GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-11-26 23:45:12, GGRNA.v2 : RefSeq release 202 (Sep, 2020)

LOCUS       NM_000201               2967 bp    mRNA    linear   PRI 25-JUL-2020
DEFINITION  Homo sapiens intercellular adhesion molecule 1 (ICAM1), mRNA.
ACCESSION   NM_000201
VERSION     NM_000201.3
KEYWORDS    RefSeq; MANE Select.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2967)
  AUTHORS   Luck K, Kim DK, Lambourne L, Spirohn K, Begg BE, Bian W, Brignall
            R, Cafarelli T, Campos-Laborie FJ, Charloteaux B, Choi D, Cote AG,
            Daley M, Deimling S, Desbuleux A, Dricot A, Gebbia M, Hardy MF,
            Kishore N, Knapp JJ, Kovacs IA, Lemmens I, Mee MW, Mellor JC,
            Pollis C, Pons C, Richardson AD, Schlabach S, Teeking B, Yadav A,
            Babor M, Balcha D, Basha O, Bowman-Colin C, Chin SF, Choi SG,
            Colabella C, Coppin G, D'Amata C, De Ridder D, De Rouck S,
            Duran-Frigola M, Ennajdaoui H, Goebels F, Goehring L, Gopal A,
            Haddad G, Hatchi E, Helmy M, Jacob Y, Kassa Y, Landini S, Li R, van
            Lieshout N, MacWilliams A, Markey D, Paulson JN, Rangarajan S,
            Rasla J, Rayhan A, Rolland T, San-Miguel A, Shen Y, Sheykhkarimli
            D, Sheynkman GM, Simonovsky E, Tasan M, Tejeda A, Tropepe V,
            Twizere JC, Wang Y, Weatheritt RJ, Weile J, Xia Y, Yang X,
            Yeger-Lotem E, Zhong Q, Aloy P, Bader GD, De Las Rivas J, Gaudet S,
            Hao T, Rak J, Tavernier J, Hill DE, Vidal M, Roth FP and Calderwood
            MA.
  TITLE     A reference map of the human binary protein interactome
  JOURNAL   Nature 580 (7803), 402-408 (2020)
   PUBMED   32296183
REFERENCE   2  (bases 1 to 2967)
  AUTHORS   Regal-McDonald K, Somarathna M, Lee T, Litovsky SH, Barnes J,
            Peretik JM, Traylor JG Jr, Orr AW and Patel RP.
  TITLE     Assessment of ICAM-1 N-glycoforms in mouse and human models of
            endothelial dysfunction
  JOURNAL   PLoS ONE 15 (3), e0230358 (2020)
   PUBMED   32208424
  REMARK    GeneRIF: Study assessed the relative formation of high mannose
            (HM), hybrid and complex alpha-2,6-sialyated N-glycoforms of ICAM-1
            in human and mouse models of atherosclerosis, as well as in
            arteriovenous fistulas (AVF) of patients on hemodialysis. Data
            demonstrates that ICAM-1 harboring HM or hybrid epitopes as well as
            ICAM-1 bearing alpha-2,6-sialylated epitopes are present in human
            and mouse atherosclerotic lesions.
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 2967)
  AUTHORS   Cao XX, Yang JK and Wang L.
  TITLE     Association between intercellular adhesion molecule 1 (ICAM1)
            polymorphisms and diabetic foot susceptibility: A case-control
            study
  JOURNAL   Medicine (Baltimore) 99 (11), e18052 (2020)
   PUBMED   32176024
  REMARK    GeneRIF: association between polymorphisms and diabetic foot
            susceptibility
REFERENCE   4  (bases 1 to 2967)
  AUTHORS   Wang Y, Sun X, Xia B, Le C, Li Z, Wang J, Huang J, Wang J and Wan
            C.
  TITLE     The role of OX40L and ICAM-1 in the stability of coronary
            atherosclerotic plaques and their relationship with sudden coronary
            death
  JOURNAL   BMC Cardiovasc Disord 19 (1), 272 (2019)
   PUBMED   31783796
  REMARK    GeneRIF: The expression of OX40L and ICAM-1 proteins and mRNAs is
            positively correlated with the stability of coronary
            atherosclerotic plaque, this reduces the stability of atheromatous
            plaques and causes sudden death.
            Publication Status: Online-Only
REFERENCE   5  (bases 1 to 2967)
  AUTHORS   Rashad NM, El-Shal AS, Abomandour HG, Aboelfath AMK, Rafeek MES,
            Badr MS, Ali AE, Yousef MS, Fathy MA and Sharaf El Din MTA.
  TITLE     Intercellular adhesion molecule-1 expression and serum levels as
            markers of pre-clinical atherosclerosis in polycystic ovary
            syndrome
  JOURNAL   J Ovarian Res 12 (1), 97 (2019)
   PUBMED   31629408
  REMARK    GeneRIF: ICAM-1 expression and serum levels were higher in women
            with PCOS compared to control group also, there was a strong
            independent association between higher ICAM-1 expression and serum
            levels with cardiovascular risks in PCOS group.
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 2967)
  AUTHORS   Fawcett J, Holness CL, Needham LA, Turley H, Gatter KC, Mason DY
            and Simmons DL.
  TITLE     Molecular cloning of ICAM-3, a third ligand for LFA-1,
            constitutively expressed on resting leukocytes
  JOURNAL   Nature 360 (6403), 481-484 (1992)
   PUBMED   1448173
REFERENCE   7  (bases 1 to 2967)
  AUTHORS   Viac J, Chardonnet Y, Euvrard S and Schmitt D.
  TITLE     Epidermotropism of T cells correlates with intercellular adhesion
            molecule (ICAM1) expression in human papillomavirus (HPV)-induced
            lesions
  JOURNAL   J. Pathol. 168 (3), 301-306 (1992)
   PUBMED   1361527
REFERENCE   8  (bases 1 to 2967)
  AUTHORS   Rossler K, Neuchrist C, Kitz K, Scheiner O, Kraft D and Lassmann H.
  TITLE     Expression of leucocyte adhesion molecules at the human blood-brain
            barrier (BBB)
  JOURNAL   J. Neurosci. Res. 31 (2), 365-374 (1992)
   PUBMED   1374132
REFERENCE   9  (bases 1 to 2967)
  AUTHORS   Denkers IA, de Jong-de Boer TJ, Beelen RH, Ossenkoppele GJ and
            Langenhuijsen MM.
  TITLE     VLA molecule expression may be involved in the release of acute
            myeloid leukaemic cells from the bone marrow
  JOURNAL   Leuk. Res. 16 (5), 469-474 (1992)
   PUBMED   1625472
REFERENCE   10 (bases 1 to 2967)
  AUTHORS   Degitz K, Li LJ and Caughman SW.
  TITLE     Cloning and characterization of the 5'-transcriptional regulatory
            region of the human intercellular adhesion molecule 1 gene
  JOURNAL   J. Biol. Chem. 266 (21), 14024-14030 (1991)
   PUBMED   1677359
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from BC015969.2 and BG149901.1.
            This sequence is a reference standard in the RefSeqGene project.
            On Nov 23, 2018 this sequence version replaced NM_000201.2.
            
            Summary: This gene encodes a cell surface glycoprotein which is
            typically expressed on endothelial cells and cells of the immune
            system. It binds to integrins of type CD11a / CD18, or CD11b / CD18
            and is also exploited by Rhinovirus as a receptor. [provided by
            RefSeq, Jul 2008].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC015969.2, GQ901042.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMEA1965299, SAMEA1966682
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            MANE Ensembl match     :: ENST00000264832.8/ ENSP00000264832.2
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-2806              BC015969.2         32-2837
            2807-2967           BG149901.1         4-164               c
FEATURES             Location/Qualifiers
     source          1..2967
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="19"
                     /map="19p13.2"
     gene            1..2967
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /note="intercellular adhesion molecule 1"
                     /db_xref="GeneID:3383"
                     /db_xref="HGNC:HGNC:5344"
                     /db_xref="MIM:147840"
     exon            1..107
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /inference="alignment:Splign:2.1.0"
     variation       5
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746959311"
     variation       6
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753538053"
     variation       7
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747652035"
     variation       9
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376560799"
     variation       10
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1215680580"
     variation       11
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1258000629"
     variation       12
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:910349349"
     variation       13
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1185727452"
     variation       14
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772770898"
     variation       15
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:941851770"
     variation       19
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1037574073"
     variation       21
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:919011269"
     variation       23
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754809837"
     variation       24
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767879490"
     variation       25
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1418681394"
     variation       26
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775888638"
     variation       27
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1377668238"
     variation       28
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1433178870"
     variation       29
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761162864"
     variation       31
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1007518934"
     variation       32
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:5490"
     variation       33
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393267353"
     variation       34
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1304925739"
     variation       35
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753928021"
     variation       37
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:36086415"
     variation       38
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:569558604"
     variation       39
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750681618"
     variation       40
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1300793263"
     CDS             41..1639
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /note="intercellular adhesion molecule 1 (CD54), human
                     rhinovirus receptor; cell surface glycoprotein P3.58;
                     ICAM-1; major group rhinovirus receptor; epididymis
                     secretory sperm binding protein"
                     /codon_start=1
                     /product="intercellular adhesion molecule 1 precursor"
                     /protein_id="NP_000192.2"
                     /db_xref="CCDS:CCDS12231.1"
                     /db_xref="GeneID:3383"
                     /db_xref="HGNC:HGNC:5344"
                     /db_xref="MIM:147840"
                     /translation="
MAPSSPRPALPALLVLLGALFPGPGNAQTSVSPSKVILPRGGSVLVTCSTSCDQPKLLGIETPLPKKELLLPGNNRKVYELSNVQEDSQPMCYSNCPDGQSTAKTFLTVYWTPERVELAPLPSWQPVGKNLTLRCQVEGGAPRANLTVVLLRGEKELKREPAVGEPAEVTTTVLVRRDHHGANFSCRTELDLRPQGLELFENTSAPYQLQTFVLPATPPQLVSPRVLEVDTQGTVVCSLDGLFPVSEAQVHLALGDQRLNPTVTYGNDSFSAKASVSVTAEDEGTQRLTCAVILGNQSQETLQTVTIYSFPAPNVILTKPEVSEGTEVTVKCEAHPRAKVTLNGVPAQPLGPRAQLLLKATPEDNGRSFSCSATLEVAGQLIHKNQTRELRVLYGPRLDERDCPGNWTWPENSQQTPMCQAWGNPLPELKCLKDGTFPLPIGESVTVTRDLEGTYLCRARSTQGEVTRKVTVNVLSPRYEIVIITVVAAAVIMGTAGLSTYLYNRQRKIKKYRLQQAQKGTPMKPNTQATPP"
     sig_peptide     41..121
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     misc_feature    110..370
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /note="Intercellular adhesion molecule (ICAM), N-terminal
                     domain; Region: ICAM_N; pfam03921"
                     /db_xref="CDD:252248"
     mat_peptide     122..1636
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /product="intercellular adhesion molecule 1"
     misc_feature    377..661
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /note="Second immunoglobulin (Ig)-like domain of
                     intercellular cell adhesion molecule-1 (ICAM-1, CD54) and
                     similar proteins; Region: Ig2_ICAM-1_like; cd05755"
                     /db_xref="CDD:143232"
     misc_feature    428..430
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000269|PubMed:12526797,
                     ECO:0000269|PubMed:9539702; propagated from
                     UniProtKB/Swiss-Prot (P05362.2); glycosylation site"
     misc_feature    473..475
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /note="N-linked (GlcNAc...) (complex) asparagine.
                     /evidence=ECO:0000269|PubMed:12526797,
                     ECO:0000269|PubMed:19139490, ECO:0000269|PubMed:19349973,
                     ECO:0000269|PubMed:9539702; propagated from
                     UniProtKB/Swiss-Prot (P05362.2); glycosylation site"
     misc_feature    494..502
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /note="propagated from UniProtKB/Swiss-Prot (P05362.2);
                     Region: Cell attachment site, atypical.
                     /evidence=ECO:0000255"
     misc_feature    587..589
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000269|PubMed:12526797,
                     ECO:0000269|PubMed:9539702; propagated from
                     UniProtKB/Swiss-Prot (P05362.2); glycosylation site"
     misc_feature    644..646
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000269|PubMed:12526797,
                     ECO:0000269|PubMed:19159218, ECO:0000269|PubMed:9539702,
                     ECO:0000269|PubMed:9539703; propagated from
                     UniProtKB/Swiss-Prot (P05362.2); glycosylation site"
     misc_feature    839..841
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000269|PubMed:15099525,
                     ECO:0000269|PubMed:16335952, ECO:0000269|PubMed:19159218,
                     ECO:0000269|PubMed:19349973; propagated from
                     UniProtKB/Swiss-Prot (P05362.2); glycosylation site"
     misc_feature    926..928
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000269|PubMed:15099525; propagated from
                     UniProtKB/Swiss-Prot (P05362.2); glycosylation site"
     misc_feature    971..1201
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:325142"
     misc_feature    1193..1195
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000269|PubMed:15099525; propagated from
                     UniProtKB/Swiss-Prot (P05362.2); glycosylation site"
     misc_feature    1250..1462
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:214653"
     misc_feature    1256..1258
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (P05362.2); glycosylation site"
     misc_feature    1481..1549
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /note="propagated from UniProtKB/Swiss-Prot (P05362.2);
                     transmembrane region"
     misc_feature    1601..1603
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000244|PubMed:18669648,
                     ECO:0000244|PubMed:20068231, ECO:0000244|PubMed:23186163;
                     propagated from UniProtKB/Swiss-Prot (P05362.2);
                     phosphorylation site"
     misc_feature    1628..1630
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000244|PubMed:18669648,
                     ECO:0000244|PubMed:20068231, ECO:0000244|PubMed:24275569;
                     propagated from UniProtKB/Swiss-Prot (P05362.2);
                     phosphorylation site"
     variation       41
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1366763648"
     variation       42
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1167645849"
     variation       43
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1055973323"
     variation       44
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758212257"
     variation       45
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1255397267"
     variation       49
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752690617"
     variation       50
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779984305"
     variation       52
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754913780"
     variation       55
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1438484728"
     variation       56
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781040245"
     variation       58
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1396507988"
     variation       59
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747654731"
     variation       60
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769191023"
     variation       61
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201712599"
     variation       62
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1490803282"
     variation       68..78
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="ctgcccgcact"
                     /replace="ctgcccgcactgcccgcact"
                     /db_xref="dbSNP:1267975714"
     variation       68
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375620971"
     variation       69
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1011691226"
     variation       70
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369677298"
     variation       71
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770635391"
     variation       73
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:903248823"
     variation       74
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775798556"
     variation       75
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764608366"
     variation       77
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777039885"
     variation       81
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1599262143"
     variation       82
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1305983935"
     variation       83
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373461435"
     variation       85
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:954891297"
     variation       90
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750591481"
     variation       91
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:530490957"
     variation       92
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200158754"
     variation       96
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751378879"
     variation       97
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757898845"
     variation       98
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1017525934"
     variation       103
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754751296"
     variation       104
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456986382"
     variation       105
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1213762840"
     exon            108..371
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /inference="alignment:Splign:2.1.0"
     variation       110
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759316086"
     variation       119
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767201668"
     variation       123
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1427679145"
     variation       126
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1353647708"
     variation       129
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1227239485"
     variation       133
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41520346"
     variation       143
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1041158342"
     variation       144
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1214959993"
     variation       146
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755971015"
     variation       147
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1486174155"
     variation       154
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1211274094"
     variation       155
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137977632"
     variation       158
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747111380"
     variation       159
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756786973"
     variation       161
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778474887"
     variation       169
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745524523"
     variation       170
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771818150"
     variation       173
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1332992590"
     variation       175
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781408937"
     variation       178
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151201212"
     variation       181
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:535089993"
     variation       182
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1435027936"
     variation       184
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200156450"
     variation       187..189
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="cac"
                     /db_xref="dbSNP:750328429"
     variation       187
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:992809768"
     variation       190
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1279602610"
     variation       192
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1485425363"
     variation       195
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773878586"
     variation       197
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763087198"
     variation       199
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1284791760"
     variation       201
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200970471"
     variation       202
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:548184831"
     variation       203
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759672075"
     variation       205
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1015821647"
     variation       207
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:5491"
     variation       211
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1449920919"
     variation       217
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1239738076"
     variation       224
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1183121001"
     variation       226
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760537870"
     variation       227
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1468617162"
     variation       228
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763975382"
     variation       229
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370020996"
     variation       230
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111997581"
     variation       244
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778384721"
     variation       247
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371538999"
     variation       249
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1400032879"
     variation       253
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143731465"
     variation       254
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1329399253"
     variation       258
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374718798"
     variation       261
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369268780"
     variation       262
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372704720"
     variation       264
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1371251341"
     variation       265
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1301493446"
     variation       266
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146780348"
     variation       267
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:554091291"
     variation       271
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190348035"
     variation       272
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1196902783"
     variation       273
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774261335"
     variation       277
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1171426844"
     variation       280
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1390690093"
     variation       288
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1032707496"
     variation       289
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1374469173"
     variation       290
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746006779"
     variation       295
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198070335"
     variation       298
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1430143134"
     variation       304
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1374649868"
     variation       309
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772134103"
     variation       313
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140559142"
     variation       321
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1171324211"
     variation       323
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:914038707"
     variation       325
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760391948"
     variation       326
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1375741840"
     variation       328
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1377643578"
     variation       332
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:542476616"
     variation       334
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761737102"
     variation       336
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1036900727"
     variation       340
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1421557644"
     variation       359
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765263284"
     variation       364
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749879920"
     variation       365
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:561101249"
     variation       371
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:922664343"
     exon            372..677
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /inference="alignment:Splign:2.1.0"
     variation       372
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1171688556"
     variation       374
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1294380638"
     variation       383
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150480007"
     variation       384
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754203844"
     variation       385
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1483017643"
     variation       386
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757725637"
     variation       388
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376447346"
     variation       392
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1250014617"
     variation       394
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779217695"
     variation       396
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1207079639"
     variation       397
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1599269998"
     variation       398
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1287926004"
     variation       400
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1487155548"
     variation       401
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1192864942"
     variation       406
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1258137966"
     variation       414
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750950257"
     variation       415
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1217754543"
     variation       419
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013160528"
     variation       424
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1367570239"
     variation       432
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1204497162"
     variation       435
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454017997"
     variation       436
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:758890106"
     variation       437
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780182158"
     variation       440
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768846633"
     variation       441
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781416568"
     variation       445
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747900078"
     variation       449
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769636060"
     variation       450
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1405414298"
     variation       454
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772966530"
     variation       455
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1349831256"
     variation       456
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377028532"
     variation       457
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1192066743"
     variation       460
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770813840"
     variation       463
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1394111610"
     variation       466
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371494307"
     variation       467
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773974462"
     variation       468..470
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:753950049"
     variation       468
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373279831"
     variation       479
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1351321520"
     variation       480
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1408852700"
     variation       481
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377323164"
     variation       482
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201079272"
     variation       489
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1599270102"
     variation       490
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762022035"
     variation       491
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765617669"
     variation       494
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750824008"
     variation       495
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370720409"
     variation       502
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751590802"
     variation       503
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1378091078"
     variation       505
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:5492"
     variation       515
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375107327"
     variation       516
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361221966"
     variation       517
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200230074"
     variation       525
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:367947901"
     variation       527
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1465004002"
     variation       529..533
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="gggg"
                     /replace="ggggg"
                     /db_xref="dbSNP:1302720833"
     variation       529
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370883513"
     variation       531
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1198112599"
     variation       532
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375147918"
     variation       533
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1307423569"
     variation       538..541
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace=""
                     /replace="cgct"
                     /db_xref="dbSNP:755314571"
     variation       538
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:916037970"
     variation       539
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769975581"
     variation       540
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777593675"
     variation       542
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143328428"
     variation       543
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:749083718"
     variation       549
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770851229"
     variation       550
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774458697"
     variation       553
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1199968758"
     variation       555
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759046761"
     variation       556
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1457067982"
     variation       557
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:924525389"
     variation       559
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1407870065"
     variation       562
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1427713860"
     variation       563
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1431740611"
     variation       568
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:934593597"
     variation       572
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771716527"
     variation       575
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1051567834"
     variation       579
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139263745"
     variation       580
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1329358568"
     variation       585
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:954408067"
     variation       586
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1252713833"
     variation       588
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760374267"
     variation       594
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1441940436"
     variation       595
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146324794"
     variation       599
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1007384990"
     variation       600..644
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace=""
                     /replace="gcactgaactggacctgcggccccaagggctggagctgtttgaga"
                     /db_xref="dbSNP:779207996"
     variation       600
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766833990"
     variation       601
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1474799542"
     variation       602
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1300574941"
     variation       604
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752067478"
     variation       606
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:767572203"
     variation       607
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1255634122"
     variation       608
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1316685708"
     variation       610
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907633688"
     variation       611
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139053442"
     variation       613
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1262627242"
     variation       614
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764395911"
     variation       616
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1248094146"
     variation       617
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372112882"
     variation       618..619
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1555706282"
     variation       618
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777879275"
     variation       619
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372336"
     variation       620..623
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="ccc"
                     /replace="cccc"
                     /db_xref="dbSNP:1555706284"
     variation       620
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757120426"
     variation       627
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:137905196"
     variation       628
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745783191"
     variation       637
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772198909"
     variation       641
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1053511706"
     variation       646
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:775112898"
     variation       647
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1434090171"
     variation       651
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746554151"
     variation       652
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:887327445"
     variation       653
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373913806"
     variation       654
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:537554894"
     variation       656
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1045821147"
     variation       657
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1339364571"
     variation       660
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766744082"
     variation       664
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1011611042"
     variation       667
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760003886"
     variation       669
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1220318523"
     variation       670
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141554198"
     variation       673
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752771869"
     exon            678..965
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /inference="alignment:Splign:2.1.0"
     variation       678
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1599270516"
     variation       679
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1252476558"
     variation       686
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1441369918"
     variation       687
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747745154"
     variation       688
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774674146"
     variation       689
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1414989542"
     variation       693
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150484122"
     variation       694
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:551080822"
     variation       695
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1446643875"
     variation       696
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201414539"
     variation       699
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200325260"
     variation       701
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:760747058"
     variation       704
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1238479170"
     variation       705
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:556179599"
     variation       706
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764062779"
     variation       709..713
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="ccccc"
                     /replace="cccccc"
                     /db_xref="dbSNP:1346082757"
     variation       710
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1221439292"
     variation       713
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568295295"
     variation       714
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:754014530"
     variation       715
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371681905"
     variation       716
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1199329249"
     variation       722
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1337841278"
     variation       724
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:896099469"
     variation       725
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765607464"
     variation       727
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:572028894"
     variation       728
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139607484"
     variation       731
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1379464546"
     variation       732
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375023616"
     variation       733
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35956512"
     variation       737
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755002696"
     variation       738
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1413458415"
     variation       739
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780564025"
     variation       742
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1800019"
     variation       743
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769386131"
     variation       746
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777434435"
     variation       747
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534458967"
     variation       750
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1599270631"
     variation       753
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772332794"
     variation       754
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139333961"
     variation       756
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1182296722"
     variation       759
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:761079910"
     variation       760
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143689328"
     variation       761
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1799969"
     variation       763
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:5493"
     variation       764
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1005199205"
     variation       766
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1419281488"
     variation       767
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369391699"
     variation       772
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1203831907"
     variation       777
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765520096"
     variation       778
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750681772"
     variation       781
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244494276"
     variation       793
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:930526340"
     variation       795
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:762780304"
     variation       805
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:963043122"
     variation       811
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139628843"
     variation       812
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1599270705"
     variation       813
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142745312"
     variation       815
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754841136"
     variation       820
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1425155250"
     variation       821
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:781210616"
     variation       824
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:907641822"
     variation       826
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1169595589"
     variation       834
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:752161214"
     variation       840
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:755625816"
     variation       841
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777348143"
     variation       842
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748922559"
     variation       847
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:770679518"
     variation       849
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780248758"
     variation       850
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:34369517"
     variation       852
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747446910"
     variation       853
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200759542"
     variation       854
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1266308413"
     variation       856
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:896048798"
     variation       859
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777312140"
     variation       860
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:567512435"
     variation       861
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770010762"
     variation       862
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1490106324"
     variation       872
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:535206172"
     variation       873
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763265816"
     variation       877
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:5030381"
     variation       878
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141080585"
     variation       884
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1368501868"
     variation       885
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1000391834"
     variation       886
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:5494"
     variation       887
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113419367"
     variation       894
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294424687"
     variation       896
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1008829568"
     variation       898
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756098611"
     variation       899
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:989473316"
     variation       900
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763586600"
     variation       902
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1268444852"
     variation       903
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:964564309"
     variation       904..907
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="gacg"
                     /replace="gacggacg"
                     /db_xref="dbSNP:755973846"
     variation       906
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147925015"
     variation       907
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201771459"
     variation       911
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1342293195"
     variation       920
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1318872845"
     variation       921
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747298236"
     variation       924
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755378643"
     variation       927
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1404271908"
     variation       931
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:951954558"
     variation       933
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369906592"
     variation       936..940
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="aggag"
                     /replace="aggaggag"
                     /db_xref="dbSNP:1358537666"
     variation       946
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374364326"
     variation       949
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770489968"
     variation       951
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773397826"
     variation       952
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141801732"
     variation       953
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1285401930"
     variation       958
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771018156"
     variation       959
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424977643"
     variation       962
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1185042029"
     variation       965
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1384202081"
     exon            966..1220
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /inference="alignment:Splign:2.1.0"
     variation       971
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1401064916"
     variation       972
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772315973"
     variation       973
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146954887"
     variation       975
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768543917"
     variation       976
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199692247"
     variation       977
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764794802"
     variation       978
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1411318260"
     variation       981
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762664096"
     variation       982
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137970890"
     variation       983
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:5495"
     variation       990
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:756550665"
     variation       991
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1200145766"
     variation       993
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1235964865"
     variation       994
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374392444"
     variation       998
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1192108985"
     variation       1002
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1269866645"
     variation       1004
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754356021"
     variation       1008
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1431972317"
     variation       1009
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757771096"
     variation       1012
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368283911"
     variation       1015
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772229913"
     variation       1017
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1008944257"
     variation       1018
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376700590"
     variation       1019
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143008699"
     variation       1020
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746741810"
     variation       1027
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768455781"
     variation       1028
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146134321"
     variation       1029
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1325801458"
     variation       1032
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:964678962"
     variation       1035
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769659570"
     variation       1046
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772757657"
     variation       1047
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1285113750"
     variation       1050
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762576033"
     variation       1052
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:960494429"
     variation       1053
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1340666091"
     variation       1062
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141326678"
     variation       1063
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759319472"
     variation       1069
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:754190930"
     variation       1071
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1568295575"
     variation       1072
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757757223"
     variation       1073
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779307629"
     variation       1075
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758480023"
     variation       1076
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780195275"
     variation       1077
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747223390"
     variation       1078..1098
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace=""
                     /replace="agcccagccactgggcccgag"
                     /db_xref="dbSNP:771319016"
     variation       1078
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1599271127"
     variation       1079..1106
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="gcccagc"
                     /replace="gcccagccactgggcccgagggcccagc"
                     /db_xref="dbSNP:775039982"
     variation       1079
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768938327"
     variation       1080
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1027972658"
     variation       1081
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781009982"
     variation       1088
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1424635602"
     variation       1089
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:983667097"
     variation       1094
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1167107227"
     variation       1095
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1801714"
     variation       1096
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201383296"
     variation       1097
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1406188712"
     variation       1102
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1599271170"
     variation       1105
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:868375367"
     variation       1108
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1179338784"
     variation       1118
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1302535118"
     variation       1120
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377420632"
     variation       1122
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568295632"
     variation       1124
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770551007"
     variation       1127
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199672020"
     variation       1129
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1267923581"
     variation       1135
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:13306429"
     variation       1136
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370415118"
     variation       1138
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1568295648"
     variation       1139
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139178890"
     variation       1140
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146000551"
     variation       1141
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765707240"
     variation       1147
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139290643"
     variation       1149
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1489572878"
     variation       1155
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758965302"
     variation       1158
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1241607771"
     variation       1161
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1483579827"
     variation       1169
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766445571"
     variation       1171..1172
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1260983469"
     variation       1171
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150014298"
     variation       1173
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755206701"
     variation       1174
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1378331069"
     variation       1175
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376622574"
     variation       1176
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380629463"
     variation       1178
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755868188"
     variation       1183
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1316057000"
     variation       1185
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1036180125"
     variation       1188
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777679809"
     variation       1189..1197
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="ca"
                     /replace="caagaacca"
                     /db_xref="dbSNP:1568295687"
     variation       1195
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2071441"
     variation       1200
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1599271274"
     variation       1202..1205
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="cggg"
                     /replace="cgggcggg"
                     /db_xref="dbSNP:1161958306"
     variation       1202
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181563357"
     variation       1203
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770432918"
     variation       1207
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1244743412"
     variation       1211
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144226309"
     variation       1212
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771711919"
     variation       1213
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762182509"
     variation       1217
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1243785346"
     variation       1219
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765509208"
     exon            1221..1466
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /inference="alignment:Splign:2.1.0"
     variation       1221
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426736990"
     variation       1225
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1260217255"
     variation       1226
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773548607"
     variation       1227
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1179351488"
     variation       1229
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1386070565"
     variation       1230
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:5497"
     variation       1235
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426809883"
     variation       1237
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144924815"
     variation       1238
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201464213"
     variation       1242
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752861754"
     variation       1243
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1468830540"
     variation       1244
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760785172"
     variation       1245
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147967899"
     variation       1251
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:112301533"
     variation       1252
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753646159"
     variation       1253
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1599271465"
     variation       1254
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757120819"
     variation       1257
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368566175"
     variation       1260
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:971926313"
     variation       1261
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439224226"
     variation       1262
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1281922240"
     variation       1263
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371463487"
     variation       1264
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41276880"
     variation       1277
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:935025840"
     variation       1278
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758430171"
     variation       1282
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199931094"
     variation       1291
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1272044051"
     variation       1292
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768253249"
     variation       1300
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1224715941"
     variation       1302
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1266669206"
     variation       1305
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:905083025"
     variation       1307
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1479852844"
     variation       1309
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780857308"
     variation       1310..1311
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1392798016"
     variation       1311
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:552634203"
     variation       1312
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749591375"
     variation       1317
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568295825"
     variation       1321
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:556280231"
     variation       1322
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147723291"
     variation       1324
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1391985429"
     variation       1330
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759927316"
     variation       1336
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1301885800"
     variation       1339
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1369216765"
     variation       1345
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1180596943"
     variation       1347
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772680139"
     variation       1348..1350
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="ttt"
                     /replace="tttt"
                     /db_xref="dbSNP:768304340"
     variation       1354
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1365468249"
     variation       1355
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775378792"
     variation       1361
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1401097415"
     variation       1363
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760839324"
     variation       1364
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374722531"
     variation       1367
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:867279367"
     variation       1368
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148613735"
     variation       1371
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1285002056"
     variation       1373
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1356862171"
     variation       1376
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140768360"
     variation       1378
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765121038"
     variation       1382
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1599271567"
     variation       1385
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1490175275"
     variation       1386
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:13306430"
     variation       1387
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:527654714"
     variation       1388
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753651400"
     variation       1390
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199727082"
     variation       1399
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750997842"
     variation       1400
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1446861335"
     variation       1401
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754492552"
     variation       1406
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:780768999"
     variation       1410
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747787849"
     variation       1412
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150121537"
     variation       1413
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779121366"
     variation       1414
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746262793"
     variation       1415
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1335162508"
     variation       1420
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772418086"
     variation       1422
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1389840786"
     variation       1425
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:868512314"
     variation       1429
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:776068920"
     variation       1435
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1599271663"
     variation       1437
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1599271666"
     variation       1440
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:561258573"
     variation       1441
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768841852"
     variation       1442
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138380001"
     variation       1443
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200230807"
     variation       1444
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772834478"
     variation       1445
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:5498"
     variation       1446
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:766166027"
     variation       1447
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1181314242"
     variation       1448
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1242930269"
     variation       1451
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1599271710"
     variation       1453
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751531507"
     variation       1454
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754970121"
     variation       1457..1458
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:878945445"
     variation       1460
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1196540370"
     variation       1462
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766981270"
     variation       1463
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1453198780"
     exon            1467..2967
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /inference="alignment:Splign:2.1.0"
     variation       1467..1472
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="cccccc"
                     /replace="ccccccc"
                     /db_xref="dbSNP:1346911918"
     variation       1469
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369459423"
     variation       1470
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763594216"
     variation       1472
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:5030400"
     variation       1473
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780437504"
     variation       1474
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752020807"
     variation       1475
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1480508060"
     variation       1477
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:755494643"
     variation       1478
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781772466"
     variation       1479
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:748177379"
     variation       1480
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769933648"
     variation       1481
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777777071"
     variation       1485..1493
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="tcatca"
                     /replace="tcatcatca"
                     /replace="tcatcatcatca"
                     /db_xref="dbSNP:761539599"
     variation       1485
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749524458"
     variation       1486
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771104368"
     variation       1487
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1371198155"
     variation       1490
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:868789554"
     variation       1495..1498
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="tg"
                     /replace="tgtg"
                     /db_xref="dbSNP:750159059"
     variation       1497
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:567569815"
     variation       1498
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759353795"
     variation       1499
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187022571"
     variation       1505
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1472736379"
     variation       1508
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775418785"
     variation       1513
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1423820736"
     variation       1517
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1382968890"
     variation       1524
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763653983"
     variation       1538
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1292981351"
     variation       1539
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372389375"
     variation       1540
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199929256"
     variation       1542
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1599271948"
     variation       1548
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764821022"
     variation       1553
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142682313"
     variation       1554
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:755398718"
     variation       1555
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753247072"
     variation       1556
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1486889693"
     variation       1559
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202205823"
     variation       1560
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200510339"
     variation       1566
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:926467634"
     variation       1568
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771141539"
     variation       1572
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1229166038"
     variation       1575
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779108548"
     variation       1583
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745601470"
     variation       1584
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374275620"
     variation       1586
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1225105373"
     variation       1591
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:556127462"
     variation       1597
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1345328056"
     variation       1598
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1432261188"
     variation       1599
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1286797144"
     variation       1601
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:577755211"
     variation       1602
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1452847154"
     variation       1603
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768526637"
     variation       1604
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201409559"
     variation       1605
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1278808711"
     variation       1606
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1001130557"
     variation       1608
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1358537165"
     variation       1609
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776160824"
     variation       1614
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761261553"
     variation       1615
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1318865619"
     variation       1622
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1213697407"
     variation       1627
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1568296159"
     variation       1629
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376526495"
     variation       1630
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145990265"
     variation       1641
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373937707"
     variation       1642
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767992203"
     variation       1645
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370905432"
     variation       1646
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:764537463"
     variation       1647
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1182964353"
     variation       1648
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:956675035"
     variation       1649
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2071440"
     variation       1651
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757293534"
     variation       1652
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:945056621"
     variation       1656
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1344029659"
     variation       1659
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:202033491"
     variation       1662
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1338285601"
     variation       1665
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:779022397"
     variation       1667
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746085200"
     variation       1668
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781639267"
     variation       1669
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1437498223"
     variation       1671
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1271204133"
     variation       1675
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1354625320"
     variation       1677
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:572171111"
     variation       1679
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:966233606"
     variation       1680
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768599839"
     variation       1683
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191907942"
     variation       1695
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1453744455"
     variation       1699
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1258612765"
     variation       1716
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:976298849"
     variation       1717
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:922227712"
     variation       1718..1721
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="at"
                     /replace="atat"
                     /db_xref="dbSNP:925062782"
     variation       1718
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1343335830"
     variation       1729
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276427954"
     variation       1734
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1317242853"
     variation       1736
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746254037"
     variation       1741
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:5499"
     variation       1742
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:865800242"
     variation       1752
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372246948"
     variation       1753
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1245845891"
     variation       1755
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34797260"
     variation       1756
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:889295108"
     variation       1757
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1009447932"
     variation       1760
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1040645548"
     variation       1762
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1427655153"
     variation       1763..1764
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:898058151"
     variation       1763
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1192165222"
     variation       1768
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1469981535"
     variation       1783
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773167193"
     variation       1784
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375919922"
     variation       1789
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:749317644"
     variation       1790
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1180806499"
     variation       1798
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1458220293"
     variation       1799
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:555766239"
     variation       1801
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:565371843"
     variation       1804
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:949403598"
     variation       1835
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1280710898"
     variation       1841
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1027641826"
     variation       1849
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1183880691"
     variation       1854
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1349773474"
     variation       1859
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:183487091"
     variation       1868
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1306614586"
     variation       1875
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1044984791"
     variation       1882
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:547642698"
     variation       1887
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1442280622"
     variation       1891
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768851030"
     variation       1894
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1002288516"
     variation       1906
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1182471396"
     variation       1908
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1568296278"
     variation       1914
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361372722"
     variation       1926
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1420071702"
     variation       1928
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1000675984"
     variation       1929
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1160611328"
     variation       1930
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774302233"
     variation       1935
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1599272265"
     variation       1936
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:892177087"
     variation       1938
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1353771222"
     variation       1940
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1009280661"
     variation       1941
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1599272274"
     variation       1945
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:560202753"
     variation       1949
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1599272281"
     variation       1954
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1338992893"
     variation       1955
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1404221642"
     variation       1956
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1239131445"
     variation       1957
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:992371244"
     variation       1959
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1020846005"
     variation       1964
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1270856130"
     variation       1972..1974
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1283632878"
     variation       1983
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1019358629"
     variation       1996
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762041883"
     variation       2001
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41436648"
     variation       2012
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3093032"
     variation       2014
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1324777582"
     variation       2015
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1380780508"
     variation       2017
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:549049798"
     variation       2020..2025
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="ac"
                     /replace="acttac"
                     /db_xref="dbSNP:1303873988"
     variation       2020
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1264566997"
     variation       2024
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:774416942"
     variation       2025
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:567263651"
     variation       2026..2033
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="agaag"
                     /replace="agaagaag"
                     /db_xref="dbSNP:759672694"
     variation       2044
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1300456967"
     variation       2048
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1208737132"
     variation       2049..2050
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace=""
                     /replace="at"
                     /db_xref="dbSNP:1384807244"
     variation       2049
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1161975408"
     variation       2050
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538178533"
     variation       2056
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1344670359"
     variation       2068
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:932270986"
     variation       2074
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1182311182"
     variation       2076
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1599272381"
     variation       2077
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1475063330"
     variation       2079
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1260709967"
     variation       2082
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218495406"
     variation       2087
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:550029595"
     variation       2088
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:984935821"
     variation       2089
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:944908839"
     variation       2090
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1322928062"
     variation       2097
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1312848124"
     variation       2104
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184764833"
     variation       2112
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1016851600"
     variation       2114
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:962269406"
     variation       2120
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:972139179"
     variation       2124
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1214445910"
     variation       2134
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1040544561"
     variation       2135..2141
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="tat"
                     /replace="tatgtat"
                     /db_xref="dbSNP:1280692540"
     variation       2137
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1599272431"
     variation       2142
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751823601"
     variation       2147
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1448785671"
     variation       2160
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1291945337"
     variation       2166..2173
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="tatt"
                     /replace="tatttatt"
                     /db_xref="dbSNP:1178346816"
     variation       2167
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:929538618"
     variation       2171
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:114012606"
     variation       2173..2178
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="tg"
                     /replace="tgagtg"
                     /db_xref="dbSNP:1469483616"
     variation       2178
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1319056601"
     variation       2185
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:980781161"
     variation       2186
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:538841150"
     variation       2191
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1347097507"
     variation       2201
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1169862019"
     variation       2206
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1426867925"
     variation       2219
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:553642572"
     variation       2220
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:572208022"
     variation       2221
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1195828699"
     variation       2222
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1477991011"
     variation       2230
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:57744533"
     variation       2235
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1057981"
     variation       2238
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1267916722"
     variation       2246
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1599272500"
     variation       2249
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:892287453"
     variation       2250
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1189056363"
     variation       2252
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1489269868"
     variation       2259
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1002582178"
     variation       2260
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:945252007"
     variation       2264
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1040753085"
     variation       2269
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225671621"
     variation       2276
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1203167907"
     variation       2284
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1315598801"
     variation       2292
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1260538085"
     variation       2293
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1281777673"
     variation       2294
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1345197780"
     variation       2302
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:536344362"
     variation       2303
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:896540231"
     variation       2304
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:996441485"
     variation       2306
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1028407601"
     variation       2307
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:5500"
     variation       2310
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1297863755"
     variation       2311
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1218343448"
     variation       2313
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752735468"
     variation       2317
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1284324332"
     variation       2320
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:966637872"
     variation       2323
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:979319620"
     variation       2324
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1032185087"
     variation       2325
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147622302"
     variation       2327
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142396903"
     variation       2330
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:972253767"
     variation       2334
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370921661"
     variation       2335..2336
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1199776707"
     variation       2348..2352
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="ag"
                     /replace="agaag"
                     /db_xref="dbSNP:775825668"
     variation       2348
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1201224966"
     variation       2349
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1254817013"
     variation       2353
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565589859"
     variation       2362
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1477814689"
     variation       2366
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1159414114"
     variation       2367
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:5501"
     variation       2368
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189699084"
     variation       2369
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:936721095"
     variation       2373
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1332149179"
     variation       2374
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:56232676"
     variation       2384
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:757148179"
     variation       2390
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1401372412"
     variation       2397
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1407371261"
     variation       2413
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1301664165"
     variation       2416
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1599272619"
     variation       2418..2429
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="cc"
                     /replace="cccagtgaggcc"
                     /db_xref="dbSNP:1345334995"
     variation       2431
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1467376569"
     variation       2438
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1378004535"
     variation       2443..2448
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="ccccc"
                     /replace="cccccc"
                     /db_xref="dbSNP:1568296488"
     variation       2443
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:913844981"
     variation       2446
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:945201130"
     variation       2447
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1157608133"
     variation       2448
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1437469632"
     variation       2457
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1049350192"
     variation       2460
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:778430951"
     variation       2464
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:541617413"
     variation       2466
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:559985501"
     variation       2477
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1568296498"
     variation       2482
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1483743384"
     variation       2483
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1055517767"
     variation       2488
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1452399224"
     variation       2489
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1040872250"
     variation       2490
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:896598301"
     variation       2495
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1568296507"
     variation       2508
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:900889886"
     variation       2512
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:527426214"
     variation       2513
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1338834413"
     variation       2516
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1599272687"
     variation       2519
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:5030383"
     variation       2520
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781019174"
     variation       2525
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:888106540"
     variation       2527
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1297378664"
     variation       2535
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746201101"
     variation       2543
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:560897676"
     variation       2554
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1016914074"
     variation       2556
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1266480859"
     variation       2562
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1362036126"
     variation       2565
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:954078848"
     variation       2568
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1450861262"
     variation       2571
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:898092517"
     variation       2572
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:993641831"
     variation       2574
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1234767726"
     variation       2576
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1025150564"
     variation       2599
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:970768705"
     variation       2606
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1568296533"
     variation       2617
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1599272753"
     variation       2627
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756593692"
     variation       2634
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1356229033"
     variation       2638
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1263160286"
     variation       2648
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1214863697"
     variation       2649
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1158121273"
     variation       2654
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1386002511"
     variation       2656
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:993620348"
     variation       2662
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182320132"
     variation       2664
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:549475580"
     variation       2707..2716
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace=""
                     /replace="cgcgtgtgtg"
                     /db_xref="dbSNP:753787897"
     variation       2707..2710
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="cgcg"
                     /replace="cgcgcg"
                     /db_xref="dbSNP:371214190"
     variation       2707
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1033809615"
     variation       2708
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:571525273"
     variation       2708
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="gtg"
                     /db_xref="dbSNP:965199947"
     variation       2709
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:867951773"
     variation       2710..2725
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="gtgtgt"
                     /replace="gtgtgtgtgt"
                     /replace="gtgtgtgtgtgt"
                     /replace="gtgtgtgtgtgtgt"
                     /replace="gtgtgtgtgtgtgtgt"
                     /replace="gtgtgtgtgtgtgtgtgt"
                     /replace="gtgtgtgtgtgtgtgtgtgt"
                     /replace="gtgtgtgtgtgtgtgtgtgtgt"
                     /db_xref="dbSNP:rs74178250"
     variation       2710
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:913793761"
     variation       2711
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1390686363"
     variation       2711
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:966618575"
     variation       2712
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="ggg"
                     /db_xref="dbSNP:1458004125"
     variation       2714
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1331303663"
     variation       2715
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1337089837"
     variation       2716
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:976518170"
     variation       2717..2731
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="tgtgt"
                     /replace="tgtgtgtgtatgtgt"
                     /db_xref="dbSNP:779818608"
     variation       2717
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="t"
                     /replace="ttt"
                     /db_xref="dbSNP:1555706669"
     variation       2718
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="ggg"
                     /db_xref="dbSNP:780743534"
     variation       2719
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:922430279"
     variation       2720
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:55942114"
     variation       2720
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:869070115"
     variation       2721..2732
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="tgtgtatgtgta"
                     /replace="tgtgtatgtgtatgtgta"
                     /db_xref="dbSNP:1478973588"
     variation       2725..2727
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="tat"
                     /replace="tatat"
                     /db_xref="dbSNP:1055170971"
     variation       2726
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1382947816"
     variation       2728
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:932523899"
     variation       2737
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1049924297"
     variation       2739
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1292351947"
     variation       2741
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1210479968"
     variation       2742
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1317447293"
     variation       2743
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749740172"
     variation       2747
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34031043"
     variation       2748..2750
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="t"
                     /replace="tgt"
                     /db_xref="dbSNP:1342095245"
     variation       2752
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1278629056"
     variation       2755
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1435557527"
     variation       2769
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1328962096"
     variation       2776
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1036717843"
     variation       2777
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:902581259"
     variation       2782
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1386829880"
     variation       2784
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:898040296"
     variation       2786
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:993758145"
     variation       2800
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274938772"
     variation       2801
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1054012635"
     variation       2802
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:56148554"
     variation       2807..2809
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="agt"
                     /replace="ggc"
                     /db_xref="dbSNP:386806770"
     variation       2807
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:281436"
     variation       2808
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1172338515"
     variation       2809
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114170067"
     variation       2812
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1568296660"
     variation       2818
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1019490192"
     variation       2819
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199926520"
     variation       2823
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1457331377"
     variation       2824
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1236442974"
     variation       2825
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1599272950"
     variation       2827
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1196622232"
     variation       2828
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1319882390"
     variation       2832
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1446483523"
     variation       2833
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772252286"
     variation       2842
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:993806378"
     variation       2843
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1342679723"
     variation       2844
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1276194013"
     variation       2845
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1436754488"
     variation       2846
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1599272985"
     variation       2847
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1368345605"
     variation       2849
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1476028083"
     variation       2850
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1170001103"
     variation       2857
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187878298"
     variation       2859..2862
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="ca"
                     /replace="caca"
                     /db_xref="dbSNP:1025419024"
     variation       2864
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1401623116"
     variation       2865
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1599273010"
     variation       2868
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1599273023"
     variation       2870
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1599273030"
     variation       2871
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1034168487"
     variation       2875
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1394852582"
     variation       2876
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:958164295"
     variation       2877..2879
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:869265627"
     variation       2877
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1011303314"
     variation       2879
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:554589882"
     variation       2883
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1020916592"
     variation       2884
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:74404713"
     variation       2885..2898
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="ttttttttttt"
                     /replace="tttttttttttt"
                     /replace="ttttttttttttt"
                     /replace="tttttttttttttt"
                     /replace="ttttttttttttttt"
                     /replace="tttttttttttttttt"
                     /db_xref="dbSNP:rs769960199"
     variation       2887..2888
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1380843883"
     variation       2888
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1233372335"
     variation       2896
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1209349972"
     variation       2897..2899
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace=""
                     /replace="ttc"
                     /db_xref="dbSNP:1555706697"
     variation       2898..2899
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace=""
                     /replace="tc"
                     /db_xref="dbSNP:1330310529"
     variation       2898
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:397843877"
     variation       2899..2900
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1568296721"
     variation       2899..2900
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:34295061"
     variation       2899
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:923366"
     variation       2900
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1306684473"
     variation       2901
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1312293670"
     variation       2904
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1339801342"
     variation       2906
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75407602"
     variation       2907..2910
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="ggg"
                     /replace="gggg"
                     /db_xref="dbSNP:1568296730"
     variation       2907
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:959528728"
     variation       2908
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1446472737"
     variation       2909
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:56368048"
     variation       2914
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:281437"
     variation       2915
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:532295462"
     variation       2919
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1419520152"
     variation       2921
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1599273135"
     variation       2923
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:922544837"
     variation       2924
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1160737932"
     variation       2936
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1440331214"
     variation       2937
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:949404160"
     variation       2938
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1181169472"
     variation       2940
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1042350027"
     variation       2943
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:924054986"
     variation       2946..2947
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace=""
                     /replace="ta"
                     /db_xref="dbSNP:1599273162"
     variation       2953
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1336477264"
     variation       2957
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1599273176"
     variation       2962
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1211296350"
     variation       2966
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:765082471"
     variation       2967
                     /gene="ICAM1"
                     /gene_synonym="BB2; CD54; P3.58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775151322"
ORIGIN      
gagctcctctgctactcagagttgcaacctcagcctcgctatggctcccagcagcccccggcccgcgctgcccgcactcctggtcctgctcggggctctgttcccaggacctggcaatgcccagacatctgtgtccccctcaaaagtcatcctgccccggggaggctccgtgctggtgacatgcagcacctcctgtgaccagcccaagttgttgggcatagagaccccgttgcctaaaaaggagttgctcctgcctgggaacaaccggaaggtgtatgaactgagcaatgtgcaagaagatagccaaccaatgtgctattcaaactgccctgatgggcagtcaacagctaaaaccttcctcaccgtgtactggactccagaacgggtggaactggcacccctcccctcttggcagccagtgggcaagaaccttaccctacgctgccaggtggagggtggggcaccccgggccaacctcaccgtggtgctgctccgtggggagaaggagctgaaacgggagccagctgtgggggagcccgctgaggtcacgaccacggtgctggtgaggagagatcaccatggagccaatttctcgtgccgcactgaactggacctgcggccccaagggctggagctgtttgagaacacctcggccccctaccagctccagacctttgtcctgccagcgactcccccacaacttgtcagcccccgggtcctagaggtggacacgcaggggaccgtggtctgttccctggacgggctgttcccagtctcggaggcccaggtccacctggcactgggggaccagaggttgaaccccacagtcacctatggcaacgactccttctcggccaaggcctcagtcagtgtgaccgcagaggacgagggcacccagcggctgacgtgtgcagtaatactggggaaccagagccaggagacactgcagacagtgaccatctacagctttccggcgcccaacgtgattctgacgaagccagaggtctcagaagggaccgaggtgacagtgaagtgtgaggcccaccctagagccaaggtgacgctgaatggggttccagcccagccactgggcccgagggcccagctcctgctgaaggccaccccagaggacaacgggcgcagcttctcctgctctgcaaccctggaggtggccggccagcttatacacaagaaccagacccgggagcttcgtgtcctgtatggcccccgactggacgagagggattgtccgggaaactggacgtggccagaaaattcccagcagactccaatgtgccaggcttgggggaacccattgcccgagctcaagtgtctaaaggatggcactttcccactgcccatcggggaatcagtgactgtcactcgagatcttgagggcacctacctctgtcgggccaggagcactcaaggggaggtcacccgcaaggtgaccgtgaatgtgctctccccccggtatgagattgtcatcatcactgtggtagcagccgcagtcataatgggcactgcaggcctcagcacgtacctctataaccgccagcggaagatcaagaaatacagactacaacaggcccaaaaagggacccccatgaaaccgaacacacaagccacgcctccctgaacctatcccgggacagggcctcttcctcggccttcccatattggtggcagtggtgccacactgaacagagtggaagacatatgccatgcagctacacctaccggccctgggacgccggaggacagggcattgtcctcagtcagatacaacagcatttggggccatggtacctgcacacctaaaacactaggccacgcatctgatctgtagtcacatgactaagccaagaggaaggagcaagactcaagacatgattgatggatgttaaagtctagcctgatgagaggggaagtggtgggggagacatagccccaccatgaggacatacaactgggaaatactgaaacttgctgcctattgggtatgctgaggccccacagacttacagaagaagtggccctccatagacatgtgtagcatcaaaacacaaaggcccacacttcctgacggatgccagcttgggcactgctgtctactgaccccaacccttgatgatatgtatttattcatttgttattttaccagctatttattgagtgtcttttatgtaggctaaatgaacataggtctctggcctcacggagctcccagtcctaatcacattcaaggtcaccaggtacagttgtacaggttgtacactgcaggagagtgcctggcaaaaagatcaaatggggctgggacttctcattggccaacctgcctttccccagaaggagtgatttttctatcggcacaaaagcactatatggactggtaatggttacaggttcagagattacccagtgaggccttattcctcccttccccccaaaactgacacctttgttagccacctccccacccacatacatttctgccagtgttcacaatgacactcagcggtcatgtctggacatgagtgcccagggaatatgcccaagctatgccttgtcctcttgtcctgtttgcatttcactgggagcttgcactatgcagctccagtttcctgcagtgatcagggtcctgcaagcagtggggaagggggccaaggtattggaggactccctcccagctttggaagcctcatccgcgtgtgtgtgtgtgtgtatgtgtagacaagctctcgctctgtcacccaggctggagtgcagtggtgcaatcatggttcactgcagtcttgaccttttgggctcaagtgatcctcccacctcagcctcctgagtagctgggaccataggctcacaacaccacacctggcaaatttgattttttttttttttccagagacggggtctcgcaacattgcccagacttcctttgtgttagttaataaagctttctcaactgcc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]