein has also been proposed to negatively regulate
            apoptosis based on experiments in human cell lines in which the
            protein was shown to interact with PRKC apoptosis WT1 regulator
            protein, also known as PAR-4, and inhibit translocation of the
            PAR-4 receptor. Autoantibodies to this protein have been identified
            in human patients with panuveitis and Graves' disease. Differential
            expression of this gene has been observed in various human cancers.
            [provided by RefSeq, May 2017].
            
            Transcript Variant: This variant (2) has a longer and alternate 5'
            exon, as compared to variant 1. The encoded isoform 2 has a shorter
            and distinct N-terminus, as compared to isoform 1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR1660803.189561.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMEA1965299, SAMEA1966682
                                           [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-480               AK055435.1         27-506
            481-744             AF322916.1         202-465
            745-2268            BC016881.1         733-2256
            2269-3282           AB046781.2         1941-2954
            3283-3558           BM693348.1         212-487
            3559-4701           AB046781.2         3231-4373
            4702-6518           AC087699.11        115182-116998       c
            6519-7081           BU736944.1         17-579              c
FEATURES             Location/Qualifiers
     source          1..7081
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="15"
                     /map="15q23"
     gene            1..7081
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /note="uveal autoantigen with coiled-coil domains and
                     ankyrin repeats"
                     /db_xref="GeneID:55075"
                     /db_xref="HGNC:HGNC:15947"
                     /db_xref="MIM:612516"
     exon            1..406
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       4
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:560092105"
     variation       11
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:189361047"
     variation       18
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1216230481"
     variation       26
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1278331056"
     variation       27
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1387562758"
     variation       30
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1015862492"
     variation       32
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1282754267"
     variation       35
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:894281015"
     variation       36
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1192993865"
     variation       42
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78719631"
     variation       43
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1476697726"
     variation       47
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:896402069"
     variation       53
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1394960362"
     variation       54
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1433580754"
     variation       65
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1173644973"
     variation       67
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1054928315"
     variation       80
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1398578103"
     variation       87
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1317434969"
     variation       89
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1326770336"
     variation       92
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:561238655"
     variation       96
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:897923282"
     variation       100..108
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ataga"
                     /replace="atagataga"
                     /db_xref="dbSNP:1159901663"
     variation       103
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1370084029"
     variation       107
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235117739"
     variation       114
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043151221"
     variation       115
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1348872392"
     variation       120
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1036757818"
     variation       138..143
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aa"
                     /replace="aatcaa"
                     /db_xref="dbSNP:1285170122"
     variation       141
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1204743724"
     variation       142
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1432621984"
     variation       144
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1449120724"
     variation       147
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:942064783"
     variation       154
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:544595715"
     variation       155
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:762157451"
     variation       163
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1252930687"
     variation       171
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1195664560"
     variation       172
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:913290626"
     variation       176
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1050699375"
     variation       179
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:575744691"
     variation       180
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1157663250"
     variation       186
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1247790444"
     variation       187
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1385163950"
     variation       191
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1458629150"
     variation       203
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:932227820"
     variation       205
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:558941038"
     variation       206
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:545426594"
     variation       216
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1325659587"
     variation       217
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:559640362"
     variation       232
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:7166535"
     variation       241
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1261774809"
     variation       250
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1210068804"
     variation       254
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:943754162"
     variation       274
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1334090860"
     variation       284
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1309861820"
     variation       287
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1280144763"
     variation       288
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1234555285"
     variation       294
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1238358234"
     variation       302
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187362390"
     variation       308
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:924410636"
     variation       312..314
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1295090690"
     variation       313..318
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ttgtaa"
                     /replace="ttgtaattgtaa"
                     /db_xref="dbSNP:755392570"
     variation       317
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1430690620"
     variation       322..323
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:757709855"
     variation       329
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:985704370"
     variation       339
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:6494889"
     variation       340
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754934045"
     variation       341
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1173540123"
     variation       344
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751631770"
     variation       347
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1425301683"
     variation       350
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1185831147"
     variation       355
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:968391163"
     misc_feature    356..358
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /note="upstream in-frame stop codon"
     variation       357..359
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:973742643"
     variation       357
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566983462"
     variation       363
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1265046314"
     variation       365
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759478904"
     CDS             368..4579
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /note="isoform 2 is encoded by transcript variant 2;
                     nuclear membrane binding protein"
                     /codon_start=1
                     /product="uveal autoantigen with coiled-coil domains and
                     ankyrin repeats isoform 2"
                     /protein_id="NP_001008225.1"
                     /db_xref="CCDS:CCDS32280.1"
                     /db_xref="GeneID:55075"
                     /db_xref="HGNC:HGNC:15947"
                     /db_xref="MIM:612516"
                     /translation="
MMNCWFSCTPKNRHAADWNKYDDRLMKAAERGDVEKVTSILAKKGVNPGKLDVEGRSVFHVVTSKGNLECLNAILIHGVDITTSDTAGRNALHLAAKYGHALCLQKLLQYNCPTEHADLQGRTALHDAAMADCPSSIQLLCDHGASVNAKDVDGRTPLVLATQMSRPTICQLLIDRGADVNSRDKQNRTALMLGCEYGCRDAVEVLIKNGADISLLDALGHDSSYYARIGDNLDILTLLKTASENTNKGRELWKKGPSLQQRNLTHMQDEVNVKSHQREHQNIQDLEIENEDLKERLRKIQQEQRILLDKVNGLQLQLNEEVMVADDLESEREKLKSLLAAKEKQHEESLRTIEALKNRFKYFESDHLGSGSHFSNRKEDMLLKQGQMYMADSQCTSPGIPAHMQSRSMLRPLELSLPSQTSYSENEILKKELEAMRTFCESAKQDRLKLQNELAHKVAECKALALECERVKEDSDEQIKQLEDALKDVQKRMYESEGKVKQMQTHFLALKEHLTSEAASGNHRLTEELKDQLKDLKVKYEGASAEVGKLRNQIKQNEMIVEEFKRDEGKLIEENKRLQKELSMCEMEREKKGRKVTEMEGQAKELSAKLALSIPAEKFENMKSSLSNEVNEKAKKLVEMEREHEKSLSEIRQLKRELENVKAKLAQHVKPEEHEQVKSRLEQKSGELGKKITELTLKNQTLQKEIEKVYLDNKLLKEQAHNLTIEMKNHYVPLKVSEDMKKSHDAIIDDLNRKLLDVTQKYTEKKLEMEKLLLENDSLSKDVSRLETVFVPPEKHEKEIIALKSNIVELKKQLSELKKKCGEDQEKIHALTSENTNLKKMMSNQYVPVKTHEEVKMTLNDTLAKTNRELLDVKKKFEDINQEFVKIKDKNEILKRNLENTQNQIKAEYISLAEHEAKMSSLSQSMRKVQDSNAEILANYRKGQEEIVTLHAEIKAQKKELDTIQECIKVKYAPIVSFEECERKFKATEKELKDQLSEQTQKYSVSEEEVKKNKQENDKLKKEIFTLQKDLRDKTVLIEKSHEMERALSRKTDELNKQLKDLSQKYTEVKNVKEKLVEENAKQTSEILAVQNLLQKQHVPLEQVEALKKSLNGTIENLKEELKSMQRCYEKEQQTVTKLHQLLENQKNSSVPLAEHLQIKEAFEKEVGIIKASLREKEEESQNKMEEVSKLQSEVQNTKQALKKLETREVVDLSKYKATKSDLETQISSLNEKLANLNRKYEEVCEEVLHAKKKEISAKDEKELLHFSIEQEIKDQKERCDKSLTTITELQRRIQESAKQIEAKDNKITELLNDVERLKQALNGLSQLTYTSGNPTKRQSQLIDTLQHQVKSLEQQLADADRQHQEVIAIYRTHLLSAAQGHMDEDVQEALLQIIQMRQGLVC"
     misc_feature    440..787
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /note="ankyrin repeats; ankyrin repeats mediate
                     protein-protein interactions in very diverse families of
                     proteins. The number of ANK repeats in a protein can range
                     from 2 to over 20 (ankyrins, for example). ANK repeats may
                     occur in combinations with other...; Region: ANK; cd00204"
                     /db_xref="CDD:238125"
     misc_feature    440..703
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:289560"
     misc_feature    440..523
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    527..622
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    620..988
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /note="ankyrin repeats; ankyrin repeats mediate
                     protein-protein interactions in very diverse families of
                     proteins. The number of ANK repeats in a protein can range
                     from 2 to over 20 (ankyrins, for example). ANK repeats may
                     occur in combinations with other...; Region: ANK; cd00204"
                     /db_xref="CDD:238125"
     misc_feature    629..721
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    641..919
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:289560"
     misc_feature    728..820
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    order(731..733,743..748,755..763,767..772,782..784,
                     791..793,818..820,824..826,830..832,842..847,854..862,
                     866..871,881..883,890..892,917..919,923..925,929..931,
                     941..946,953..961,965..970,980..982,989..991,1016..1018)
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /note="oligomer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:293786"
     misc_feature    824..919
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    923..1018
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    926..1084
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /note="Ankyrin repeats (many copies); Region: Ank_4;
                     pfam13637"
                     /db_xref="CDD:290365"
     misc_feature    2216..4234
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /note="helix-rich Mycoplasma protein; Region:
                     Mplasa_alph_rch; TIGR04523"
                     /db_xref="CDD:275316"
     variation       368
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:574170281"
     variation       370
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:961432796"
     variation       375
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758600414"
     variation       381
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:554275956"
     variation       392
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:991327201"
     variation       395
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377652255"
     variation       396
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1279481667"
     variation       397
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:766688614"
     variation       397
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762180988"
     variation       400
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:149177978"
     variation       405
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764552354"
     variation       406
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1389728917"
     exon            407..540
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       411
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1414726662"
     variation       414
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:764388081"
     variation       416
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190479083"
     variation       419
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753147635"
     variation       424
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1396214654"
     variation       425..427
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1199799532"
     variation       429
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:765854482"
     variation       433
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:762535864"
     variation       434
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772919419"
     variation       436
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1322713585"
     variation       437
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1292585112"
     variation       438
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760320320"
     variation       439
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764948976"
     variation       440
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145243489"
     variation       441..446
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tga"
                     /replace="tgatga"
                     /db_xref="dbSNP:1386137188"
     variation       444
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200107284"
     variation       445
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772580072"
     variation       448
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1349844862"
     variation       450
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1388399048"
     variation       454
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144251833"
     variation       459..464
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gggggg"
                     /replace="ggggggg"
                     /db_xref="dbSNP:1566981928"
     variation       459
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1458175472"
     variation       460
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:886332937"
     variation       461
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746900667"
     variation       463
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775304983"
     variation       464
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772108083"
     variation       465
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139520381"
     variation       467
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:949681789"
     variation       469
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779006069"
     variation       475
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:908676712"
     variation       479
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:982980262"
     variation       480
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:950429441"
     variation       481
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:4776525"
     variation       485
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:576352018"
     variation       487
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:549224209"
     variation       492
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1201845955"
     variation       494
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1488993066"
     variation       496
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756445577"
     variation       498
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764828191"
     variation       500
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1355491607"
     variation       501
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377680103"
     variation       502
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755579260"
     variation       503
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371918252"
     variation       504
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1303262408"
     variation       507
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764865567"
     variation       509
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1339574450"
     variation       510
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:757762436"
     variation       513
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1163448229"
     variation       514
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1398383857"
     variation       519
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1362621562"
     variation       520
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1305757864"
     variation       525
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762625258"
     variation       529
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1442593483"
     variation       539
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244928153"
     exon            541..629
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       541
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1304730821"
     variation       546
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749452750"
     variation       548
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199674938"
     variation       550
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1353578741"
     variation       551
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1169187149"
     variation       556
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756422766"
     variation       560
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748426431"
     variation       562..565
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:1170387613"
     variation       563
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1001647122"
     variation       564
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1186379110"
     variation       565
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1440397734"
     variation       566
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1257660840"
     variation       569
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1200466441"
     variation       574
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144740902"
     variation       582
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755496829"
     variation       584
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752147626"
     variation       587
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199557627"
     variation       594
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1372106995"
     variation       596
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756845017"
     variation       598
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372824577"
     variation       602
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763651305"
     variation       604
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760416879"
     variation       606
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143934745"
     variation       608
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368204874"
     variation       609
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139963947"
     variation       612
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1290089484"
     variation       614
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467685570"
     variation       615
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774284055"
     variation       624
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1163111259"
     variation       625
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770909619"
     variation       627
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1369779891"
     exon            630..694
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       634
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197933688"
     variation       641
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752397778"
     variation       644
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1292288824"
     variation       649
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767241211"
     variation       651
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759312731"
     variation       652
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:575121985"
     variation       654
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766269411"
     variation       658
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762994459"
     variation       663
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776691128"
     variation       664
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1038668421"
     variation       666
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773114002"
     variation       667
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769951675"
     variation       670
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:969352633"
     variation       673
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761876986"
     variation       674
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1304200216"
     variation       675
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777009991"
     variation       680
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358169206"
     variation       681
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1160109907"
     variation       684
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:769060788"
     variation       689
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1272656817"
     variation       690
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747374334"
     variation       692
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1482752531"
     variation       693
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170715310"
     exon            695..752
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       697
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370445328"
     variation       698
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775635325"
     variation       699
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61741208"
     variation       700
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1425559828"
     variation       708
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373663999"
     variation       710
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750381521"
     variation       712
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765177088"
     variation       713
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1179110010"
     variation       714
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1386906367"
     variation       719
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370021264"
     variation       721
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776918046"
     variation       723
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764380928"
     variation       724
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1328660098"
     variation       725
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761029311"
     variation       726
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:974703083"
     variation       727
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775949594"
     variation       728
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772488174"
     variation       731
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746300849"
     variation       738
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:952266634"
     variation       739
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1370534833"
     variation       740
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375703457"
     variation       743
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1282084972"
     variation       745
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771406773"
     variation       746
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747622571"
     variation       751
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:559637926"
     variation       752
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150678830"
     exon            753..823
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       755
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537637071"
     variation       756
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:568890167"
     variation       756
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1253227195"
     variation       758
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1178317282"
     variation       759
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1013155635"
     variation       768
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:980202429"
     variation       769
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201525940"
     variation       772
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566976158"
     variation       775
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771692697"
     variation       776
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745645569"
     variation       778
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200529188"
     variation       779
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141940448"
     variation       782
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1247226009"
     variation       794
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757214469"
     variation       795
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753859325"
     variation       798
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148128872"
     variation       802
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1307576177"
     variation       805..808
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tg"
                     /replace="tgtg"
                     /db_xref="dbSNP:748824469"
     variation       813
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1317718258"
     variation       815
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1199625101"
     variation       816
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:577583531"
     variation       821
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767747054"
     variation       823
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751899551"
     exon            824..930
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       826
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:575135370"
     variation       827
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:955058992"
     variation       828
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1191038243"
     variation       830
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756160531"
     variation       831
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1027916003"
     variation       834
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:996559283"
     variation       835
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:888097908"
     variation       843
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1264885939"
     variation       850
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1048075076"
     variation       852
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774044627"
     variation       856
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199643973"
     variation       859
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276134047"
     variation       863
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1278582950"
     variation       865
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752798754"
     variation       868
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:781150235"
     variation       870
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1296581984"
     variation       871
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1395484392"
     variation       872
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201050468"
     variation       874
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147378902"
     variation       875
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1470619919"
     variation       876
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766710720"
     variation       877
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:763293792"
     variation       881
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1463864174"
     variation       881
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="ta"
                     /db_xref="dbSNP:376160405"
     variation       886
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373236592"
     variation       887
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1378097878"
     variation       889
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139165884"
     variation       890
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1287172841"
     variation       891
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1421512462"
     variation       892
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765706515"
     variation       896
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762356912"
     variation       900
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775017793"
     variation       901
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759163989"
     variation       903
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:773860365"
     variation       904
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142735122"
     variation       914
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749060432"
     variation       919
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138672950"
     variation       920
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1314396533"
     variation       921
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:947475803"
     variation       923
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769801962"
     variation       924
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1453478751"
     variation       926
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283260161"
     variation       928
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:928634952"
     exon            931..1112
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       932
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1376651877"
     variation       937
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762717061"
     variation       938
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1405222421"
     variation       940
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145754980"
     variation       941
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149120122"
     variation       943
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1225994798"
     variation       944
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748057752"
     variation       946
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1196944776"
     variation       952
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746059009"
     variation       953
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368611824"
     variation       957
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:938177378"
     variation       958
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1483419222"
     variation       973
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1202142485"
     variation       974
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:755443569"
     variation       974
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747032491"
     variation       976
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1282320019"
     variation       980
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780161131"
     variation       982
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1351944623"
     variation       984
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:758567740"
     variation       985..986
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:747345977"
     variation       985
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1222017133"
     variation       988
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:138086966"
     variation       989
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1193950322"
     variation       994
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1392326783"
     variation       995
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199497578"
     variation       998
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:536787451"
     variation       1002
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754294636"
     variation       1005
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764476030"
     variation       1008
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756692970"
     variation       1014
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:549811052"
     variation       1020
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766014158"
     variation       1021
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762624989"
     variation       1027
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1157362356"
     variation       1029
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773009171"
     variation       1031
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384841660"
     variation       1036
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:933395435"
     variation       1041
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1475247322"
     variation       1042
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1240582913"
     variation       1044
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764995653"
     variation       1045
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761511146"
     variation       1046
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776532990"
     variation       1052
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768459344"
     variation       1053
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760688895"
     variation       1057
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1164741404"
     variation       1061
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1320626526"
     variation       1062
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775508502"
     variation       1063
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1218411195"
     variation       1064
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772144245"
     variation       1069
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1271590081"
     variation       1073
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746033972"
     variation       1075
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:567529933"
     variation       1080
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1366671651"
     variation       1082
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771223179"
     variation       1086
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1438272750"
     variation       1089
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201109696"
     variation       1091
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1470949991"
     variation       1093
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150361297"
     variation       1094
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:988228657"
     variation       1095
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778220594"
     variation       1096
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756537761"
     variation       1101
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1258930295"
     variation       1104
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1349863148"
     variation       1106
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753257290"
     variation       1107
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:975711700"
     exon            1113..1150
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       1114..1119
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gagaga"
                     /replace="gagagaga"
                     /db_xref="dbSNP:1024431721"
     variation       1114
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770205119"
     variation       1122
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:988124378"
     variation       1123
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:143150748"
     variation       1124
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748578187"
     variation       1129
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1244247162"
     variation       1136
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144905097"
     variation       1139
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:755585403"
     variation       1141
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1479849974"
     variation       1148
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1235019364"
     exon            1151..1219
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       1151
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148156777"
     variation       1152
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777479598"
     variation       1159
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1288295243"
     variation       1160
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373823406"
     variation       1161
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370959404"
     variation       1163
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767328670"
     variation       1169
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1480298310"
     variation       1171
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:754838700"
     variation       1173
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1201123710"
     variation       1175
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:995393187"
     variation       1185
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1478172484"
     variation       1193
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1260622295"
     variation       1194
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1202800502"
     variation       1195
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146712252"
     variation       1204
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766284405"
     variation       1210
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1203011477"
     variation       1211
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763082528"
     variation       1217
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1264845374"
     variation       1219
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1223900439"
     exon            1220..1327
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       1221
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1463261843"
     variation       1223
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:775760805"
     variation       1225
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1162316349"
     variation       1231
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772579838"
     variation       1243
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759989049"
     variation       1249..1254
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="agag"
                     /replace="agagag"
                     /db_xref="dbSNP:1248226204"
     variation       1250
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184179132"
     variation       1251
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772639630"
     variation       1261
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769302585"
     variation       1268
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1295344316"
     variation       1271..1279
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="caagaacaa"
                     /replace="caagaacaagaacaa"
                     /db_xref="dbSNP:1275644276"
     variation       1271
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747714236"
     variation       1274
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1397224882"
     variation       1278..1280
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1198423691"
     variation       1281
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780818072"
     variation       1284
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1357417941"
     variation       1289
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:979060947"
     variation       1298
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145715387"
     variation       1300
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61746369"
     variation       1301
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1566970715"
     variation       1302
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61746365"
     variation       1305..1306
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="gt"
                     /db_xref="dbSNP:752630677"
     variation       1305
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376789292"
     variation       1316
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758317449"
     variation       1319
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1302182766"
     variation       1322
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:750333142"
     exon            1328..1360
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       1328
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1402782957"
     variation       1334
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:759364060"
     variation       1334
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1052686418"
     variation       1335
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761281162"
     variation       1341
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1290454831"
     variation       1342
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776166541"
     variation       1348
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200302709"
     variation       1349
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:768303511"
     variation       1350
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1382637908"
     variation       1355
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142271497"
     variation       1356
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779831779"
     variation       1357
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369346643"
     variation       1358
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306315355"
     variation       1359
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745719709"
     exon            1361..1459
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       1367
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867191492"
     variation       1371
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1361173843"
     variation       1372
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760318791"
     variation       1377
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1383103981"
     variation       1385
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372300506"
     variation       1387
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565517215"
     variation       1399
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1475113537"
     variation       1404
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771828314"
     variation       1405
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1319431733"
     variation       1407
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:745631620"
     variation       1412
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1465694321"
     variation       1413
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1243090307"
     variation       1415
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774340258"
     variation       1421
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314345049"
     variation       1424
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770945768"
     variation       1425
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749239182"
     variation       1430
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184375610"
     variation       1436..1440
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaaaa"
                     /replace="aaaaaa"
                     /db_xref="dbSNP:1566969951"
     variation       1440
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1418353952"
     variation       1441
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61741196"
     variation       1442
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1566969944"
     variation       1443
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748323152"
     exon            1460..1496
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       1479
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774221009"
     variation       1481
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1405278410"
     variation       1490
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1325480584"
     variation       1491
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1228442003"
     variation       1495
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770861703"
     variation       1496
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749149499"
     exon            1497..1549
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       1501
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:945191881"
     variation       1504
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:773108087"
     variation       1505
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1465988518"
     variation       1506
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1174815224"
     variation       1508
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:553785289"
     variation       1509
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761839722"
     variation       1514
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:913701457"
     variation       1517..1522
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aa"
                     /replace="aaacaa"
                     /db_xref="dbSNP:1297344563"
     variation       1517..1519
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:1428444297"
     variation       1518
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:976029823"
     variation       1525
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1266308167"
     variation       1526
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776507272"
     variation       1533
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768738122"
     variation       1535
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150049035"
     variation       1539
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112415946"
     variation       1545..1548
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ca"
                     /replace="caca"
                     /db_xref="dbSNP:1566967325"
     variation       1545
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:574725954"
     variation       1547
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772324074"
     exon            1550..4288
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       1551
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1202844390"
     variation       1553
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776619025"
     variation       1557
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768648048"
     variation       1560
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1235618053"
     variation       1563
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:760715088"
     variation       1572
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775600260"
     variation       1577
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1283869153"
     variation       1594
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139369634"
     variation       1602
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746136094"
     variation       1606
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1321769231"
     variation       1607
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:774515740"
     variation       1609
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771310964"
     variation       1611..1651
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tatctttacccagtcaaacgtcatactctgaaaatgaaatt"
                     /replace="tatctttacccagtcaaacgtcatactctgaaaatgaaattatcttta
                     cccagtcaaacgtcatactctgaaaatgaaatt"
                     /db_xref="dbSNP:750095912"
     variation       1612
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749680290"
     variation       1617
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147499743"
     variation       1620
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:897579140"
     variation       1623
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200591121"
     variation       1629
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142769157"
     variation       1630
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:570402849"
     variation       1634
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757920252"
     variation       1642
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1455895333"
     variation       1651
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1182860391"
     variation       1654..1662
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaaga"
                     /replace="aaagaaaga"
                     /db_xref="dbSNP:1200815816"
     variation       1655
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1157224002"
     variation       1658
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1379997134"
     variation       1662
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750101761"
     variation       1663
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1386536409"
     variation       1666
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1483733617"
     variation       1669
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764857714"
     variation       1670
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226323671"
     variation       1671
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1344354609"
     variation       1675
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299016704"
     variation       1676
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757072272"
     variation       1677
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753673926"
     variation       1683
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1322532596"
     variation       1685
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:551986241"
     variation       1693
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1236304709"
     variation       1701
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1001451916"
     variation       1702
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:78821209"
     variation       1705
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:537236890"
     variation       1706
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369379599"
     variation       1707
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:571781334"
     variation       1710
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1370575616"
     variation       1714
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1162858778"
     variation       1715
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566966234"
     variation       1716
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1471807664"
     variation       1717
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1370103425"
     variation       1722
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566966222"
     variation       1724
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1209298850"
     variation       1724
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188053967"
     variation       1725
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1253935608"
     variation       1731
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147152893"
     variation       1733
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1469993608"
     variation       1741
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771094058"
     variation       1748
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1250115960"
     variation       1751
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:931827501"
     variation       1752
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867253624"
     variation       1754
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749637765"
     variation       1758
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1420006408"
     variation       1761
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191011342"
     variation       1762
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375893173"
     variation       1776
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748668041"
     variation       1778
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539534982"
     variation       1781
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757914518"
     variation       1783
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1163578023"
     variation       1784
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1246027586"
     variation       1786
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1335497796"
     variation       1788
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:923147961"
     variation       1789
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1052494407"
     variation       1794
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745438939"
     variation       1799
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778596630"
     variation       1802
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1372485796"
     variation       1806
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403071720"
     variation       1807
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:538327129"
     variation       1811
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1308811624"
     variation       1819
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1040186718"
     variation       1825..1828
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:764913324"
     variation       1828
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1338495342"
     variation       1829
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1426982968"
     variation       1830
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:935486637"
     variation       1831
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:372813692"
     variation       1833
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274030713"
     variation       1840
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200898543"
     variation       1841
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753584998"
     variation       1846
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:571464088"
     variation       1848
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755982027"
     variation       1852
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1473730350"
     variation       1853
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252790170"
     variation       1856
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1198301540"
     variation       1858
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:566572244"
     variation       1859
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1292671501"
     variation       1864
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767418284"
     variation       1876
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1337290879"
     variation       1878
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1350415570"
     variation       1881
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1266700509"
     variation       1884
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1230606808"
     variation       1894
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1481218749"
     variation       1903
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759626819"
     variation       1906
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774338996"
     variation       1914
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766571413"
     variation       1915
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1332269324"
     variation       1916
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147142448"
     variation       1917
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381510765"
     variation       1919
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1386348273"
     variation       1921
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773643136"
     variation       1925
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1457548131"
     variation       1926
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769242051"
     variation       1927
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762325166"
     variation       1930
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777192081"
     variation       1935
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368193973"
     variation       1938
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769084461"
     variation       1945
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745363839"
     variation       1946
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1167864673"
     variation       1946
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374373516"
     variation       1949
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1353434609"
     variation       1951
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188217497"
     variation       1956
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1566965906"
     variation       1957
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748949025"
     variation       1958
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:946732138"
     variation       1964
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1211011324"
     variation       1965
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1266089926"
     variation       1967
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:973029319"
     variation       1968
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:941670591"
     variation       1976
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777490563"
     variation       1978
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:916827234"
     variation       1979
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375230873"
     variation       1980
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:370993832"
     variation       1982
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755896148"
     variation       1984
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1262141192"
     variation       1986
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752525197"
     variation       1987
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141625629"
     variation       1994
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754891956"
     variation       1995
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566965837"
     variation       1998..2003
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="cag"
                     /replace="cagcag"
                     /db_xref="dbSNP:1312173141"
     variation       1999
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226035123"
     variation       2014
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1035144433"
     variation       2016
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:751617518"
     variation       2022
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1322418730"
     variation       2023
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:766372312"
     variation       2027
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1277583685"
     variation       2031
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308156923"
     variation       2037
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1405011603"
     variation       2041
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:972902015"
     variation       2046..2051
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tag"
                     /replace="tagtag"
                     /db_xref="dbSNP:761259954"
     variation       2054
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765082684"
     variation       2055
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1241524280"
     variation       2055
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:983130163"
     variation       2056
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763209812"
     variation       2066..2070
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ga"
                     /replace="gatga"
                     /db_xref="dbSNP:1483236528"
     variation       2068
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1014700431"
     variation       2075
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:750659290"
     variation       2077
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765623117"
     variation       2078
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1260089275"
     variation       2079
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762237342"
     variation       2083
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776911245"
     variation       2091
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542712606"
     variation       2096
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1566965737"
     variation       2096
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1428584780"
     variation       2097
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143460657"
     variation       2098
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761120761"
     variation       2102
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1389271529"
     variation       2104
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1392493964"
     variation       2108
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1434063535"
     variation       2114..2117
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="agta"
                     /db_xref="dbSNP:776234127"
     variation       2115
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1237191959"
     variation       2117
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:530712413"
     variation       2118
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566965692"
     variation       2126
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:372319891"
     variation       2128
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1278858554"
     variation       2129
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867923886"
     variation       2132
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748859067"
     variation       2133
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761442046"
     variation       2134
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1377063029"
     variation       2136
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299751588"
     variation       2139
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777370351"
     variation       2144
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381941641"
     variation       2146..2152
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aag"
                     /replace="aagaaag"
                     /db_xref="dbSNP:752971680"
     variation       2147
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769480423"
     variation       2151
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368054323"
     variation       2157
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143605384"
     variation       2158
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762372831"
     variation       2159
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754876721"
     variation       2162
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751462507"
     variation       2163
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1171037362"
     variation       2168
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780096426"
     variation       2169
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750571401"
     variation       2172
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:765534267"
     variation       2175
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:957984005"
     variation       2176
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1440239377"
     variation       2177
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182468125"
     variation       2180
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1566965605"
     variation       2189
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237719512"
     variation       2190
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764373773"
     variation       2191
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189747910"
     variation       2193
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1276241026"
     variation       2194
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1205237913"
     variation       2199
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149316568"
     variation       2200
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:935185666"
     variation       2201
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1287603706"
     variation       2203..2212
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ttcca"
                     /replace="ttccattcca"
                     /db_xref="dbSNP:1209304699"
     variation       2205
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1051919371"
     variation       2216
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1379562256"
     variation       2230
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137905046"
     variation       2231
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1409364953"
     variation       2241
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772729423"
     variation       2242
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769394198"
     variation       2245
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:900765014"
     variation       2250
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1417619180"
     variation       2263
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777042000"
     variation       2268
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1345977854"
     variation       2269..2275
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:761196686"
     variation       2269
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144753268"
     variation       2274
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:776427691"
     variation       2276..2277
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1407455541"
     variation       2276
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:916605642"
     variation       2277
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1291808645"
     variation       2282
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768322363"
     variation       2285
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:990837009"
     variation       2286
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1181905465"
     variation       2292
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746888229"
     variation       2294
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780109504"
     variation       2296
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1182318688"
     variation       2304..2317
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aa"
                     /replace="aatcacttagtgaa"
                     /db_xref="dbSNP:776135225"
     variation       2309
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1487849376"
     variation       2310
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1244932965"
     variation       2313
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1223599749"
     variation       2323
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1267339515"
     variation       2326
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1352221163"
     variation       2327
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1226330202"
     variation       2329..2333
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aaaga"
                     /db_xref="dbSNP:1217943474"
     variation       2331
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758459810"
     variation       2335
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374297683"
     variation       2338
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779167032"
     variation       2347
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757490219"
     variation       2348
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1307499623"
     variation       2349
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1235939807"
     variation       2351
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:140635691"
     variation       2357
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:754023228"
     variation       2359
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1317092567"
     variation       2361
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764438751"
     variation       2363
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756435149"
     variation       2367
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1158956599"
     variation       2369
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753151975"
     variation       2371
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146812558"
     variation       2372
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150332740"
     variation       2373..2389
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="t"
                     /replace="tcaaaccagaggaacat"
                     /db_xref="dbSNP:1247316402"
     variation       2375
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1432106607"
     variation       2376
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764739595"
     variation       2386
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761443025"
     variation       2388
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1488797117"
     variation       2395
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776143210"
     variation       2396
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140160623"
     variation       2397..2398
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:772377977"
     variation       2403
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746758700"
     variation       2405
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1311824317"
     variation       2406
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1299359674"
     variation       2410..2413
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="agaa"
                     /db_xref="dbSNP:970273738"
     variation       2410
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:979975050"
     variation       2414
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:557645324"
     variation       2422
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775448576"
     variation       2431
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772096665"
     variation       2432
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199892116"
     variation       2433
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779081391"
     variation       2434..2441
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gaaga"
                     /replace="gaagaaga"
                     /db_xref="dbSNP:1375990005"
     variation       2434
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140936438"
     variation       2437
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:866060046"
     variation       2446
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373326012"
     variation       2449..2451
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="gtt"
                     /db_xref="dbSNP:1270870020"
     variation       2453
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777832416"
     variation       2455
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756377521"
     variation       2456
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148252688"
     variation       2459
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1274537467"
     variation       2464
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767869140"
     variation       2465
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:578213404"
     variation       2475
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566965237"
     variation       2481
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1435955969"
     variation       2484..2485
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1451108300"
     variation       2484
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:558028386"
     variation       2489
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373285275"
     variation       2493
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766938380"
     variation       2496
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761196411"
     variation       2497
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753438291"
     variation       2498
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1179954027"
     variation       2500
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763604401"
     variation       2502
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:996377083"
     variation       2503
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1212377743"
     variation       2510
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760408838"
     variation       2512
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1297526559"
     variation       2513
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1398223085"
     variation       2522
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1029042423"
     variation       2528
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1226748397"
     variation       2529
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775358941"
     variation       2530..2538
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="taac"
                     /replace="taacttaac"
                     /db_xref="dbSNP:746217937"
     variation       2534
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296811524"
     variation       2536..2540
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aa"
                     /replace="aacaa"
                     /db_xref="dbSNP:1378003575"
     variation       2537
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1409830101"
     variation       2540
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:995870019"
     variation       2546
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:79724871"
     variation       2548
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1304177552"
     variation       2550
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1434816509"
     variation       2553
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:772008800"
     variation       2556..2560
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="at"
                     /replace="attat"
                     /db_xref="dbSNP:768133711"
     variation       2559
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774430262"
     variation       2560
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142981855"
     variation       2564
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1186628370"
     variation       2565
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:566442081"
     variation       2566
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749274778"
     variation       2578
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1183755247"
     variation       2581
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1233546440"
     variation       2582
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1486042331"
     variation       2587
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374407527"
     variation       2589
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1294530834"
     variation       2591
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:777936135"
     variation       2593
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1203089850"
     variation       2597
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1344994724"
     variation       2601
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769838106"
     variation       2603
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244552166"
     variation       2604
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368722238"
     variation       2605
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1265370501"
     variation       2606
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314440584"
     variation       2607
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781449269"
     variation       2611..2617
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tgat"
                     /replace="tgatgat"
                     /db_xref="dbSNP:886129812"
     variation       2613
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:999303820"
     variation       2621
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:115305380"
     variation       2623..2625
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tag"
                     /replace="tagtag"
                     /db_xref="dbSNP:771141640"
     variation       2623
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043813141"
     variation       2626
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566965008"
     variation       2629
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751960436"
     variation       2630
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1256574910"
     variation       2632
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780402434"
     variation       2642
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143107777"
     variation       2652
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746153669"
     variation       2653
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763666095"
     variation       2654
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1475118411"
     variation       2663
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:760189268"
     variation       2665
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1475690959"
     variation       2666
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114734080"
     variation       2671
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1055504626"
     variation       2674
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767347929"
     variation       2675
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1251895617"
     variation       2676
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1209699606"
     variation       2680
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759376888"
     variation       2685
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1267670492"
     variation       2686
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774340474"
     variation       2692
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1328099333"
     variation       2704
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770730167"
     variation       2706
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762949630"
     variation       2708
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1335772850"
     variation       2711
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1322815679"
     variation       2712
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:928183718"
     variation       2714
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1037315077"
     variation       2720
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:550619844"
     variation       2721
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:530685196"
     variation       2725
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748293056"
     variation       2729
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456477947"
     variation       2730
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1411541636"
     variation       2731..2735
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tgt"
                     /replace="tgtgt"
                     /db_xref="dbSNP:749389307"
     variation       2731
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1157150095"
     variation       2732
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1226026499"
     variation       2734
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1270305251"
     variation       2737
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781361234"
     variation       2738
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747325846"
     variation       2750
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200006843"
     variation       2753
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780499099"
     variation       2757
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:140445271"
     variation       2765
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:934543893"
     variation       2766
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1212832355"
     variation       2767
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1383721061"
     variation       2769
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3743315"
     variation       2770
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779348840"
     variation       2771
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755684641"
     variation       2772
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:146530294"
     variation       2786
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144149272"
     variation       2793
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141249659"
     variation       2797
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:751243389"
     variation       2804
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766207502"
     variation       2806
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139052072"
     variation       2808
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1436953298"
     variation       2809
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150709937"
     variation       2812
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761857749"
     variation       2817
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:565495606"
     variation       2818
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1240440235"
     variation       2820
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:768826242"
     variation       2823
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866984332"
     variation       2827
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200395651"
     variation       2828
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:529227646"
     variation       2832
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772473505"
     variation       2833
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746288247"
     variation       2839
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1194746304"
     variation       2842
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1449245811"
     variation       2844
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1022511481"
     variation       2853
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1438169337"
     variation       2854
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181818682"
     variation       2855
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757891331"
     variation       2860
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1236184502"
     variation       2861
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:747617330"
     variation       2862
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113034898"
     variation       2863
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1277434255"
     variation       2874
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780849532"
     variation       2876
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543814859"
     variation       2881..2888
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gaaga"
                     /replace="gaagaaga"
                     /db_xref="dbSNP:1350165153"
     variation       2881
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751208406"
     variation       2886
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1227665151"
     variation       2887..2894
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gatgatga"
                     /replace="gatgatgatga"
                     /db_xref="dbSNP:1566964634"
     variation       2888
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1362931327"
     variation       2889
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:766011610"
     variation       2891
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376472787"
     variation       2893
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1431162816"
     variation       2894
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1327281597"
     variation       2895
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372114429"
     variation       2897
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750233015"
     variation       2900
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1412850542"
     variation       2908
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765110929"
     variation       2922
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1174334195"
     variation       2928
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:572194470"
     variation       2929
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61742861"
     variation       2934
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1055238133"
     variation       2938
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776626083"
     variation       2939
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373897961"
     variation       2940
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1236554388"
     variation       2952
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760804726"
     variation       2953
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370496255"
     variation       2962..2968
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aac"
                     /replace="aactaac"
                     /db_xref="dbSNP:1371591644"
     variation       2964
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1280498533"
     variation       2965
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1203787188"
     variation       2968
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1340023525"
     variation       2969..2973
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aga"
                     /replace="agaga"
                     /db_xref="dbSNP:777766591"
     variation       2971
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1274980061"
     variation       2973..2977
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aatta"
                     /db_xref="dbSNP:1355309424"
     variation       2977
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1304525321"
     variation       2979
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772226288"
     variation       2980
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1267931146"
     variation       2981
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1446173919"
     variation       2983
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746224315"
     variation       2986
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:756184473"
     variation       2994
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:774605454"
     variation       2995
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771493657"
     variation       2996
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:749822960"
     variation       2997
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778478573"
     variation       2999
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201529951"
     variation       3002
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754528890"
     variation       3004
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377221680"
     variation       3005
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779733419"
     variation       3007
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:940222197"
     variation       3008
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:766173619"
     variation       3011
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758008300"
     variation       3015
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750193346"
     variation       3018
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778685231"
     variation       3020
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190718928"
     variation       3028
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762576820"
     variation       3031..3035
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="agata"
                     /db_xref="dbSNP:1402710829"
     variation       3032
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753763851"
     variation       3037
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764087607"
     variation       3038
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1332224732"
     variation       3040
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:924540713"
     variation       3042
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1337270794"
     variation       3044
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1413673713"
     variation       3049..3053
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1474040206"
     variation       3049
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1465299577"
     variation       3055
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760779968"
     variation       3057
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1227885264"
     variation       3059
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752771670"
     variation       3063
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767734444"
     variation       3068
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:572636096"
     variation       3069
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186541436"
     variation       3070
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:974501075"
     variation       3076
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1463306916"
     variation       3077
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201393156"
     variation       3078
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770471453"
     variation       3079
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746477639"
     variation       3082
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750139193"
     variation       3083
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:911516443"
     variation       3085
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771689094"
     variation       3089
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745522222"
     variation       3091
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1391733409"
     variation       3094
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778595564"
     variation       3097
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:977733665"
     variation       3099
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:569081139"
     variation       3102
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1244875719"
     variation       3106
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1215364258"
     variation       3109
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1468712893"
     variation       3112
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138757062"
     variation       3113
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144820825"
     variation       3115
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761275966"
     variation       3117
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:567387793"
     variation       3125
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1315343704"
     variation       3126
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1293917832"
     variation       3127
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1011137827"
     variation       3129
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142570134"
     variation       3130
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756032048"
     variation       3139
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1301816495"
     variation       3143
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566964256"
     variation       3145
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752786283"
     variation       3153
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767504087"
     variation       3157..3158
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gg"
                     /replace="ggg"
                     /db_xref="dbSNP:1320303593"
     variation       3161
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759716420"
     variation       3166
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145177868"
     variation       3167
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766776608"
     variation       3171
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:763399066"
     variation       3175
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1481269884"
     variation       3177
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:202233435"
     variation       3179
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773727019"
     variation       3183
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1454552195"
     variation       3186
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143299796"
     variation       3188
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1206572054"
     variation       3190..3193
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1566964208"
     variation       3195
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770270564"
     variation       3197
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262673982"
     variation       3200
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1216618477"
     variation       3202
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762259073"
     variation       3203
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775015884"
     variation       3211
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771459849"
     variation       3217
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745420520"
     variation       3218
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:867743924"
     variation       3222
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199811737"
     variation       3223
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1372349789"
     variation       3224
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776238893"
     variation       3227
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186785151"
     variation       3237..3244
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="agaag"
                     /replace="agaagaag"
                     /db_xref="dbSNP:747011009"
     variation       3241
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778530154"
     variation       3242..3243
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1380852623"
     variation       3250
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149154885"
     variation       3251
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377062806"
     variation       3252
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1037005896"
     variation       3254..3262
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="acaa"
                     /replace="acaatacaa"
                     /db_xref="dbSNP:984944897"
     variation       3255
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1167760889"
     variation       3257
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777545622"
     variation       3264
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1462458974"
     variation       3266
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1229574674"
     variation       3269
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200262267"
     variation       3271
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373954045"
     variation       3273
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781233334"
     variation       3274
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1186479155"
     variation       3277
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1430033055"
     variation       3283
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:934005"
     variation       3284
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1187267933"
     variation       3285
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1483047561"
     variation       3286
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:751749504"
     variation       3287
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766651986"
     variation       3288
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1349283189"
     variation       3289
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1274496633"
     variation       3290
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565566100"
     variation       3293
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150013138"
     variation       3295
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762286800"
     variation       3301
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1003526969"
     variation       3303
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1293401872"
     variation       3305
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150396339"
     variation       3307
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1295852845"
     variation       3310
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764727706"
     variation       3311
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759030929"
     variation       3317
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1314224198"
     variation       3318
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78910436"
     variation       3321
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770500675"
     variation       3328
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1378745086"
     variation       3331..3335
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aga"
                     /replace="agaga"
                     /db_xref="dbSNP:1373504461"
     variation       3331
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1309748995"
     variation       3332
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1166029557"
     variation       3333..3340
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="agaa"
                     /replace="agaaagaa"
                     /db_xref="dbSNP:779948888"
     variation       3334
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1463337434"
     variation       3338
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1257749507"
     variation       3340
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761282559"
     variation       3341
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186538346"
     variation       3348
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423512004"
     variation       3350
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:900040152"
     variation       3351
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:892903658"
     variation       3353
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1255628584"
     variation       3355
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1190186663"
     variation       3356
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748967422"
     variation       3359
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772971250"
     variation       3364
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1393260936"
     variation       3367
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:769448570"
     variation       3369..3372
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1433847781"
     variation       3373
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201129903"
     variation       3375
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:533405767"
     variation       3376
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747020540"
     variation       3379
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780313659"
     variation       3380
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758644950"
     variation       3381
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1428916618"
     variation       3386..3395
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gaagaag"
                     /replace="gaagaagaag"
                     /db_xref="dbSNP:752051341"
     variation       3388
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750650986"
     variation       3389
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370665811"
     variation       3390
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:911653516"
     variation       3393
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377370063"
     variation       3394
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761172640"
     variation       3396
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1566963853"
     variation       3399
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1292771673"
     variation       3405
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:977702702"
     variation       3410
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:773806522"
     variation       3413
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765892818"
     variation       3420
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1475577182"
     variation       3422..3428
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aa"
                     /replace="aagttaa"
                     /db_xref="dbSNP:766568043"
     variation       3422
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363364328"
     variation       3425
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:762493874"
     variation       3427..3432
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aa"
                     /replace="aaagaa"
                     /db_xref="dbSNP:764821090"
     variation       3428..3433
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aag"
                     /replace="aagaag"
                     /db_xref="dbSNP:756877452"
     variation       3431
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772738557"
     variation       3432..3436
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ag"
                     /replace="aggag"
                     /db_xref="dbSNP:753401958"
     variation       3436
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769550419"
     variation       3443
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:763761269"
     variation       3444..3446
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1251031317"
     variation       3444
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1485902818"
     variation       3445
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1328037304"
     variation       3446
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747843231"
     variation       3448
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:564610970"
     variation       3450
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1453756158"
     variation       3453
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:923326489"
     variation       3456
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:139290693"
     variation       3460
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1427027182"
     variation       3465
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115468507"
     variation       3466
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200022948"
     variation       3469
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1396315633"
     variation       3470..3472
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aca"
                     /db_xref="dbSNP:1326328053"
     variation       3470
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346073421"
     variation       3471
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144888058"
     variation       3474
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1462217381"
     variation       3478
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1384497021"
     variation       3480
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150879212"
     variation       3497
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:746025331"
     variation       3499
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1364894691"
     variation       3501
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1193485115"
     variation       3504
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1453114233"
     variation       3506
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1255352641"
     variation       3508
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778988212"
     variation       3515
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1446110801"
     variation       3521
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757511713"
     variation       3522
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:367717515"
     variation       3524
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1350690111"
     variation       3526
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151082439"
     variation       3527
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1232074099"
     variation       3528
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:144784600"
     variation       3532..3540
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaaca"
                     /replace="aaacaaaca"
                     /db_xref="dbSNP:760248027"
     variation       3532..3533
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1434046169"
     variation       3532
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:753175278"
     variation       3534
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762440473"
     variation       3536
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:749966397"
     variation       3537..3540
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aaca"
                     /db_xref="dbSNP:776187194"
     variation       3537
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566963604"
     variation       3538
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764731158"
     variation       3543
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201495100"
     variation       3544..3547
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aa"
                     /replace="aaaa"
                     /db_xref="dbSNP:768033647"
     variation       3545..3549
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aaaga"
                     /db_xref="dbSNP:759845763"
     variation       3548
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61729919"
     variation       3551
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:981738348"
     variation       3558
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374484868"
     variation       3565
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:768549664"
     variation       3566
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760587117"
     variation       3567
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775563177"
     variation       3568
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749286770"
     variation       3570
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1447209836"
     variation       3573
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1256260967"
     variation       3575
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1208069831"
     variation       3586..3590
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aga"
                     /replace="agaga"
                     /db_xref="dbSNP:1350011472"
     variation       3587
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1462360350"
     variation       3588
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112724542"
     variation       3593
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:180946566"
     variation       3595
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1566963487"
     variation       3610
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1041165424"
     variation       3615
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772610492"
     variation       3617..3618
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1291392072"
     variation       3625
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1441900290"
     variation       3629
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:774725796"
     variation       3629
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1227412444"
     variation       3632
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779052323"
     variation       3633
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771016231"
     variation       3636
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:566466849"
     variation       3639
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1312398424"
     variation       3640
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:60600939"
     variation       3644
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1032768595"
     variation       3649
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1301398857"
     variation       3650
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143154561"
     variation       3651
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1228452639"
     variation       3652
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1042148247"
     variation       3654..3660
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaca"
                     /replace="aacaaca"
                     /db_xref="dbSNP:552400386"
     variation       3657
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1409751072"
     variation       3658
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1291910130"
     variation       3659
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998603734"
     variation       3660
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753122092"
     variation       3661
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566963385"
     variation       3662
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1169990957"
     variation       3665
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1475565207"
     variation       3666
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566963372"
     variation       3667
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:903041127"
     variation       3668
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:945027721"
     variation       3674
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781623644"
     variation       3676
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1486338070"
     variation       3682
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755483322"
     variation       3684
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777911577"
     variation       3689..3694
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /db_xref="dbSNP:1475565609"
     variation       3694
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1417486764"
     variation       3696
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1165117759"
     variation       3698
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749863215"
     variation       3699
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274916743"
     variation       3702
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764825647"
     variation       3710
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1318917370"
     variation       3713
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:753497715"
     variation       3714
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1329897637"
     variation       3717
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763904811"
     variation       3721
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139791694"
     variation       3722
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:775436524"
     variation       3728
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146031233"
     variation       3731
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759546659"
     variation       3732
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754814316"
     variation       3733
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188103753"
     variation       3734..3747
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aag"
                     /replace="aagagtatgcaaag"
                     /db_xref="dbSNP:1566963228"
     variation       3734
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:546764485"
     variation       3737
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1410839490"
     variation       3740
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749398612"
     variation       3741
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1162265176"
     variation       3742
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773413932"
     variation       3745
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770019747"
     variation       3748
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566963221"
     variation       3750
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1176101172"
     variation       3754
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:548726754"
     variation       3755
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781569828"
     variation       3760
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:559274117"
     variation       3763
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:796110323"
     variation       3765
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:989553182"
     variation       3767
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1204990567"
     variation       3770
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755393718"
     variation       3772
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747528345"
     variation       3775
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61746327"
     variation       3776
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:756787230"
     variation       3778
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753457065"
     variation       3780
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:981924422"
     variation       3788
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763779567"
     variation       3790
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1215002996"
     variation       3792
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1213927961"
     variation       3797
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150767083"
     variation       3804..3807
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1281732084"
     variation       3807
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:970579095"
     variation       3809
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752497204"
     variation       3811
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767439854"
     variation       3813
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:759294074"
     variation       3821
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1462736263"
     variation       3822
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866429673"
     variation       3824
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1157774747"
     variation       3828
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1398405690"
     variation       3832
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1219987023"
     variation       3836
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1410091794"
     variation       3842
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371543852"
     variation       3844
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1240444209"
     variation       3852
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766288503"
     variation       3858
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1250965782"
     variation       3861
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:763035452"
     variation       3862
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773286699"
     variation       3864
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:769966701"
     variation       3869
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1281421381"
     variation       3882
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748393199"
     variation       3885
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776890041"
     variation       3888
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1433219998"
     variation       3891
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769035026"
     variation       3894
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1173449925"
     variation       3895
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747398460"
     variation       3898
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780597103"
     variation       3899..3907
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gaagaa"
                     /replace="gaagaagaa"
                     /db_xref="dbSNP:749581565"
     variation       3900
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1288738264"
     variation       3904
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1026954629"
     variation       3910
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1443519032"
     variation       3911
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:550285923"
     variation       3913
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779816286"
     variation       3916
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777453408"
     variation       3917..3920
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1324173165"
     variation       3920
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346519107"
     variation       3921
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1159174060"
     variation       3922
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1434076328"
     variation       3929
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140913353"
     variation       3930
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:971565660"
     variation       3931
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1175314937"
     variation       3942
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:900068673"
     variation       3943
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1367322744"
     variation       3945
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376705053"
     variation       3946
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767111911"
     variation       3952
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754792990"
     variation       3959
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:576595433"
     variation       3965
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751329436"
     variation       3967
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766275347"
     variation       3968
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750052938"
     variation       3970
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:773412063"
     variation       3970
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1056326"
     variation       3973..3979
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:1250410682"
     variation       3974
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:761921200"
     variation       3975
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1446489704"
     variation       3979
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776830335"
     variation       3980
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:768817091"
     variation       3982
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1236977978"
     variation       3985
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1313084114"
     variation       3988
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1295306150"
     variation       3991
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761042400"
     variation       3994
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775720069"
     variation       3995
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1193343738"
     variation       3997
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147338503"
     variation       3998
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1413585528"
     variation       4001
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373580260"
     variation       4002
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1466169050"
     variation       4006
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1314585451"
     variation       4008
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1466364119"
     variation       4009..4018
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="taaa"
                     /replace="taaatataaa"
                     /db_xref="dbSNP:769915866"
     variation       4009..4010
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ta"
                     /replace="tata"
                     /db_xref="dbSNP:1372347806"
     variation       4014
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168032217"
     variation       4017
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746397117"
     variation       4022
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779609784"
     variation       4025
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1485354177"
     variation       4031
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370637648"
     variation       4032
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1256034065"
     variation       4036
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1213731967"
     variation       4040..4044
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aca"
                     /replace="acaca"
                     /db_xref="dbSNP:748199092"
     variation       4040
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:564736890"
     variation       4042
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1382398935"
     variation       4057..4059
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaa"
                     /replace="aaaa"
                     /db_xref="dbSNP:34632458"
     variation       4059
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:527950551"
     variation       4060
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998635060"
     variation       4063
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1225658987"
     variation       4067
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747723416"
     variation       4073
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:544492679"
     variation       4076
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:780844113"
     variation       4079
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1352946045"
     variation       4080
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1294587299"
     variation       4082
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754595776"
     variation       4086
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201992560"
     variation       4087
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779738218"
     variation       4089
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758240181"
     variation       4090
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373804994"
     variation       4092
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113255037"
     variation       4093
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750331586"
     variation       4097
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765225720"
     variation       4098
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1209393544"
     variation       4101
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761867692"
     variation       4102
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1415851746"
     variation       4105
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1467479016"
     variation       4116
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1213617382"
     variation       4126..4132
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gaa"
                     /replace="gaaggaa"
                     /db_xref="dbSNP:1566962706"
     variation       4126
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753877154"
     variation       4127
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1424937886"
     variation       4133
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368669913"
     variation       4134
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:899633827"
     variation       4136
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764308005"
     variation       4144
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:756942622"
     variation       4147
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:760836364"
     variation       4148
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1472074991"
     variation       4149
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772299860"
     variation       4154
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760014936"
     variation       4159
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1470269792"
     variation       4160
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143679420"
     variation       4161
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1332190606"
     variation       4165
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274550235"
     variation       4169
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369029822"
     variation       4170
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1244833921"
     variation       4180
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771581561"
     variation       4190
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747599122"
     variation       4191
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1392927393"
     variation       4199
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541103929"
     variation       4202
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201043161"
     variation       4203
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768309300"
     variation       4209
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1005420623"
     variation       4210
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1292859757"
     variation       4211
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746621471"
     variation       4213
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1165101429"
     variation       4214
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:779798678"
     variation       4215
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1318616573"
     variation       4216
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1388262388"
     variation       4217
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1363741276"
     variation       4219..4226
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aacaa"
                     /replace="aacaacaa"
                     /db_xref="dbSNP:779889058"
     variation       4221
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294985784"
     variation       4222
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1335347127"
     variation       4224
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:758185068"
     variation       4240..4247
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aagaa"
                     /replace="aagaagaa"
                     /db_xref="dbSNP:1566962581"
     variation       4241
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542436249"
     variation       4244
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369571784"
     variation       4248
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566962576"
     variation       4249
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757191526"
     variation       4252
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374854267"
     variation       4253
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1209929563"
     variation       4262
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1049036897"
     variation       4265
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1250279275"
     variation       4268
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1349257488"
     variation       4269
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764101632"
     variation       4273
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:756263317"
     variation       4274
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1182451243"
     variation       4277
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:576748008"
     variation       4281..4287
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ataa"
                     /replace="ataataa"
                     /db_xref="dbSNP:758307207"
     variation       4282
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141557783"
     variation       4283
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368078785"
     variation       4284
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766957344"
     variation       4285
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:535536215"
     exon            4289..4441
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       4291..4300
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aactg"
                     /replace="aactgaactg"
                     /db_xref="dbSNP:756996963"
     variation       4293
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1566961523"
     variation       4294
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:905956365"
     variation       4302
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200132897"
     variation       4304
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:763416581"
     variation       4306
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773588553"
     variation       4310
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765832322"
     variation       4316
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760047960"
     variation       4318
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774984644"
     variation       4325
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138988448"
     variation       4329
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566961470"
     variation       4331
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256719926"
     variation       4334
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547776848"
     variation       4335
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146910380"
     variation       4336
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78551559"
     variation       4338
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368965063"
     variation       4344
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1450309405"
     variation       4345
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:535745285"
     variation       4348
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:151042907"
     variation       4350
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1480459583"
     variation       4354
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1002044207"
     variation       4356
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781446308"
     variation       4363
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:941084181"
     variation       4377
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1341282473"
     variation       4381
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755161566"
     variation       4386
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375621948"
     variation       4388
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150030349"
     variation       4391
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780491610"
     variation       4392
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1403447526"
     variation       4395
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758676774"
     variation       4400
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393892269"
     variation       4401..4404
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ct"
                     /replace="ctct"
                     /db_xref="dbSNP:1323109898"
     variation       4401
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:753600540"
     variation       4401
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750815316"
     variation       4403
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765597280"
     variation       4404
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762411725"
     variation       4406
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1234255488"
     variation       4411
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1473759839"
     variation       4414
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237936259"
     variation       4415
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752153370"
     variation       4417
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1435797405"
     variation       4422
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140236740"
     variation       4429
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759083805"
     variation       4431
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:933684841"
     variation       4437
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1240379077"
     variation       4437
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1272673604"
     variation       4438
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773984259"
     variation       4441
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:151171457"
     exon            4442..4507
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       4442
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747020730"
     variation       4448..4456
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gacag"
                     /replace="gacagacag"
                     /db_xref="dbSNP:1398918298"
     variation       4449
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780214940"
     variation       4453
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746078546"
     variation       4454
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:868344716"
     variation       4460
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779043438"
     variation       4463
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1159044303"
     variation       4464
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1485299506"
     variation       4470
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1453514839"
     variation       4475
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1394712701"
     variation       4481
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757610547"
     variation       4482
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749706162"
     variation       4484
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201974563"
     variation       4492
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756615583"
     variation       4496
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1487612749"
     variation       4501
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751024908"
     variation       4505
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1420514544"
     exon            4508..7081
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /inference="alignment:Splign:2.1.0"
     variation       4509
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1157456909"
     variation       4512
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1304407458"
     variation       4514
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368378898"
     variation       4515
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:554198379"
     variation       4516
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1359978954"
     variation       4519
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377324710"
     variation       4523
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1170318180"
     variation       4529
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:865836657"
     variation       4530
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1162603788"
     variation       4534
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:978196574"
     variation       4541
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:954400470"
     variation       4549
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1044554760"
     variation       4550
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143220817"
     variation       4559
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139824373"
     variation       4560
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773466932"
     variation       4563
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770143078"
     variation       4565
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111540102"
     variation       4567
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1483747316"
     variation       4568
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748522787"
     variation       4569
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1196440176"
     variation       4570..4575
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tgtgtg"
                     /replace="tgtgtgtg"
                     /db_xref="dbSNP:1227042530"
     variation       4571..4576
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="gtgtgc"
                     /db_xref="dbSNP:866156067"
     variation       4571
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769048146"
     variation       4573..4576
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="gtgc"
                     /db_xref="dbSNP:752210788"
     variation       4573
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:745343823"
     variation       4574
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373249241"
     variation       4575
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756874021"
     variation       4576
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145929072"
     variation       4580
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1396531642"
     variation       4581
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755923541"
     variation       4582
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141286633"
     variation       4585
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201158136"
     variation       4588
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:886388966"
     variation       4593
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200933895"
     variation       4596
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772199061"
     variation       4598
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1457417587"
     variation       4602
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200343329"
     variation       4603
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766418592"
     variation       4606
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763090198"
     variation       4609
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:906520715"
     variation       4610
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773413779"
     variation       4617
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1384502490"
     variation       4618
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376522425"
     variation       4623
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1238358762"
     variation       4624
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1212536917"
     variation       4625
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:941268056"
     variation       4628
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762170475"
     variation       4644
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:985303826"
     variation       4645
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:948180091"
     variation       4647
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:561472467"
     variation       4648
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:544263104"
     variation       4659
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1356549977"
     variation       4678
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:922431606"
     variation       4683
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1445902886"
     variation       4692
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1261285164"
     variation       4693
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1314505135"
     variation       4697
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1384151695"
     variation       4703
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1248828953"
     variation       4707
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:916623904"
     variation       4710
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:988859145"
     variation       4711..4719
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tttttttt"
                     /replace="ttttttttt"
                     /replace="tttttttttt"
                     /db_xref="dbSNP:367590847"
     variation       4716
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1194818555"
     variation       4719
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:956123043"
     variation       4720
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:575622216"
     variation       4732
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1000221049"
     variation       4733
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763484127"
     variation       4739
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:954557874"
     variation       4745
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1474955160"
     variation       4750
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:922978083"
     variation       4754
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:974792883"
     variation       4755
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:556089663"
     variation       4756
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:964461730"
     variation       4760
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:970323383"
     variation       4767
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1016012066"
     variation       4768
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1023675426"
     variation       4776
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773639790"
     variation       4778..4779
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="aca"
                     /db_xref="dbSNP:1226047297"
     variation       4778
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:895934625"
     variation       4783..4784
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1326425807"
     variation       4794
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1228574756"
     variation       4804
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1047894097"
     variation       4806
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:558550431"
     variation       4807
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:74021812"
     variation       4808
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1261892840"
     variation       4814
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1461385830"
     variation       4821
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1205075102"
     variation       4830
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1400418401"
     variation       4837
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1259574288"
     variation       4841
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1446402935"
     variation       4846
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:896931954"
     variation       4857
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1037985884"
     variation       4861
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534898579"
     variation       4866
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:889707263"
     variation       4867
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:148246069"
     variation       4875
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:933929633"
     variation       4879
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175986018"
     variation       4884
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:553102743"
     variation       4889
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:536896734"
     variation       4891
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748422160"
     variation       4892
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1421809840"
     variation       4911
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:926056836"
     variation       4913
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978777572"
     variation       4927
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1042924019"
     variation       4932
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1566956467"
     variation       4939
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1414459417"
     variation       4946
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1344027659"
     variation       4949
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:933608609"
     variation       4952
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1323906137"
     variation       4958
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:566255230"
     variation       4959
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1258489352"
     variation       4965
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1173039014"
     variation       4968
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:970505722"
     variation       4985
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1205680984"
     variation       5004
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1022970717"
     variation       5018
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1478363779"
     variation       5021
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:993456430"
     variation       5022
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:574441205"
     variation       5027..5059
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gta"
                     /replace="gtaacttggctggccaagttacatgttacagta"
                     /db_xref="dbSNP:1194776576"
     variation       5035
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:960297404"
     variation       5037
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:554685403"
     variation       5038
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:537424706"
     variation       5053
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481569720"
     variation       5054
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1179689840"
     variation       5057
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363329341"
     variation       5058
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:144173426"
     variation       5065
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1364311896"
     variation       5075
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1424414765"
     variation       5077
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1304178735"
     variation       5078
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1345730540"
     variation       5079
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1456042311"
     variation       5080..5081
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1304186348"
     variation       5082
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:552641520"
     variation       5088..5090
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="t"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1239611021"
     variation       5095..5100
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ttttt"
                     /replace="tttttt"
                     /db_xref="dbSNP:1288061433"
     variation       5104
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:950419321"
     variation       5106
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1005303314"
     variation       5110
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1026165493"
     variation       5111
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1003079503"
     variation       5113
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1194298789"
     variation       5113
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182158874"
     variation       5121..5125
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:1566956366"
     variation       5129
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1419730587"
     variation       5136..5144
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="cttttatgc"
                     /db_xref="dbSNP:1444618777"
     variation       5136
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1184152687"
     variation       5141
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1023297488"
     variation       5149
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1049417283"
     variation       5158..5160
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tt"
                     /replace="ttt"
                     /db_xref="dbSNP:1367886537"
     variation       5159
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1012242924"
     variation       5166
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868861603"
     variation       5171
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1459062768"
     variation       5176
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1296108844"
     variation       5181
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1395399866"
     variation       5182
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1391459558"
     variation       5193
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:566777165"
     variation       5206
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1310876154"
     variation       5212
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1053828160"
     variation       5212
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:191192670"
     variation       5237
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1315395497"
     variation       5238
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:529932553"
     variation       5246
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1052926971"
     variation       5248
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:934515852"
     variation       5252
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1042564517"
     variation       5259
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197610915"
     variation       5267
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1446166632"
     variation       5280
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1398137618"
     variation       5282
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1241388071"
     variation       5283
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1333629485"
     variation       5284
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:561204039"
     variation       5285
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1387408783"
     variation       5292
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1427097038"
     variation       5295
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2217180"
     variation       5299
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1170271752"
     variation       5302
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1390276297"
     variation       5304
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1161882710"
     variation       5310
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186433966"
     variation       5319
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1403269110"
     variation       5329
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1369585188"
     variation       5330
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1039675411"
     variation       5331
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1181658926"
     variation       5341
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1337294398"
     variation       5347
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:113849152"
     variation       5348
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:756112019"
     variation       5356
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1239400548"
     variation       5363
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:908888891"
     variation       5364
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:984432070"
     variation       5365
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1198725509"
     variation       5374..5378
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aatta"
                     /replace="aattaaatta"
                     /db_xref="dbSNP:1467797221"
     variation       5385
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149532510"
     variation       5389
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1211457851"
     variation       5390
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1204455271"
     variation       5394
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1356738621"
     variation       5395
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138733397"
     variation       5396
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:992864819"
     variation       5403
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262904710"
     variation       5406
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1428671960"
     variation       5412
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172387132"
     variation       5420
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426836032"
     variation       5429
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:960266201"
     variation       5443
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1278907159"
     variation       5451
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1176569306"
     variation       5458
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1360800689"
     variation       5462
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1428583446"
     variation       5474
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:971636391"
     variation       5481
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1022905256"
     variation       5488..5490
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aca"
                     /db_xref="dbSNP:1362409814"
     variation       5497
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1237790718"
     variation       5499
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758601952"
     variation       5502
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1402019838"
     variation       5510..5511
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="at"
                     /db_xref="dbSNP:1323179205"
     variation       5510
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:991353434"
     variation       5521
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1026555875"
     variation       5524
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1896430"
     variation       5545
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:963474823"
     variation       5550
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1032326108"
     variation       5557
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1215709830"
     variation       5558
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1447585662"
     variation       5565
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489467274"
     variation       5568..5576
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ac"
                     /replace="acagtaaac"
                     /db_xref="dbSNP:1266285437"
     variation       5573
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1000784435"
     variation       5576
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566956161"
     variation       5579..5581
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="aaa"
                     /db_xref="dbSNP:1021453371"
     variation       5580
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:902606299"
     variation       5582
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1426707858"
     variation       5585
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1398814767"
     variation       5586
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1016440644"
     variation       5589
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1321787319"
     variation       5603..5611
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ataa"
                     /replace="ataacataa"
                     /db_xref="dbSNP:1345777426"
     variation       5607
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181691919"
     variation       5610
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1391837361"
     variation       5612
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:889561353"
     variation       5615
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1301106578"
     variation       5619..5629
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tgtttatagta"
                     /replace="tgtttatagtatttactgtttatagta"
                     /db_xref="dbSNP:1405814502"
     variation       5619
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1345097521"
     variation       5640
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:901993360"
     variation       5644..5649
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aac"
                     /replace="aacaac"
                     /db_xref="dbSNP:943619219"
     variation       5648
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1028389714"
     variation       5650
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189012551"
     variation       5651
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777532110"
     variation       5652
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:901083054"
     variation       5661
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1477389956"
     variation       5670
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:928947422"
     variation       5677
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244652053"
     variation       5687
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1200489817"
     variation       5691
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:919053375"
     variation       5692..5696
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tt"
                     /replace="ttgtt"
                     /db_xref="dbSNP:1247891531"
     variation       5693
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:981582011"
     variation       5694
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1451975851"
     variation       5698..5703
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tttttt"
                     /replace="ttttttt"
                     /db_xref="dbSNP:1468147959"
     variation       5705
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:949943559"
     variation       5710..5718
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="attt"
                     /replace="attttattt"
                     /db_xref="dbSNP:1566956075"
     variation       5711..5714
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tttt"
                     /replace="ttttt"
                     /db_xref="dbSNP:1441522771"
     variation       5713
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:915743282"
     variation       5721..5726
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ca"
                     /replace="cattca"
                     /db_xref="dbSNP:1161389720"
     variation       5723
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1373479135"
     variation       5739
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1053064825"
     variation       5742
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1355831189"
     variation       5745..5749
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="t"
                     /replace="tgagt"
                     /db_xref="dbSNP:1286614193"
     variation       5755
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1353043111"
     variation       5763
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:998777235"
     variation       5770
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1241008941"
     variation       5774
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1344342739"
     variation       5776
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:574208509"
     variation       5781
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:904324587"
     variation       5782
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1042910074"
     variation       5783
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1566956042"
     variation       5789..5792
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:1379691136"
     variation       5795
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:948796091"
     variation       5798
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:557296507"
     variation       5811
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184837742"
     variation       5813
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1360638120"
     variation       5817
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:979438692"
     variation       5819
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:530090733"
     variation       5822
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1291574853"
     variation       5826
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:938720605"
     variation       5828
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1021064890"
     variation       5836
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181191060"
     variation       5837
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1363046107"
     variation       5840
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1458984409"
     variation       5841
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1181690447"
     variation       5845
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1384594406"
     variation       5850
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1473000486"
     variation       5854..5856
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:71152306"
     variation       5854
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:998020336"
     variation       5869
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:972254101"
     variation       5872
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1422376232"
     variation       5873
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1402557832"
     variation       5885
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1007697272"
     variation       5888
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:963610347"
     variation       5891
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1478189186"
     variation       5900
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384272313"
     variation       5903
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752380957"
     variation       5910
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1450598040"
     variation       5921
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566955991"
     variation       5923..5928
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ttttt"
                     /replace="tttttt"
                     /db_xref="dbSNP:34923449"
     variation       5923
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1268839781"
     variation       5927
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:888063091"
     variation       5929
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:986340483"
     variation       5930
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:953917167"
     variation       5931
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:538685435"
     variation       5933
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1028107879"
     variation       5943
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370819736"
     variation       5944
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189296104"
     variation       5945
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1240171371"
     variation       5946
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:997848877"
     variation       5951
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1209266494"
     variation       5966
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:965005725"
     variation       5972
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171674259"
     variation       5973
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:949860297"
     variation       5979
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468298638"
     variation       5983
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767361500"
     variation       5991
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403507344"
     variation       6001
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78351424"
     variation       6003
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1316632893"
     variation       6004
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:904458706"
     variation       6010..6016
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tta"
                     /replace="ttaatta"
                     /db_xref="dbSNP:1566955946"
     variation       6010
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1326221804"
     variation       6017
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376013977"
     variation       6019
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:751250766"
     variation       6022
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1342031933"
     variation       6024
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1221125788"
     variation       6030
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:546899841"
     variation       6031
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:536177816"
     variation       6039
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1202109991"
     variation       6044
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1276676362"
     variation       6059
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1043267468"
     variation       6061
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1012784561"
     variation       6062
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1346040663"
     variation       6063
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:967290732"
     variation       6066
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:913908454"
     variation       6078
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1217215300"
     variation       6082
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:549305478"
     variation       6085
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1467970680"
     variation       6093
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1342712529"
     variation       6100
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:976068926"
     variation       6106
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1299352439"
     variation       6110..6120
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="ccgggggtggt"
                     /db_xref="dbSNP:1299908588"
     variation       6111
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765849726"
     variation       6112..6116
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:1402747565"
     variation       6112
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1447856344"
     variation       6115
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:894546851"
     variation       6116
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751311781"
     variation       6123
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1331189153"
     variation       6124..6125
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="ta"
                     /db_xref="dbSNP:1234860729"
     variation       6125
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1017693258"
     variation       6126
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1349925724"
     variation       6130
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1217041774"
     variation       6133..6147
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="t"
                     /replace="taatcccagcacttt"
                     /db_xref="dbSNP:757913661"
     variation       6146
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:779863503"
     variation       6158
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1287925965"
     variation       6159
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1057176200"
     variation       6160
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:938776456"
     variation       6176
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146273253"
     variation       6187
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1036338827"
     variation       6188
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:942268077"
     variation       6193
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1440866710"
     variation       6196
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:909497079"
     variation       6199..6200
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="ta"
                     /db_xref="dbSNP:1160778073"
     variation       6201
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:550508544"
     variation       6204
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:566651092"
     variation       6206
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1292572117"
     variation       6220
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:898054161"
     variation       6221
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:565083022"
     variation       6226
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1181069400"
     variation       6231
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:551350522"
     variation       6232
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1482271067"
     variation       6240
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1375998333"
     variation       6243
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1240827808"
     variation       6245
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1311098852"
     variation       6252..6257
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tggtgg"
                     /replace="tggtggtgg"
                     /db_xref="dbSNP:1357027939"
     variation       6256
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:528502860"
     variation       6271
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1013889031"
     variation       6272..6274
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="cc"
                     /replace="ccc"
                     /db_xref="dbSNP:1266226780"
     variation       6274
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1239111573"
     variation       6282
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142443713"
     variation       6283
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:543281121"
     variation       6286
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:567189507"
     variation       6288
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:548876308"
     variation       6299
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1181064644"
     variation       6305
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189196450"
     variation       6322
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:575408468"
     variation       6325
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:558728127"
     variation       6331
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1165981253"
     variation       6333
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1368666449"
     variation       6339
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1041527447"
     variation       6340
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1165612170"
     variation       6341
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1398928142"
     variation       6342
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1447352701"
     variation       6346
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1333278391"
     variation       6347
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380541884"
     variation       6349
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:969030386"
     variation       6353
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1313184887"
     variation       6356
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1377684511"
     variation       6363..6364
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1555406629"
     variation       6365..6367
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:869092932"
     variation       6365
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1021579741"
     variation       6373
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1257436096"
     variation       6377
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1318678364"
     variation       6382
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:922509821"
     variation       6388..6406
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="aaaataaaataaaa"
                     /replace="aaaataaaataaaataaaa"
                     /replace="aaaataaaataaaataaaataaaa"
                     /db_xref="dbSNP:966069714"
     variation       6411
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1182759116"
     variation       6413
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013250202"
     variation       6418
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:894274927"
     variation       6419
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1190597893"
     variation       6428
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566955751"
     variation       6429
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1035500924"
     variation       6430
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1465659373"
     variation       6432
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002888196"
     variation       6438
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566955741"
     variation       6444
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1403754022"
     variation       6448
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1465510594"
     variation       6457
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1303141260"
     variation       6459
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:897936808"
     variation       6469
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1163874554"
     variation       6472
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380368119"
     variation       6473
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1421804026"
     variation       6477
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184289849"
     variation       6481
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1027843735"
     variation       6482
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1312086785"
     variation       6483
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1036309356"
     variation       6484
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866570959"
     variation       6487..6497
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tatttt"
                     /replace="tattttatttt"
                     /db_xref="dbSNP:993643128"
     variation       6498
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:572848245"
     variation       6505
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1261991210"
     variation       6514
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1477956173"
     variation       6524
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1024554904"
     variation       6533
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1195162097"
     variation       6534
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192296258"
     variation       6536
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:536503895"
     variation       6539
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:894130356"
     variation       6543
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1176682836"
     variation       6561
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1360888176"
     variation       6562
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1196825044"
     variation       6564
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762395038"
     variation       6568
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1055356955"
     variation       6570
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:999918758"
     variation       6571
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1252084840"
     variation       6575
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:567449909"
     variation       6579
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:976267599"
     variation       6582
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1281384153"
     variation       6597..6598
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1219949140"
     variation       6597
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1367016007"
     variation       6603
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1304046917"
     variation       6606..6607
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1320242437"
     variation       6607
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1315711389"
     variation       6611
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1292660252"
     variation       6612
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1247268113"
     variation       6613
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1488374926"
     variation       6618
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:943753105"
     variation       6619
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1244675690"
     variation       6623
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1487868942"
     variation       6628
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:924389167"
     variation       6632
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1427156278"
     variation       6638
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:533500094"
     variation       6655
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1448327718"
     variation       6656
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:968371968"
     variation       6657
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1021715104"
     variation       6664
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:991392978"
     variation       6672
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:958891501"
     variation       6679..6686
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="cttc"
                     /replace="cttccttc"
                     /db_xref="dbSNP:1437251810"
     variation       6680
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1349586868"
     variation       6686
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1292538395"
     variation       6688
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1295383125"
     variation       6691
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1035468145"
     variation       6692
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1040948848"
     variation       6696
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:944718523"
     variation       6702
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1002689646"
     variation       6709
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:528333462"
     variation       6718
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:930718120"
     variation       6720
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:920645657"
     variation       6721
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1320799311"
     variation       6722
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1378389333"
     variation       6723
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1247986088"
     variation       6724
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1456337839"
     variation       6727
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769207895"
     variation       6728
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1006721461"
     variation       6734
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:962236657"
     variation       6736
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1441312016"
     variation       6737
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1183643713"
     variation       6738
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187857141"
     variation       6740..6742
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="tta"
                     /db_xref="dbSNP:1251544571"
     variation       6740
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:993105354"
     variation       6744
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369389555"
     variation       6745
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1166920584"
     variation       6753
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1352850425"
     variation       6757
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:958921150"
     variation       6758
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1033977485"
     variation       6769
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1379811196"
     variation       6774
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1190771773"
     variation       6775
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1283999952"
     variation       6779
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1355163745"
     variation       6781
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184636639"
     variation       6782
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:932231950"
     variation       6785
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1315518394"
     variation       6787
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197536154"
     variation       6788
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:902121924"
     variation       6795..6807
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="tgg"
                     /replace="tggacaatgctgg"
                     /db_xref="dbSNP:1459050665"
     variation       6796
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1040552971"
     variation       6800
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:935522713"
     variation       6801
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775806600"
     variation       6833
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1185090750"
     variation       6836
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:28607477"
     variation       6842..6843
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1421837047"
     variation       6842
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1353688055"
     variation       6843
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1183800036"
     variation       6853
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1465138990"
     variation       6859
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:745869768"
     variation       6871
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:977133089"
     variation       6875
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1403025013"
     variation       6876
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1010509254"
     variation       6880
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1333849134"
     variation       6881
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1341461952"
     variation       6886
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1450707160"
     variation       6888
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:947137345"
     variation       6901
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1241729587"
     variation       6903..6904
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace=""
                     /replace="tg"
                     /db_xref="dbSNP:545806821"
     variation       6912
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1041248899"
     variation       6914
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:914219964"
     variation       6924
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779066785"
     variation       6927
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:958635220"
     variation       6930
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198672415"
     variation       6932
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1293953729"
     variation       6933
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442784928"
     variation       6935
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:528588448"
     variation       6938
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:981239338"
     variation       6953
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:961814928"
     variation       6958
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1014719480"
     variation       6972
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1194429299"
     variation       6974..6985
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="ttttttttttt"
                     /replace="tttttttttttt"
                     /replace="ttttttttttttt"
                     /db_xref="dbSNP:796588055"
     variation       6976
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1421607196"
     variation       6978
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:972157827"
     variation       6985
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:78174670"
     variation       6986
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:77025671"
     variation       6988
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577051296"
     variation       6999
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1296792898"
     variation       7001
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:720519"
     variation       7027
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:566033667"
     variation       7031
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1175446538"
     variation       7032
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:917439953"
     variation       7038
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1399013563"
     variation       7040
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1278208399"
     variation       7041..7045
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="t"
                     /replace="taatt"
                     /db_xref="dbSNP:1269714214"
     variation       7043
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1431723272"
     variation       7061
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1230522007"
     variation       7063
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:549118530"
     variation       7065
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566955459"
     variation       7066
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:992916521"
     variation       7075
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1345691533"
     variation       7076
                     /gene="UACA"
                     /gene_synonym="NUCLING"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1200655759"
ORIGIN      
agtgttgaggcagcaggatgcagagtgctgttcaagttttccagtggggtccctcaaagggacaactttgaaagatagctagcttccaaagaataagaaatagatagagttactgtacctgacttggggctgctcttaatcaagttctgcattgcaaggaagataatattcgagcgttatgaaggcggagaaggatcctgaagacgaagaaaatatcgttagagatccaagctaagtgtagcacagcatgtgagggactgagtcacttgtcaggagtttgtctgagagtttgctttgtgagcttacagagatttgtaacttaatgcaaagtagtttgccattagcaacaagaaactaaatcctgtctatgatgaactgttggttttcttgtactcctaagaacagacatgcagcagattggaataaatatgatgaccgattgatgaaagcagcagaaaggggggatgtagaaaaagtgacctcaatccttgctaaaaagggggtcaatccaggcaaactagatgtggaaggcagatctgtcttccatgttgtgacctcaaaggggaatcttgagtgtttgaatgccatccttatacatggagttgatattacaaccagtgacactgcagggagaaatgctcttcacctggctgctaagtatggacatgcattgtgcctacaaaaacttctacagtacaattgtcccactgagcatgcagacctgcagggaagaactgcacttcacgatgccgcaatggcagattgtccttctagcatacagctgctttgtgaccatggggcctctgtgaatgccaaagatgtagacgggcggacaccacttgttctggctactcagatgagtaggccaacaatatgtcaactgctgatagatagaggagcggatgttaattccagagacaaacaaaacagaactgccctcatgctaggttgcgaatatggttgcagagatgcagtagaagtcttaattaaaaatggtgctgatataagcttgctggatgcgcttggccatgatagttcttactatgcaagaattggtgacaatctggacattctaaccttgttgaagactgcatcggaaaataccaacaaagggagagaactttggaagaaagggccatctttgcaacagcgaaatttgacacacatgcaagatgaagtaaatgtgaagtcacatcagagggagcatcaaaatattcaggatttggagattgaaaatgaagatttgaaagagaggttgagaaaaattcagcaagaacaaagaatacttttggataaagtcaatggtttacagttacagctgaatgaggaagttatggttgctgatgatctggaaagcgagagagaaaagctgaagtcccttttggcagctaaagaaaagcaacatgaagaaagcttaaggactattgaggctctgaaaaatagatttaaatattttgagagtgatcatttaggatcaggaagtcatttcagtaaccgaaaagaagatatgcttcttaaacaaggtcagatgtatatggcagactcacagtgtacttccccaggtataccagcccatatgcaaagcagatctatgttaagacctctggaactatctttacccagtcaaacgtcatactctgaaaatgaaattttaaagaaagagttagaagcaatgcgaactttctgtgagtcagcaaaacaagaccgactgaagctccaaaatgaactggcacacaaagtggcagaatgcaaagctttagcattagaatgtgaaagggtcaaggaggattcagatgaacagataaagcaattagaagatgcattaaaagatgtgcagaagaggatgtatgagtcagaaggtaaagttaaacaaatgcagacccattttcttgcccttaaagaacacttaacaagtgaagcagcctcagggaatcacagactaaccgaggaactgaaggatcagttgaaagacttgaaagtaaaatatgaaggtgcttcagcagaagtggggaaattaagaaaccaaatcaaacaaaatgagatgatagtagaagagtttaagagggatgaaggcaagctgatagaagaaaataagcgattacagaaggaacttagtatgtgtgaaatggagcgagagaagaaaggaagaaaggtcacagagatggaaggccaggcaaaagaattgtcagcgaagttggccctttccattccagctgaaaaatttgaaaacatgaagagctcattatcaaatgaagtgaatgagaaagcaaaaaaattagtagaaatggaaagagaacatgaaaaatcacttagtgaaattagacagttaaagagagaacttgagaatgttaaggccaagcttgctcagcacgtcaaaccagaggaacatgaacaggttaagagcagattagaacagaaatcaggagaacttgggaagaagatcactgagttaacattgaaaaatcagacactacaaaaggaaattgaaaaagtttatttggataataagctcctcaaggagcaagcacataacttaacaattgaaatgaaaaatcattatgttcctttaaaagtaagtgaagacatgaaaaagtcacatgatgcaattattgatgatcttaatagaaagcttttagatgtaacacaaaaatatacagaaaagaagttggaaatggagaaattgctactggaaaatgacagcttaagtaaggatgtaagccgcctagaaactgtgtttgtacctcctgagaaacatgaaaaagagataatagctctgaaatccaatattgttgaacttaagaaacagctgtctgaacttaagaaaaaatgtggtgaagaccaggagaaaatacacgctctcacatctgaaaacactaacttgaagaagatgatgagtaatcagtatgtgccagttaaaacccatgaagaggttaaaatgacactgaatgacacgttagccaaaactaacagagaattattagatgtgaagaaaaaatttgaagatataaatcaggaatttgtaaaaataaaagataagaatgaaatattaaaaagaaacctggaaaacactcagaaccaaataaaagctgagtacatcagcctggcagagcacgaggcaaagatgagctcgctaagtcagagcatgagaaaggtgcaggatagtaatgctgaaatcttggccaactacagaaaaggccaagaagagattgtgacactgcatgccgaaattaaagcccagaagaaggagctcgacacaatacaagaatgcattaaggtaaaatacgccccaattgtcagctttgaggagtgcgagagaaaatttaaagcaacagagaaagaactaaaagaccagttatcagagcagacacaaaagtatagtgtcagtgaagaagaagtcaagaaaaacaagcaagagaatgacaagttaaagaaggagatttttacccttcagaaagatttgagagataagacagttctcattgagaagtctcatgaaatggaaagagcattaagcagaaaaacagacgagctaaacaaacagttaaaagacttgtcacagaaatacacggaagtaaagaatgtgaaagagaagctagtagaagaaaatgccaaacagacttctgagatacttgcagtgcaaaatcttttgcaaaaacaacatgttccattggaacaggttgaggctctgaaaaaatctcttaatggcacaattgaaaatctaaaggaagaactgaagagtatgcaaaggtgttacgagaaagagcagcagacagtgaccaaactgcatcaattgttggagaatcaaaagaactcttctgtacccctggcagagcatttgcagattaaagaagcatttgagaaagaagttggaatcataaaagccagcttgagagaaaaggaagaagaaagccaaaacaaaatggaagaagtctccaaacttcagtcggaggttcagaatactaaacaagcattaaaaaaattagagactagagaggtagttgacttgtctaaatataaagcaacaaaaagtgatttggagacacagatttctagcttaaatgaaaaattggccaatctgaatagaaagtatgaggaagtatgtgaggaagttttgcatgccaaaaagaaggaaatatctgcaaaagatgagaaggaattactgcatttcagcattgagcaagaaattaaggatcagaaggaacgatgtgataagtccttaacaacaatcacagagttacaaagaagaatacaagaatctgctaaacaaatagaagcaaaagataataagataactgaactgcttaatgatgtggaaagattaaaacaggcactcaatggcctttcccaactcacctacacaagtgggaaccccaccaagaggcagagccagctgattgacactctgcagcaccaagtgaaatctctggagcaacagctggccgatgctgacagacagcaccaagaagtaattgcaatttatcggacacaccttcttagtgctgcacagggtcacatggatgaagatgttcaggaggctctgctccagatcatacaaatgcggcaggggcttgtgtgctagccgttagcactgactgccagtatctgttttatcttgctggtgctgaacattctttgtgcaactccatggtctttctgggccttactgtgctggtataattaaaataaaatatattttgttctattggtaggtttttttttaaaattagatgaatatgttagtctttttcaatatcagtttgaatcttattttctgtatgtgttaattttacaaataggcaaacaacataactttgccctggattgactacatatttttaaaccttcaagtccctaataaaacatgagccatctgagtgagtccatatgaagcgaggttaggctgaaataattgcttaaagatgtctttcagagaaattaatttggttggtggccacttttaggtggatcaaaagacctttcagatcctcagaaccttgagacataatacagttgtgaggaatgtgttgtaacttggctggccaagttacatgttacagtatctttactgaggtaacttcattagtgtctttggccttttttgtaggtatagatattttttctttttacactaataacttttatgccttttaaaataaatttattttcataaatggtttgcagtgctaaattacatttagattaagaacaggcaggggtggaatatatcaggaatttataataaaattgccttaatctctacaacagtatcttaatttttacttgcggtgactattcttgccacaatattggagaataatgatagatgatatactagatttttcaaagtgtgaaaacctttagactttttttagcaattagtttgacattcgctactatagtaaccaagcactcattatatatgcatcctccaaatgtttcatgcttatttataggaaagttatattaatgagattaataatgtgaaatacagttttcctgcaaaattagcattagagaattgattttagataacagatttttaaagttttagagaaaagtacagtaatacagtaaactgaaagagtatatagatagcaataaaataacataagtggacatgtttatagtaaatactctgaagtaaacaaccgtttttattaactgcatctcattagggaaagtttatatgtcttgttattttttattaacattttatttaccattcagagtgaaaattactaatttgagtattaacaaataactgaataaatggatcattacagttaggttttctcaaattgcaaaatttgccttagcaattatctttgaacatcccgaaccagatttttaaatcccatttttgtttaatagggtaaaaataccatcaaaatgacttctcataccaaagaataagccatcatattttttcggtgttgaaacaacattgaaagtcagaattggatttgtttttaattctttatacggtttacataagcaatatctgtctctttaattattatgattaatgtcgtccttcagcatgagttctgtttcacaagttttgggccacctatttcaataaaaaataaaatataaattaaaaaagttgccgggggtggtggctcatgcctgtaatcccagcactttgggaggctgagggaggtagatcacctgaggtcagaagttcgagaccagccttaccaatatggtgaagccccatctctactaaaaatacaaaaattagccctgcatggtggcaggtgcctgtagtcccaggtactcgggaggctgagacaggagaatcgcttgaacctgggaggcggaggttgcagtgagccaagatctcgccactgcactccagcttgggcaatagcaagactccatctcaaaataaaataaaataaaacttagagcaaagtttaaaactgagtattcatattaagtgttttattttccatattagagatgggaagggaaccttatgtgtattttattttgttttcaaccatcaataaagttttctctagaatattgttttgaacatccttgtaaaagatttgcgagttaaactattttatttactgtctgtgagagcattgggagtaggaaacgatggactccaaagtacaagggagaatacccattttcattcagctatctggagtaaaatatcaagtacttccttcaactaatcttgtctcattcactcaccttttgatatcgaaggcagaaattgcgtttacaacactgaagaccaaagctttttaattagtaaacaagcggaacatagataatggacaatgctggccactgccattctgtgttcagaaagactatgagacctgaacatatggccaagaggaaagaagagtgacgttgtctaagatgtaatgagtgctctctgagagaatcactcaattcctattggagtgcaatccttacttgagaactttattactcttgttctgtgtagttttttttttttgtcacttccccatcagaaaagcatattctttttgatagagggtcagtgttataaataattgtcttttgaaataaaatcaaatattcatgcattgaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]