GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2018-01-22 11:41:33, GGRNA : RefSeq release 85 (Nov, 2017)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Nematostella vectensis predicted protein (NEMVEDRAFT_v1g220845) partial mRNA. (356 bp)
Lucas,S., Detter,J.C., Glavina del Rio,T., Shapiro,H., Lindquist,E., Putnam,N. and Rokhsar,D. CONSRTM US DOE Joint Genome Institute (JGI-PGF) TITLE Direct Submission JOURNAL Submitted (20-JUN-2007) US DOE Joint Genome Institute, 2800 Mitchell Drive B100, Walnut Creek, CA 94598-1698, USA ctaatgaccttgaacttatcatgttagctaatgacctttaccttaccatgttagctaatgaccttgaacttatcatgttagctaatgaccttgaacttatcatgttagctaatgaccttgaacttatcatgttagctaatgacctttacattatcatgttagctaatgacctttaccttaccatgttagccaatgaccttgaacttatcatgttagccaatgaccttgaccttatcatgttacctaatgaccttgaacttatcatgttagctaatgaccttgaacttatcatgttatctaatgacctttacc...
position 6
XM_001622291.1 - Nematostella vectensis (starlet sea anemone) - NCBI
Trichoderma virens Gv29-8 hypothetical protein partial mRNA. (615 bp)
K.S. and Kubicek,C.P. TITLE Direct Submission JOURNAL Submitted (05-JUL-2007) DOE Joint Genome Institute, 2800 Mitchell Drive, Walnut Creek, CA 94598, USA atgaagttcaactccgctgctattgtagccatcttggcctacaccaccttagctctgccaacgccatccccaggcaaaaccgatgttggcaaagttgatcttgagagccgaaatggcaagatggatgtcggcaaggttgaccttgaacgacgaaacggcaagatggatgttggcaaggttgatcttgaacgtcgaaacggcaagatggatgtcggcaaagttgatcttgagcgtcgaaacggcaagatggatgtcggcaaggttgaccttgaacgacgaaacggcaagatggatgtcggcaaggttgaccttgaacgacgaaacggcaagatggatgtcggcaaggttgaccttgaacgtcgaaacggcaagatggatgttggcaaggttgatcttgaacgtcgaaatggtaagatggatgttggcaaggttgatcttgaacgac...
position 139
XM_014100710.1 - Trichoderma virens Gv29-8 - NCBI
PREDICTED: Crassostrea virginica CUB and sushi domain-containing protein 2-like (LOC111104980), mRNA. (2194 bp)
ORIGIN // cgcaaacttaaccaatgtcaaggtcacttccactagcatcgggacgactctttcttacacatgtcattggaataaatcaatgaccttgaactcaacatgcaaagctgatggtacctggacatcttcggcttccgtttgccctaccggcccaccagaatgccctgttgatcaccctgacgcaaacttaaccaatgtcaaggtcacttccactagcatcgggacgactctttcttacacatgtcattggaataaatcaatgaccttgaactcaacatgcaaagctgatggtacctggacatcttcggcttccgtttgccctaccggcccaccagaatgccctgttgatcaccctgacgcaaacttaaccaatgtcaaggtcacttccactagcatcgggacgactctttcttacacatgtcattggaataaatcaatgaccttgaactcaacatgcaaagctgatggtacctggacatcttcggcttccgtttgccctaccggcccaccagaatgccctgttgatcaccctgacgcaaacttaaccaatgtcaaggtcacttccactagcatcgggacgactctttcttaca...
position 82
XM_022439157.1 - Crassostrea virginica (eastern oyster) - NCBI
PREDICTED: Ursus maritimus tropomyosin-like (LOC103657629), mRNA. (849 bp)
Chromosome segregation ATPase [Cell cycle control, cell division, chromosome partitioning]; Region: Smc; COG1196" /db_xref="CDD:224117" ORIGIN // atgtcctggctgtgtggtctgaggtggttcactaaccacgctggttttcagggccttcatctctacagaagtagagtcacgcctccgtcaaggttccctgtgagcactgaactagatgttatagacaccaaactagatgttatagaccttgaactagatgttctagacactgaactagatgttctagacaccaaactagatgttatagacactgaactagatgttatagacaccgaactagatgttatagaccttgaactagatgttctagacaccgaactagatgttatagacactgaactagatgttatagacattgaactagatgttatagaccttgaactagatgttctagacaccgaactagatgttatagacattgaactagatgttatagacaccgaactagatgttatagacattgaactagatgttatagacaccgaactagatg...
position 145
XM_008685039.1 - Ursus maritimus (polar bear) - NCBI
Branchiostoma floridae hypothetical protein, mRNA. (959 bp)
ggcggtatctggtgttcaaaactcccgccgctgggaagatatgtaggacagtagagagaatggcggacaagattcggaaagagaaacagaggcaggagtcgcagggcaacatgggacaggaggcaacggcctgttgaccttgacctttgaatgacatttggtggcatgttgaccttgacctttttttattacatttgaactcgattgaatgatggtcgagaatgactgataaaattcggaaggaaaaacagacaagagtcgcagggcaacatgggacaggaggcaatgacctgctgaccttgaactttgaaggacatttgctggtctgttgacctttgagctttgaaggacatttccttccctttgaactctatggaatgatggtcgagtattgctgataagattcggaagaaaaacagagacaagagtcgcaacttcggacagcaggaagcaaagacctgttgaccttgaactttgaaggacatttggaattacttccggttgaactcgatggaatgatggtcgagaatagctctgataagatttagaagacaaacagagacatgagtccagcaagtgtatttcggtcaggacggcacc...
position 534
XM_002602344.1 - Branchiostoma floridae (Florida lancelet) - NCBI
PREDICTED: Branchiostoma belcheri uncharacterized LOC109481402 (LOC109481402), ncRNA. (394 bp)
by RNAseq alignments, including 2 samples with support for all annotated introns" /db_xref="GeneID:109481402" ncRNA 1..394 /ncRNA_class="lncRNA" /gene="LOC109481402" /product="uncharacterized LOC109481402" /db_xref="GeneID:109481402" ORIGIN // agaaccgagattcgaatgcagacgaccggacgcgatgaaatttaggggtgaccttgaacagtttgtgatcatggcacaagaacatggaggcgccatcattctgtcacgtttcctttcgtcacacaagcaagtttagaggtgaccttgaacagttcacaagaacctgaagggcgccttgattcatggattcatgcacgctttcgttcatcacaagcaatgaagtttagaagtgatcacaagaaacatggaggatggagggcgccatcactaagtcattttttttcaccaccgaagagcaatgaagtttagaggtgaccttgaagtcaaaaacacaacaaccaagaagggcatcatca...
position 50
XR_002140896.1 - Branchiostoma belcheri (Belcher's lancelet) - NCBI
Trichomonas vaginalis G3 hypothetical protein (TVAG_193740) partial mRNA. (1689 bp)
cgaagcagaagcacgcgatatcatcttagaagaaggtgccaatgaagaagaagaaaaacttgaagctgaaatcaatgtaatcgattctcagattaatgaaaagaattccaagaacgcagaacaagaaaagaagaacagtgaacttcaacaacaactggaatctaagaagaatgaacttgaatctattccaacagttgaagacaagtcatccgaacttgaaaacgaacttaagaagattgattcacatatcaatgacaagaattcaaagaactcagaaaccgatcataagaacaaggaccttgaacaagagttgaatgataagaagtctcaacttgaatccattccaaccgttgaagacaaatcatccgaactcgaaaacgaaatcaagaacatcaattcacatatcaacgaaaagaattcaaagaactcagaaactgacaagaagaacaaagatcttgaacaagagttgaatgataagaaagctcaacttgaatctattccaaccgttgaagacaaatcatccgaactcgaaaacgaaatcaagaacatcaattcacatatcaacgaaaagaattcaaagaactcagaaactgacaagaa...
position 304
XM_001315492.1 - Trichomonas vaginalis G3 - NCBI
Phytophthora parasitica INRA-310 hypothetical protein partial mRNA. (587 bp)
ctgcaagccactcgctggattttttcgctcctggctgccgccgctggtcgagctgatcccaagtctgaaccagagaccaagccaaagcccagcgacgcgaaggaggaagccgtatcgcgacgccacgaagaaatcaggtgtcgcgagctcattcgactgagcggtgcagcgacgggatctcttgggcggcttcgcttgaagcgcggcaaaaacgccggaagcgcgccacgctggacaacgatctcgtcgtcaagtccagcgcagcactacgaagacgagcagctccaggccgagcgaccttgaacggtggcttcatataggccggcaaggcctgcagcccacgttggcacatgggatatcatcgcgaagccgccagatcatgttcgatcacgacgccgcgtccatctcaccgcgacccgaccttgaaccaacccggcttctatagtacacgatatcggtgatcgcaggctcctactcctctcgcaggtcaccactcaatacaattcccctttcaactagtcttttgtagctatataatataacagacctattcgttttcgcagaga
position 317
XM_008903830.1 - Phytophthora parasitica INRA-310 - NCBI
PREDICTED: Nelumbo nucifera uncharacterized LOC104600355 (LOC104600355), transcript variant X1, ncRNA. (1498 bp)
atggatgtccagcaataaatgtctctgctttttgtctgatcagtgctggccattggtacgttgcccagcaaaaagtggatggggattgggaaattttgattttttgacaaatggttatgaagtatatatggaaagaaagtgtgaattaaggctctccatcacttcgaaacggtctcacctgtgtctctgtaattcgatcagtttgtttaatcagattcatctggagctctctacagaagctacaaccaacaagttaacagaaacaacttggccaaacccagtagttgcacagctggaccttgaaccctctaagaaaaaccaaatttttccggaggcatcagagatggtggaccaaaaggttcagtagcttgaccttgaaccctctaagaaaaaccaaattttgccggagacatcaaagatggtgggaccaaaaggttcagtagcttgaccttgaaccctctaggaaaaaccaaattttgtcggaggcatcagagatggtgggaccaaaagttctcagtagcagtaggttcatataggctgatcagaaaatccctaaaaatcttgcattaaaatcaaccagaagtcaatgtaatataaata...
position 1150
XR_002022815.1 - Nelumbo nucifera (sacred lotus) - NCBI
PREDICTED: Nelumbo nucifera uncharacterized LOC104600355 (LOC104600355), transcript variant X2, ncRNA. (1501 bp)
atggatgtccagcaataaatgtctctgctttttgtctgatcagtgctggccattggtacgttgcccagcaaaaagtggatggggattgggaaattttgattttttgacaaatggttatgaagtatatatggaaagaaagtgtgaattaaggctctccatcacttcgaaacggtctcacctgtgtctctgtaattcgatcagtttgtttaatcagattcatctggagctctctacagaagctacaaccaacaagttaacagaaacaacttggccaaacccagtagttgcacagctggaccttgaaccctctaagaaaaaccaaatttttccggaggcatcagagatggtggaccaaaaggttcagtagcttgaccttgaaccctctaagaaaaaccaaattttgccggagacatcaaagatggtgggaccaaaaggttcagtagcttgaccttgaaccctctaggaaaaaccaaattttgtcggaggcatcagagatggtgggaccaaaagttctcagtagcagtaggttcatataggctgatcagaaaatccctaaaaatcttgcattaaaatcaaccagaagtcaatgtaatataaata...
position 1153
XR_002022816.1 - Nelumbo nucifera (sacred lotus) - NCBI
Babesia microti strain RI partial mRNA. (2901 bp)
ctacgatgagaagatggataatttgcaaaagcagctgaaagaatacactgaaaagatcacagtgctggaaaacaacgcctctgaattcaactataaagaccaagctgaaacgttgaagacggaactggataagtcgcaactaaagataatggaactggagactatgattaaggagaacagcgaaaaaacggaaagagtgccatctcccagaaaggacaacgaggaggttgatagattaacttcggaaatattacagttgaagaatcaggtggacattctgcaaaatgaaaagactgaccttgaacaaaaattatcacaacaatctcccagaaaggacaacgaggaggttgatagattaacttcggaaatattacagttgaagaatcaggtggacattctgcaaaatgaaaagactgaccttgaacaaaaattatcacaacaatctcccagaaaggacaacgaggaagttgatagattaacttcggaaatattacagttgaagaatcaggtggacattctgcaaaatgaaaagactgaccttgaacaaaaattatcacaacaatctcccagaaaggacaacgaggaagttgatagattaac...
position 1867
XM_012794168.1 - Babesia microti strain RI - NCBI
PREDICTED: Crassostrea virginica uncharacterized LOC111104979 (LOC111104979), mRNA. (1451 bp)
ORIGIN // ggaataaatcaatgaccttgaactcaacatgcaaagctgatggtacctggacatcttcggcttccgtttgccctaccggcccaccagaatgccctgttgatcaccctgacgcaaacttaaccaatgtcaaggtcacttccactagcatcgggacgactctttcttacacatgtcattggaataaatcaatgaccttgaactcaacatgcaaagctgatggtacctggacatcttcggcttccgtttgccctaccggcccaccagaatgccctgttgatcaccctgacgcaaacttaaccaatgtcaaggtcacttccactagcatcgggacgactctttcttacacatgtcattggaataaatcaatgaccttgaactcaacatgcaaagctgatggtacctggacatcttcggcttccgtttgccctaccggcccaccagaatgccctgttgatcaccctgacgcaaacttaaccaatgtcaaggtcacttccactagcatcgggacgactcttccctacacatgtcattggaatacatcaatgacattgaactcaacatgcaaggccgatggtacctggacatcttcg...
position 14
XM_022439156.1 - Crassostrea virginica (eastern oyster) - NCBI
PREDICTED: Oreochromis niloticus uncharacterized LOC102079679 (LOC102079679), ncRNA. (2462 bp)
acacgctttgcaaaatttgtccttcccatatctcatcactcagtctttaataatagaggacctaaatttcaccacatggtgctatccaaactccactggaggactccagtgtcagtgtgaggaccagtttgcttggtcatgtaacaagtgtgatgagtacggcgcatgcagtaatgtcacctcccaaacctgtgattgcataaagggatttcctctgagtggggagttctgtcaaccaatcacaggcgtcgctccttgcccaacaccaactcctgcaccagtggactttgatatagaccttgaactgcacatcccagcatctagtgtgccccaaaatttcagtgttgtgctcagaaatattctgagaaatttctccttccccaaaatcatcactgggtctttaacactgaaagacttgaacttcaccacatggtgctatccaaactccactggaggacaccagtgtcagtgtgaagaccagtttgcttggtcatgtggcaagtgtgataagtacggcgcatgcagtaatgtcacctcacaaacctgtgattgcataaagggatttcctctgagtggggagttctgtcaaccaatcacagg...
position 1293
XR_002057560.1 - Oreochromis niloticus (Nile tilapia) - NCBI
PREDICTED: Mus musculus predicted gene, 42009 (Gm42009), ncRNA. (643 bp)
tggcccaagtcttacagcctcagacttctgagaacgaaattttaaaaaacggcagtttaagttatgaaaagagggacgttgtcagtcagagtctattgggataggcctctttgcacatcttcattgagaatttctagaggcccttctgcctggaaccaagaagggagaaagcttgacagcactgaattgagcatcttttgtggcctgtgcttctccccacccagcaccccctcccccttgcccttgtctctcatgtagcacaggcaaaccttgagctccttatacaacagacggtgaccttgaactcccacttgcccttgtctctcatgtagcacaggcaaaccttgagctccttatacaacagacggtgaccttgaactcc
position 557
XR_878709.2 - Mus musculus (house mouse) - NCBI - UCSC - RefEx(expression)
PREDICTED: Takifugu rubripes supervillin-like (LOC105419549), mRNA. (871 bp)
gttcagacccggctagtggagcccagagcaccctccctgaacagcggtgactgtttcctgctggttacaccacaacactgctttgtctggactggagaatttgcaaatgtcattgagaagaacaaggtctgactgtggtagagttaagaacttgaaaacatgtggcgtctttcatctgtggtgtgacagaagcttagggttgagaagcctgatgctatataggcagactaaccctaacacaggaagccacgcttggtgttttagaggaaacacctgggaaacagcctggcctcctgaccttgaactgaccttgaactgataaacgactctgttggtaccgtacgatggtgctgcaca
position 810
XM_011621184.1 - Takifugu rubripes (Fugu rubripes) - NCBI
PREDICTED: Lepidothrix coronata uncharacterized LOC108492581 (LOC108492581), ncRNA. (105 bp)
the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:108492581" ncRNA 1..105 /ncRNA_class="lncRNA" /gene="LOC108492581" /product="uncharacterized LOC108492581" /db_xref="GeneID:108492581" ORIGIN // gaagatgcaagcgatttgggaccttgaacaaggcaaatatggttttgtgtcttttggccatttgtaccgggagactgactcggagtcccggtatcggaaaagcac
position 20
XR_001873159.1 - Lepidothrix coronata (blue-crowned manakin) - NCBI
Perkinsus marinus ATCC 50983 hypothetical protein, mRNA. (153 bp)
REFERENCE 1 (bases 1 to 153) AUTHORS El-Sayed,N., Caler,E., Inman,J., Amedeo,P., Hass,B. and Wortman,J. TITLE Direct Submission JOURNAL Submitted (09-JUL-2008) J. Craig Venter Institute, 9704 Medical Center Drive, Rockville, MD 20850, USA atatgcttcgattgctggcacaacacgtggcacagcaaggagtacatcgccttgaccttgaacgtgcacacggacaaacctactccagtcgtgttagacctgagagaaataccagacggtaccagtgagagcctcaagatggcgatagatgaa
position 54
XM_002775004.1 - Perkinsus marinus ATCC 50983 - NCBI
Perkinsus marinus ATCC 50983 hypothetical protein, mRNA. (160 bp)
E., Inman,J., Amedeo,P., Hass,B. and Wortman,J. TITLE Direct Submission JOURNAL Submitted (09-JUL-2008) J. Craig Venter Institute, 9704 Medical Center Drive, Rockville, MD 20850, USA acgtacagcttctgggcagtcgggatcggaccactcagtccattccgaccgtgaagccgcccatcgacctcgccttcaagatcggggccctgatcctgccgtccgtgaccttgaaccgcgtcgtggcccccgtgctcgtccttacctacccgaatacgag
position 107
XM_002778064.1 - Perkinsus marinus ATCC 50983 - NCBI
Mus musculus microRNA 3070b (Mir3070b), microRNA. (89 bp)
PUBMED 20413612 REFERENCE 3 (bases 1 to 89) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res. 34 (DATABASE ISSUE), D140-D144 (2006) PUBMED 16381832 gtgctgagtgaggctgagcccctgaccttgaacctgggatcctccccatgatcttctggtgctatggtcaggggtagattccttgtcat
position 24
Synonym: mir-3070-2; mmu-mir-3070-2; mmu-mir-3070b
NR_037231.1 - Mus musculus (house mouse) - NCBI - UCSC - RefEx(expression)
Mus musculus microRNA 3070a (Mir3070a), microRNA. (89 bp)
PUBMED 20413612 REFERENCE 3 (bases 1 to 89) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res. 34 (DATABASE ISSUE), D140-D144 (2006) PUBMED 16381832 gtgctgagtgaggctgagcccctgaccttgaacctgggatcctatccatgatctcctggtgctaccgtcaggggtagattccttgtcat
position 24
Synonym: mir-3070-1; mmu-mir-3070-1; mmu-mir-3070a
NR_037230.1 - Mus musculus (house mouse) - NCBI - UCSC - RefEx(expression)
Aspergillus fumigatus Af293 hypothetical protein (AFUA_1G12360), partial mRNA. (174 bp)
Denning,D.W. TITLE Direct Submission JOURNAL Submitted (20-MAY-2005) The Institute for Genomic Research, 9712 Medical Center Dr, Rockville, MD 20850, USA atgccgcctgacatatttacctaccatcggcataccaagcagcgtttgggccctggtctgtcccttggtaatctagcattccgcggcctcgatggagtatgcgacagccacatcagaaatttcgtatccatagagaggaccttgaaccatgggtttgtcatctcatttgtctaa
position 138
XM_747512.1 - Aspergillus fumigatus Af293 - NCBI
PREDICTED: Brassica rapa uncharacterized LOC103847679 (LOC103847679), ncRNA. (142 bp)
by RNAseq alignments, including 293 samples with support for all annotated introns" /db_xref="GeneID:103847679" ncRNA 1..142 /ncRNA_class="lncRNA" /gene="LOC103847679" /product="uncharacterized LOC103847679" /db_xref="GeneID:103847679" ORIGIN // gggaatggagttgtaggggattttctggtggcaaaggctttcggtgaccttgaacccatttttacatacgaagggacgtacgacataaacaccttagtgacggggagggaagttaccgggattgcgagtttcaaacccccag
position 46
XR_628824.1 - Brassica rapa (field mustard) - NCBI
Botryotinia fuckeliana B05.10 predicted protein (BC1G_07111) partial mRNA. (198 bp)
Assembly Team TITLE Direct Submission JOURNAL Submitted (12-AUG-2005) Broad Institute of MIT and Harvard, 320 Charles Street, Cambridge, MA 02141, USA atgatttgggcttttggtactgggtatgatctgcttgcaatcctgatattcatgcatgaacgtctttttcaatggttcctatttacaattgtccttgatgctctggccagcatgatcactattgtcgatgcaattgtcgaccttgaactttttgattcagatgtgaggctcacgcgagcaatttggtttggctggtga
position 139
XM_001554473.1 - Botrytis cinerea B05.10 - NCBI
PREDICTED: Juglans regia uncharacterized LOC108995533 (LOC108995533), mRNA. (1145 bp)
taatcgaggaaatcagcaacagagcttttagacaatggacattttggttaagcaaaagagagtgagattttcaagcccagaaatagagaagcaggaagagatccatggcactagagaaagatcctttgatgaagataacagggcgcagggctggttcaagaaccatttctcaggccatgtgaatgaggactatgattcaaaagacattgagtttggagctgctgttggagcaactgctgttgccattcattcacttgaagaagctgattttgcatctcagatgaagatgagagaggaccttgaaccctcaagaactaagctcacaattggacagccaagttctggtagagcaactaggagtttctcaagcatgcagaatgcagataaacttttgataaataactcaatggagcagaaggatgcactggagagggctttcccaactaggcttccaacttcaacgtcacagaagcacaagggagatgccaaagtacgtttgccaaaggatgcagaagacagtgatgatgaagacattctaagtgaagaaggcagaaatgaattagacttgctttttgaaagccatgtgaatgaggactatga...
position 315
XM_018971111.1 - Juglans regia (English walnut) - NCBI
Trichomonas vaginalis G3 hypothetical protein (TVAG_538490) partial mRNA. (1005 bp)
cgaatcgaagaagaaggaacttgaatctattccaaccgttgaagataaatcatcatctgttgaagaggaaatcaataacatcaattcacatatcaacgaaaagaattccaagaacgcagaacaagaaaagaagaacagtgaacttcaacaacaactggaatctaagaagaatgaacttgaatctattccaacagttgaagacaaatcatccgaacttgaaaacgaacttaagaacatcaattcacatatcaacgaaaagaattcaaagaactcagaaaccgatcataagaacaaggaccttgaacaagagttgaatgataagaagtctcaacttgaatccattccaaccgttgaagacaaatcatccgaactcgaaaacgaaatcaagaacatcaattcacatatcaacgaaaagaattcaaagaactcagaaactgacaagaagaacaaagatcttgaacaagagttgaatgataagaaagctcaacttgaatccattccaaccgttgaagacaaatcatccgaactcgaaaacgaaatcaagaacatcaattcacatatcaacgaaaagaattcaaagaactcagaaactgacaagaa...
position 373
XM_001283317.1 - Trichomonas vaginalis G3 - NCBI
Paracoccidioides lutzii Pb01 hypothetical protein (PAAG_11403), partial mRNA. (210 bp)
JOURNAL Submitted (20-AUG-2014) Broad Institute of MIT and Harvard, 7 Cambridge Center, Cambridge, MA 02142, USA atggaagcttctcttgttgtccttcaccaggaatttgggagtgctattcaggagcttcgcagtgagaatcaacagctccaggctgattgccaatctttacgggctgaatgtcaatcattacatacagctctgaacagctcccgatcccaatcccgtccgaagccttcactgccagaccttgaacgaatccctggcagcctatattgctaa
position 175
XM_015847058.1 - Paracoccidioides lutzii Pb01 - NCBI
PREDICTED: Diaphorina citri keratinocyte proline-rich protein-like (LOC103519153), mRNA. (980 bp)
aggatcccccaacaaaaaaccaacaaaaggcagagccgcacgaagaaggaccaggaagaccacaacagagggtgagccaaactggaacctaactacccgctggaggatattacgggatggacctaccagtgatcctttatatcttaatggctttaagataatgcatcatcgtaaaaaagtattagtaccaaaaagaaccgcaagggtccccacaccaacaggaggccccgcaccaacaaaagcccccaaacacaaaaaagaccctgaacccaaaaaagacccagaatccaaaacagaccttgaacccaaaaaagaccctgaaaccaaaatagaccctaaacccaaaacagaccctgaaaccaaaatagaccctgaacccaaaaaagactctgaaaccaaaatagaccctaaacccaaaacagaccctgaaaccaaaatagaccctgaacccaaaacagaccttgaacccaaaaaagaccctgaaaccaaaatagaccctaaacccaaaacagaccctgaaaccaaaatagaccctgaacccaaaaaagacccagaaacgaataaaaactaattgaaaatgtatttgacatataaatttta...
position 551
XM_008484238.2 - Diaphorina citri (Asian citrus psyllid) - NCBI
PREDICTED: Biomphalaria glabrata uncharacterized LOC106068739 (LOC106068739), ncRNA. (138 bp)
for all annotated introns" /db_xref="GeneID:106068739" ncRNA 1..138 /ncRNA_class="lncRNA" /gene="LOC106068739" /product="uncharacterized LOC106068739" /db_xref="GeneID:106068739" ORIGIN // ggaagtacagtaaagaagctgtgtttgaaggcattgctgagtttgaagtcaacaatgaaattctacatccagagatcacggagtgccgtgtgtttaagactgaccttgaacttcaagctatcagatatgccaacaaaa
position 102
XR_001217959.1 - Biomphalaria glabrata - NCBI
Sordaria macrospora k-hell hypothetical protein (SMAC_11936), mRNA. (216 bp)
Nowrousian M., Dept. of General and Molecular Botany, Ruhr-Universitaet Bochum, Universitaetsstr. 150, 44801 Bochum, GERMANY atggtcggaatagccgccaaaggtgtggccgccgaggacggggtcgggaccgttataggtgccgacaaagccggtgccggtgcaatattgctcctcgccctcatggcaagacgggcattcgccgcagctgtcgaccatgcagccgacgccgaccgtgtcgccgaccttgaacttcgtcacgtcgctgccgaccgcggtgacggtgccgacgatctc
position 163
XM_003343161.1 - Sordaria macrospora k-hell - NCBI
Culex quinquefasciatus conserved hypothetical protein, mRNA. (216 bp)
Y.-H., Utterback,T., Shetty,J., Viswanathan,L., Kravitz,S., Resnick,A., Devon,K., Nusbaum,C., Galagan,J., Eisenstadt,E., Fraser-Liggett,C. and Birren,B. TITLE Direct Submission JOURNAL Submitted (26-MAR-2007) Broad Institute of MIT and Harvard, 7 Cambridge Center, Cambridge, MA 02142, USA atgaccttgaactttccttttaagatgttcttccacgggggcaacatgaagcaattccaccagtacgtgagccccgacgtgctgccgaagaactacggcggaaacctgccggaaatcgattacgctggcaaggactggtacccgtgcacggccaagtacgtggaccacatcaagcggtacaatgagtgtggatttgtggacaaggcggagaagtaa
position 3
XM_001864272.1 - Culex quinquefasciatus (southern house mosquito) - NCBI
PREDICTED: Brassica oleracea var. oleracea uncharacterized LOC106305681 (LOC106305681), ncRNA. (147 bp)
introns" /db_xref="GeneID:106305681" ncRNA 1..147 /ncRNA_class="lncRNA" /gene="LOC106305681" /product="uncharacterized LOC106305681" /db_xref="GeneID:106305681" ORIGIN // gtggaaagccaagagctgagacaaaactaaaaagtgcagtccagttgcaagacctattagatgcaacaagaatgttagttccccatacaagaccaggtcgtgagagtgatagtgatccagaagaccttgaacatgctgagaagcttc
position 123
XR_001263035.1 - Brassica oleracea var. oleracea - NCBI
PREDICTED: Xenopus laevis uncharacterized LOC108706287 (LOC108706287), ncRNA. (202 bp)
genomic feature by RNAseq alignments, including 63 samples with support for all annotated introns" /db_xref="GeneID:108706287" ncRNA 1..202 /ncRNA_class="lncRNA" /gene="LOC108706287" /product="uncharacterized LOC108706287" /db_xref="GeneID:108706287" ORIGIN // gatgaatgttctgagcttaagaaagacattgatgaccttgaactaactttggccaaagtagaaaaggagaagcatgccacagaaaacaaggtcaaaaaccttactgaagaaatggcagctctcgatgagaacatttccaaactgtccaaagaaaagaaggcccttcaagaggctcaccaacaaacacttgatgacctgcaag
position 34
XR_001934048.1 - Xenopus laevis (African clawed frog) - NCBI
PREDICTED: Brassica napus uncharacterized LOC106433144 (LOC106433144), ncRNA. (222 bp)
gene="LOC106433144" /product="uncharacterized LOC106433144" /db_xref="GeneID:106433144" ORIGIN // caaaacagaaggtgaaattaaatgttacagaggagaaactgttaaacctgatgctgaagtacaatggtggaaagccaagagctgagacaaaactaaaaagtgcagtccagttgcaagacctattagatgcaacaagaatgttagttccccgtacaagaccaggtcgtgagagtgatagtgatccagaagaccttgaacatgctgagaagcttcaccaagtta
position 189
XR_001286532.2 - Brassica napus (rape) - NCBI
Alternaria alternata hypothetical protein partial mRNA. (207 bp)
Institute TITLE Direct Submission JOURNAL Submitted (09-MAY-2016) DOE Joint Genome Institute, 2800 Mitchell Drive, Walnut Creek, CA 94598-1698, USA gaagacataaactcagagatgtacgatctgtttggagcagaccacgaaacaagcactcttgaattcgcaactagcgatagtgatcaccagtttccccatgaactgtgtgatgagggagagaaaagccgcgaaacattgtgtttgaccttgaacgattcattcaatggaagcacttcaggtaagtacttcagtagactgcggtggtga
position 144
XM_018535268.1 - Alternaria alternata - NCBI
PREDICTED: Diaphorina citri protein TsetseEP-like (LOC103519155), mRNA. (1035 bp)
caaaaaagactctgaaaccaaaatagaccctaaacccaaaacagaccctgaaaccaaaatagaccctgaacccaaaaaagactctgaaaccaaaatagaccctaaacccaaaacagaccctgaaaccaaaatagaccctgaacccaaaaaagactctgaaaccaaaatagaccctaaacccaaaacagaccctgaaaccaaaatagaccctgaacccaaaaaagactctgaaaccaaaatagaccctaaacccaaaacagaccctgaaaccaaaatagaccctgaacccaaaacagaccttgaacccaaaaaagaccctgaaaccaaaatagaccctaaacccaaaacagaccctgaaaccaaaatagaccctgaacccaaaaaagactctgaaaccaaaatagaccctaaacccaaaacagaccctgaaaccaaaatagaccctgaacccaaaaaagactctgaaaccaaaatagaccctaaacccaaaacagaccctgaaaccaaaatagaccctgaacccaaaaaagactctgaaaccaaaatagaccctaaacccaaaacagaccctgaaaccaaaatagaccctgaacccaaaaa...
position 472
XM_008484240.1 - Diaphorina citri (Asian citrus psyllid) - NCBI
Homo sapiens small nucleolar RNA, H/ACA box 31 (SNORA31), small nucleolar RNA. (130 bp)
Nucleic Acids Res. 34 (DATABASE ISSUE), D158-D162 (2006) PUBMED 16381836 REFERENCE 3 (bases 1 to 130) AUTHORS Kiss AM, Jady BE, Bertrand E and Kiss T. TITLE Human box H/ACA pseudouridylation guide RNA machinery JOURNAL Mol. Cell. Biol. 24 (13), 5797-5807 (2004) PUBMED 15199136 ctgcatccactgatagaccttgaacaatttactgttgttcttttggtttgcactaggatgcaaaagaaagaaatccctgcgctttctgtctgtctttgtggcggcccagattgaattggggaatacatct
position 16
Synonym: ACA31; SNORA31A
NR_002967.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Helobdella robusta hypothetical protein partial mRNA. (165 bp)
DOE Joint Genome Institute TITLE Direct Submission JOURNAL Submitted (18-DEC-2012) DOE Joint Genome Institute, 2800 Mitchell Drive, Walnut Creek, CA 94598-1698, USA atcaaagacagcacatcactatttccggtcatcgtgtttgtgcacggcgtcagctatgacaccggaaccggcaatgcatacgacggaagttacctggccgccttcggtcacgtgattgttgtgaccttgaactatcgagtcggagttttaggtgcgtctttttaa
position 123
XM_009018708.1 - Helobdella robusta - NCBI
PREDICTED: Brassica napus uncharacterized LOC106395442 (LOC106395442), ncRNA. (232 bp)
gene="LOC106395442" /product="uncharacterized LOC106395442" /db_xref="GeneID:106395442" ORIGIN // tccaaaacagaaggtgaaactaaatgttacagaggagaaactgttaaacctgatgctgaagtacaatggtggaaagccaagagctgagacaaaactaaaaagtgcagtccagttgcaagacctattagatgcaacaagaatgttagttccccgtacaagaccaggtcgtgagagtgatagtgatccagaagaccttgaacatgctgagaagcttcgccaagttaaagcagtt
position 191
XR_002658202.1 - Brassica napus (rape) - NCBI
Entamoeba histolytica HM-1:IMSS ubiquitin-like, putative (EHI_103510), partial mRNA. (234 bp)
USA REFERENCE 3 (bases 1 to 234) AUTHORS Lorenzi,H., Amedeo,P., Inman,J., Schobel,S. and Caler,E. TITLE Direct Submission JOURNAL Submitted (01-MAR-2007) The Institute for Genomic Research, 9712 Medical Center Drive, Rockville, MD 20850, USA atgttaattaacattaaacttcttaatggaagaattctttctattgaccttgaaccaacagataaaatctctgaccttaaagctaaattagaagaaattgaaggtattactccagaacaacaacgacttgtttttggtggaagacaacttggagatgataaaacacttcaagaacttaacattcaaccaggaactcaaattaatcttcttcttgctttaagaggaggtttttaa
position 46
XM_644371.1 - Entamoeba histolytica HM-1:IMSS - NCBI
Physcomitrella patens subsp. patens predicted protein (PHYPADRAFT_18984) mRNA, partial cds. (243 bp)
US DOE Joint Genome Institute (JGI-PGF) TITLE Direct Submission JOURNAL Submitted (15-NOV-2007) US DOE Joint Genome Institute, 2800 Mitchell Drive B100, Walnut Creek, CA 94598-1698, USA agcgatgcggaggtcgatagcagaggtcgggtgcccgaagacgtgccggctgggtttttggttgtgtatgtgggcgatgagcggcgccggtttgtgatcagagccaagaccttgaaccacgctacgttccgcgtgctgctggagaagtcggccgcggagtttggttacaagcatgacggagggctgattattgcttgtgacgtggccttcttcgagcacctgctgtggctcattgagacaaac
position 108
XM_001768886.1 - Physcomitrella patens - NCBI
PREDICTED: Ceratotherium simum simum uncharacterized LOC106803079 (LOC106803079), ncRNA. (159 bp)
alignments, including 8 samples with support for all annotated introns" /db_xref="GeneID:106803079" ncRNA 1..159 /ncRNA_class="lncRNA" /gene="LOC106803079" /product="uncharacterized LOC106803079" /db_xref="GeneID:106803079" ORIGIN // ggaactccgaacgtccagacctacatctccctacagggccatcggtgacccggctggagaccttgaacgtaaatcagcatcagtccaggggcctggtggtaaggtgggaatccatgtttgtgtctgaagtgcttagcaataaagccaaggtggtgagtg
position 59
XR_001392226.1 - Ceratotherium simum simum (southern white rhinoceros) - NCBI
Trichomonas vaginalis G3 hypothetical protein (TVAG_240240) partial mRNA. (246 bp)
C. and Carlton,J. TITLE Direct Submission JOURNAL Submitted (16-OCT-2006) The Institute for Genomic Research, 9712 Medical Center Drive, Rockville, MD 20850, USA atgattaaacaaagttccactattgaagaattacaaaatcaacttatttcaagtcatcgcgattttgatcttgctattgaacgtcaaaagaagtcagcatcagaagcagaagaagcacgaatatttgccgaagaccttgaacgatcattcaataatttacaacgcacagttcttcgaattcaagacaaaatttcttcacacaattcaccaaatccatatccatccaaaagagtttcattcccttga
position 133
XM_001296831.1 - Trichomonas vaginalis G3 - NCBI
PREDICTED: Myotis brandtii uncharacterized LOC106727611 (LOC106727611), ncRNA. (164 bp)
RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:106727611" ncRNA 1..164 /ncRNA_class="lncRNA" /gene="LOC106727611" /product="uncharacterized LOC106727611" /db_xref="GeneID:106727611" ORIGIN // gagcatcagaagctcagtttaatcatcttacaatacccacttgcccgcacaggaccttgaacatgttggaaaataaaaggagtgaagactgagaaatgagtgaattgatattcaaaaaataacacattgctaggtttcctaatatgttgtcagaaagatggagc
position 53
XR_001363839.1 - Myotis brandtii (Brandt's bat) - NCBI
PREDICTED: Myotis lucifugus uncharacterized LOC106694600 (LOC106694600), ncRNA. (164 bp)
RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:106694600" ncRNA 1..164 /ncRNA_class="lncRNA" /gene="LOC106694600" /product="uncharacterized LOC106694600" /db_xref="GeneID:106694600" ORIGIN // gagcatcagaagctcagtttaatcatcttacaatacccacttgcccgcacaggaccttgaacatgttggaaaataaaaggagtgaagactgagaaatgagtgaattgatattcaaaaaataacacattgctaggtttcctaatatgttgtcagaaagatggagc
position 53
XR_001345641.1 - Myotis lucifugus (little brown bat) - NCBI
PREDICTED: Brassica rapa uncharacterized LOC103833608 (LOC103833608), ncRNA. (237 bp)
db_xref="GeneID:103833608" ncRNA 1..237 /ncRNA_class="lncRNA" /gene="LOC103833608" /product="uncharacterized LOC103833608" /db_xref="GeneID:103833608" ORIGIN // acaatggtggaaagccaagagctgagacaaaactaaaaagtgcagtccagttgcaagacctattagatgcaacaagaatgttagttccccgtacaagaccaggtcgtgagagtgatagtgatccagaagaccttgaacatgctgagaagcttcgccaagttaaagcagttattgaagaggttctttagtactttctctttttttgttgaatatagtccggggaaagtattacatagt
position 129
XR_626228.2 - Brassica rapa (field mustard) - NCBI
PREDICTED: Fukomys damarensis uncharacterized LOC104874106 (LOC104874106), ncRNA. (239 bp)
lncRNA" /gene="LOC104874106" /product="uncharacterized LOC104874106" /db_xref="GeneID:104874106" ORIGIN // agggactgaggcccagtctctgaatgggagcgacatcaggcttcacagactgtccagcacgggactgagacgtcaaaggcctcaggcttctgaatttatcttgtgatctttgaaaccagcaacctgagaacagagcagggagaggatgtgtcagccatggatgccatggtgcgatcaacctcaggaccttgaacttgccaggcaggcatggccactgaactacattgacagcccaagag
position 185
XR_783660.1 - Fukomys damarensis (Damara mole-rat) - NCBI
PREDICTED: Camelus dromedarius uncharacterized LOC105090102 (LOC105090102), ncRNA. (186 bp)
with support for all annotated introns" /db_xref="GeneID:105090102" ncRNA 1..186 /ncRNA_class="lncRNA" /gene="LOC105090102" /product="uncharacterized LOC105090102" /db_xref="GeneID:105090102" ORIGIN // cgttctctggccgagaacctgaggaggcgaagcgcgttcgtcgcctggcgctaagggcttgttgagaaggtcaccattaacaggcacatggaccttgaactctccggagcaccgaaaacacctgcaagaccaactgcagagatgacttcagaatatttctaacatgaaagcagttaccctttgcgc
position 91
XR_837231.1 - Camelus dromedarius (Arabian camel) - NCBI
PREDICTED: Habropoda laboriosa broad-complex core protein isoforms 1/2/3/4/5-like (LOC108571402), mRNA. (252 bp)
gene="LOC108571402" /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn finger" /db_xref="CDD:275368" misc_feature order(148..150,157..159,196..198,208..210) /gene="LOC108571402" /note="Zn binding site [ion binding]; other site" /db_xref="CDD:275368" ORIGIN // atgacggggctgaccttgaactctctgaacacccagtcagcgaagaagctgttcacctgccagctgtgcggcaaggtgctatgcagcaaagcatccctgaaacgccacgttgccgacaagcacgccgagcgacaggaggagtacagatgcgtcatctgcgagcgggtttactgctcgcgtaactccctgatgacccacatatatacctatcataagagcagacccggcgacattgacattaagttcttttga
position 12
XM_017933426.1 - Habropoda laboriosa - NCBI
Necator americanus hypothetical protein mRNA. (207 bp)
X.W.E. and Wilson,R.K. TITLE Direct Submission JOURNAL Submitted (17-APR-2013) The Genome Institute, Washington University School of Medicine, 4444 Forest Park, St. Louis, MO 63108, USA atgcacatgcgatcagagccaataggactgccagagtttgcatcgctgaaacaacacgctctcaatgtcggatcacaaaaactgtatttctgtggccgtcttatgaccttgaacaagatctcgttccagctatgcatgccatcagcgaagaacacaccaccatcggcagcacaatacatgggacaaatgccaggctctcctggatga
position 105
XM_013437053.1 - Necator americanus - NCBI
PREDICTED: Diaphorina citri homeobox protein 5-like (LOC103518562), mRNA. (1137 bp)
ttggttcaatattagtaagtgatggttcaaatggtttaaaaccagtaggaaatgattataaagatgcttcaaaaacagtagaaaatagtactaatgtttccaaatcagacaacagtccgaaattagtccaagatggttctagctcaactgtcaataaaggttctactagaaattctcctctatccaactctcaagtgtacgatttagcgaccaatggtactgctcgaagccatttagaagacaatcaaatctcctgtatggattcagtgaataatgcgtctgtgaatagtaattcgaccttgaacaatagttccaccgtgaacaacagttcatctttgaataacactgcgaccttgaacaatagttcgaacttgaacagcaattcgaccgtgaacaacagttccacaagtccaagtgccaaatctaaatcccctgggccggaacaatctaggctactgtcccgaaacagtcccttggtgaaagcgcgatcgggaactgccgaagttgattcgggtgtgttcgggtcggctgtgattccgatcggagagtcgattcacaaggtggaaaaaaagaagtcgctagacagcatcaacaataaca...
position 819
XM_008483639.1 - Diaphorina citri (Asian citrus psyllid) - NCBI

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/GACCTTGAAC
lang : en | div : | spe : | query_string : GACCTTGAAC | format : html | download :

0.000 | 0.000 | search_start;
0.236 | 0.236 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACCTTGAAC)?to=0&format=json
0.438 | 0.202 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACCTTGAAC)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.444 | 0.005 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]