GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2018-05-24 11:04:01, GGRNA : RefSeq release 87 (Mar, 2018)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Nematostella vectensis predicted protein (NEMVEDRAFT_v1g220845) partial mRNA. (356 bp)
Lucas,S., Detter,J.C., Glavina del Rio,T., Shapiro,H., Lindquist,E., Putnam,N. and Rokhsar,D. CONSRTM US DOE Joint Genome Institute (JGI-PGF) TITLE Direct Submission JOURNAL Submitted (20-JUN-2007) US DOE Joint Genome Institute, 2800 Mitchell Drive B100, Walnut Creek, CA 94598-1698, USA ctaatgaccttgaacttatcatgttagctaatgacctttaccttaccatgttagctaatgaccttgaacttatcatgttagctaatgaccttgaacttatcatgttagctaatgaccttgaacttatcatgttagctaatgacctttacattatcatgttagctaatgacctttaccttaccatgttagccaatgaccttgaacttatcatgttagccaatgaccttgaccttatcatgttacctaatgaccttgaacttatcatgttagctaatgaccttgaacttatcatgttatctaatgacctttacc...
position 6
XM_001622291.1 - Nematostella vectensis (starlet sea anemone) - NCBI
PREDICTED: Crassostrea virginica CUB and sushi domain-containing protein 2-like (LOC111104980), mRNA. (2194 bp)
ORIGIN // cgcaaacttaaccaatgtcaaggtcacttccactagcatcgggacgactctttcttacacatgtcattggaataaatcaatgaccttgaactcaacatgcaaagctgatggtacctggacatcttcggcttccgtttgccctaccggcccaccagaatgccctgttgatcaccctgacgcaaacttaaccaatgtcaaggtcacttccactagcatcgggacgactctttcttacacatgtcattggaataaatcaatgaccttgaactcaacatgcaaagctgatggtacctggacatcttcggcttccgtttgccctaccggcccaccagaatgccctgttgatcaccctgacgcaaacttaaccaatgtcaaggtcacttccactagcatcgggacgactctttcttacacatgtcattggaataaatcaatgaccttgaactcaacatgcaaagctgatggtacctggacatcttcggcttccgtttgccctaccggcccaccagaatgccctgttgatcaccctgacgcaaacttaaccaatgtcaaggtcacttccactagcatcgggacgactctttcttaca...
position 82
XM_022439157.1 - Crassostrea virginica (eastern oyster) - NCBI
Trichoderma virens Gv29-8 hypothetical protein partial mRNA. (615 bp)
K.S. and Kubicek,C.P. TITLE Direct Submission JOURNAL Submitted (05-JUL-2007) DOE Joint Genome Institute, 2800 Mitchell Drive, Walnut Creek, CA 94598, USA atgaagttcaactccgctgctattgtagccatcttggcctacaccaccttagctctgccaacgccatccccaggcaaaaccgatgttggcaaagttgatcttgagagccgaaatggcaagatggatgtcggcaaggttgaccttgaacgacgaaacggcaagatggatgttggcaaggttgatcttgaacgtcgaaacggcaagatggatgtcggcaaagttgatcttgagcgtcgaaacggcaagatggatgtcggcaaggttgaccttgaacgacgaaacggcaagatggatgtcggcaaggttgaccttgaacgacgaaacggcaagatggatgtcggcaaggttgaccttgaacgtcgaaacggcaagatggatgttggcaaggttgatcttgaacgtcgaaatggtaagatggatgttggcaaggttgatcttgaacgac...
position 139
XM_014100710.1 - Trichoderma virens Gv29-8 - NCBI
PREDICTED: Ursus maritimus tropomyosin-like (LOC103657629), mRNA. (849 bp)
Chromosome segregation ATPase [Cell cycle control, cell division, chromosome partitioning]; Region: Smc; COG1196" /db_xref="CDD:224117" ORIGIN // atgtcctggctgtgtggtctgaggtggttcactaaccacgctggttttcagggccttcatctctacagaagtagagtcacgcctccgtcaaggttccctgtgagcactgaactagatgttatagacaccaaactagatgttatagaccttgaactagatgttctagacactgaactagatgttctagacaccaaactagatgttatagacactgaactagatgttatagacaccgaactagatgttatagaccttgaactagatgttctagacaccgaactagatgttatagacactgaactagatgttatagacattgaactagatgttatagaccttgaactagatgttctagacaccgaactagatgttatagacattgaactagatgttatagacaccgaactagatgttatagacattgaactagatgttatagacaccgaactagatg...
position 145
XM_008685039.1 - Ursus maritimus (polar bear) - NCBI
Branchiostoma floridae hypothetical protein, mRNA. (959 bp)
ggcggtatctggtgttcaaaactcccgccgctgggaagatatgtaggacagtagagagaatggcggacaagattcggaaagagaaacagaggcaggagtcgcagggcaacatgggacaggaggcaacggcctgttgaccttgacctttgaatgacatttggtggcatgttgaccttgacctttttttattacatttgaactcgattgaatgatggtcgagaatgactgataaaattcggaaggaaaaacagacaagagtcgcagggcaacatgggacaggaggcaatgacctgctgaccttgaactttgaaggacatttgctggtctgttgacctttgagctttgaaggacatttccttccctttgaactctatggaatgatggtcgagtattgctgataagattcggaagaaaaacagagacaagagtcgcaacttcggacagcaggaagcaaagacctgttgaccttgaactttgaaggacatttggaattacttccggttgaactcgatggaatgatggtcgagaatagctctgataagatttagaagacaaacagagacatgagtccagcaagtgtatttcggtcaggacggcacc...
position 534
XM_002602344.1 - Branchiostoma floridae (Florida lancelet) - NCBI
PREDICTED: Branchiostoma belcheri uncharacterized LOC109481402 (LOC109481402), ncRNA. (394 bp)
by RNAseq alignments, including 2 samples with support for all annotated introns" /db_xref="GeneID:109481402" ncRNA 1..394 /ncRNA_class="lncRNA" /gene="LOC109481402" /product="uncharacterized LOC109481402" /db_xref="GeneID:109481402" ORIGIN // agaaccgagattcgaatgcagacgaccggacgcgatgaaatttaggggtgaccttgaacagtttgtgatcatggcacaagaacatggaggcgccatcattctgtcacgtttcctttcgtcacacaagcaagtttagaggtgaccttgaacagttcacaagaacctgaagggcgccttgattcatggattcatgcacgctttcgttcatcacaagcaatgaagtttagaagtgatcacaagaaacatggaggatggagggcgccatcactaagtcattttttttcaccaccgaagagcaatgaagtttagaggtgaccttgaagtcaaaaacacaacaaccaagaagggcatcatca...
position 50
XR_002140896.1 - Branchiostoma belcheri (Belcher's lancelet) - NCBI
Trichomonas vaginalis G3 hypothetical protein (TVAG_193740) partial mRNA. (1689 bp)
cgaagcagaagcacgcgatatcatcttagaagaaggtgccaatgaagaagaagaaaaacttgaagctgaaatcaatgtaatcgattctcagattaatgaaaagaattccaagaacgcagaacaagaaaagaagaacagtgaacttcaacaacaactggaatctaagaagaatgaacttgaatctattccaacagttgaagacaagtcatccgaacttgaaaacgaacttaagaagattgattcacatatcaatgacaagaattcaaagaactcagaaaccgatcataagaacaaggaccttgaacaagagttgaatgataagaagtctcaacttgaatccattccaaccgttgaagacaaatcatccgaactcgaaaacgaaatcaagaacatcaattcacatatcaacgaaaagaattcaaagaactcagaaactgacaagaagaacaaagatcttgaacaagagttgaatgataagaaagctcaacttgaatctattccaaccgttgaagacaaatcatccgaactcgaaaacgaaatcaagaacatcaattcacatatcaacgaaaagaattcaaagaactcagaaactgacaagaa...
position 304
XM_001315492.1 - Trichomonas vaginalis G3 - NCBI
PREDICTED: Eurytemora affinis band 7 protein AGAP004871-like (LOC111696122), transcript variant X3, mRNA. (1247 bp)
gaaccaagaacctgggagatattctttcagaacgagaatcgatagctcaggaaatgcagtccacccttgatgaagctacagatccttggggagttcaggtagagagggtagaagtaaaggatgttcgtgttccagagcagcttcaacgggccatggcagcagaagctgaagcagcaagagaagctcgtgcaaaggtcatagctgcagaaggagaacataaagctagcagagctctgcggcatgcagcagaagttattgtagacagtccagctgcattacagttgagatacctgcagaccttgaacagtatatcttgtttagttaagatacctgcagaccttgaacagtatatcttgtttagttgagatacctgcagaccttgaacagtatatctta
position 1147
XM_023465671.1 - Eurytemora affinis - NCBI
Phytophthora parasitica INRA-310 hypothetical protein partial mRNA. (587 bp)
ctgcaagccactcgctggattttttcgctcctggctgccgccgctggtcgagctgatcccaagtctgaaccagagaccaagccaaagcccagcgacgcgaaggaggaagccgtatcgcgacgccacgaagaaatcaggtgtcgcgagctcattcgactgagcggtgcagcgacgggatctcttgggcggcttcgcttgaagcgcggcaaaaacgccggaagcgcgccacgctggacaacgatctcgtcgtcaagtccagcgcagcactacgaagacgagcagctccaggccgagcgaccttgaacggtggcttcatataggccggcaaggcctgcagcccacgttggcacatgggatatcatcgcgaagccgccagatcatgttcgatcacgacgccgcgtccatctcaccgcgacccgaccttgaaccaacccggcttctatagtacacgatatcggtgatcgcaggctcctactcctctcgcaggtcaccactcaatacaattcccctttcaactagtcttttgtagctatataatataacagacctattcgttttcgcagaga
position 317
XM_008903830.1 - Phytophthora parasitica INRA-310 - NCBI
PREDICTED: Crassostrea virginica uncharacterized LOC111104979 (LOC111104979), mRNA. (1451 bp)
ORIGIN // ggaataaatcaatgaccttgaactcaacatgcaaagctgatggtacctggacatcttcggcttccgtttgccctaccggcccaccagaatgccctgttgatcaccctgacgcaaacttaaccaatgtcaaggtcacttccactagcatcgggacgactctttcttacacatgtcattggaataaatcaatgaccttgaactcaacatgcaaagctgatggtacctggacatcttcggcttccgtttgccctaccggcccaccagaatgccctgttgatcaccctgacgcaaacttaaccaatgtcaaggtcacttccactagcatcgggacgactctttcttacacatgtcattggaataaatcaatgaccttgaactcaacatgcaaagctgatggtacctggacatcttcggcttccgtttgccctaccggcccaccagaatgccctgttgatcaccctgacgcaaacttaaccaatgtcaaggtcacttccactagcatcgggacgactcttccctacacatgtcattggaatacatcaatgacattgaactcaacatgcaaggccgatggtacctggacatcttcg...
position 14
XM_022439156.1 - Crassostrea virginica (eastern oyster) - NCBI
Babesia microti strain RI partial mRNA. (2901 bp)
ctacgatgagaagatggataatttgcaaaagcagctgaaagaatacactgaaaagatcacagtgctggaaaacaacgcctctgaattcaactataaagaccaagctgaaacgttgaagacggaactggataagtcgcaactaaagataatggaactggagactatgattaaggagaacagcgaaaaaacggaaagagtgccatctcccagaaaggacaacgaggaggttgatagattaacttcggaaatattacagttgaagaatcaggtggacattctgcaaaatgaaaagactgaccttgaacaaaaattatcacaacaatctcccagaaaggacaacgaggaggttgatagattaacttcggaaatattacagttgaagaatcaggtggacattctgcaaaatgaaaagactgaccttgaacaaaaattatcacaacaatctcccagaaaggacaacgaggaagttgatagattaacttcggaaatattacagttgaagaatcaggtggacattctgcaaaatgaaaagactgaccttgaacaaaaattatcacaacaatctcccagaaaggacaacgaggaagttgatagattaac...
position 1867
XM_012794168.1 - Babesia microti strain RI - NCBI
PREDICTED: Physeter catodon leucine-rich repeat-containing protein 37A3-like (LOC112063147), partial mRNA. (711 bp)
aaaacctgtggaacttgcacttatcgtaactccagcattcactaatgaggttgaaacttctccaccccaacaagaaaccttggctccgtttacagtgtcccctgagcagttggaaattttgtcggtccagcaagaggtttcagatcagcatccaaccccctctgaaaatgttgaaccttctccaatacagcagggagcccccactcaaccaacatacttcgaggttacatttccaaatccagagcaagttcaggctcagcatccaaccttgactgaggtcacaattcaacctttggaccttgaactgaccataaggccagaacccactaaggaaggtgaaccttctccatccatgcaggagaccttaacccagcctccagaaccacctaaggaggtttttgtagctcagcctccactatatcagaacccaatagttccaacaccagttcaggatcacactgagcctccaacatcacccagtgtcagagttcaacctttagaccagggacttaccacaactccagaacctactatggaggctgaacattccacacccctgcaggaggctatagttcctccaacacaccccgaggtgacact...
position 307
XM_024118053.1 - Physeter catodon (sperm whale) - NCBI
PREDICTED: Nelumbo nucifera uncharacterized LOC104600355 (LOC104600355), transcript variant X1, ncRNA. (1498 bp)
atggatgtccagcaataaatgtctctgctttttgtctgatcagtgctggccattggtacgttgcccagcaaaaagtggatggggattgggaaattttgattttttgacaaatggttatgaagtatatatggaaagaaagtgtgaattaaggctctccatcacttcgaaacggtctcacctgtgtctctgtaattcgatcagtttgtttaatcagattcatctggagctctctacagaagctacaaccaacaagttaacagaaacaacttggccaaacccagtagttgcacagctggaccttgaaccctctaagaaaaaccaaatttttccggaggcatcagagatggtggaccaaaaggttcagtagcttgaccttgaaccctctaagaaaaaccaaattttgccggagacatcaaagatggtgggaccaaaaggttcagtagcttgaccttgaaccctctaggaaaaaccaaattttgtcggaggcatcagagatggtgggaccaaaagttctcagtagcagtaggttcatataggctgatcagaaaatccctaaaaatcttgcattaaaatcaaccagaagtcaatgtaatataaata...
position 1150
XR_002022815.1 - Nelumbo nucifera (sacred lotus) - NCBI
PREDICTED: Nelumbo nucifera uncharacterized LOC104600355 (LOC104600355), transcript variant X2, ncRNA. (1501 bp)
atggatgtccagcaataaatgtctctgctttttgtctgatcagtgctggccattggtacgttgcccagcaaaaagtggatggggattgggaaattttgattttttgacaaatggttatgaagtatatatggaaagaaagtgtgaattaaggctctccatcacttcgaaacggtctcacctgtgtctctgtaattcgatcagtttgtttaatcagattcatctggagctctctacagaagctacaaccaacaagttaacagaaacaacttggccaaacccagtagttgcacagctggaccttgaaccctctaagaaaaaccaaatttttccggaggcatcagagatggtggaccaaaaggttcagtagcttgaccttgaaccctctaagaaaaaccaaattttgccggagacatcaaagatggtgggaccaaaaggttcagtagcttgaccttgaaccctctaggaaaaaccaaattttgtcggaggcatcagagatggtgggaccaaaagttctcagtagcagtaggttcatataggctgatcagaaaatccctaaaaatcttgcattaaaatcaaccagaagtcaatgtaatataaata...
position 1153
XR_002022816.1 - Nelumbo nucifera (sacred lotus) - NCBI
PREDICTED: Mus musculus predicted gene, 42009 (Gm42009), ncRNA. (643 bp)
tggcccaagtcttacagcctcagacttctgagaacgaaattttaaaaaacggcagtttaagttatgaaaagagggacgttgtcagtcagagtctattgggataggcctctttgcacatcttcattgagaatttctagaggcccttctgcctggaaccaagaagggagaaagcttgacagcactgaattgagcatcttttgtggcctgtgcttctccccacccagcaccccctcccccttgcccttgtctctcatgtagcacaggcaaaccttgagctccttatacaacagacggtgaccttgaactcccacttgcccttgtctctcatgtagcacaggcaaaccttgagctccttatacaacagacggtgaccttgaactcc
position 557
XR_878709.2 - Mus musculus (house mouse) - NCBI - UCSC - RefEx(expression)
PREDICTED: Oreochromis niloticus uncharacterized LOC102079679 (LOC102079679), ncRNA. (2462 bp)
acacgctttgcaaaatttgtccttcccatatctcatcactcagtctttaataatagaggacctaaatttcaccacatggtgctatccaaactccactggaggactccagtgtcagtgtgaggaccagtttgcttggtcatgtaacaagtgtgatgagtacggcgcatgcagtaatgtcacctcccaaacctgtgattgcataaagggatttcctctgagtggggagttctgtcaaccaatcacaggcgtcgctccttgcccaacaccaactcctgcaccagtggactttgatatagaccttgaactgcacatcccagcatctagtgtgccccaaaatttcagtgttgtgctcagaaatattctgagaaatttctccttccccaaaatcatcactgggtctttaacactgaaagacttgaacttcaccacatggtgctatccaaactccactggaggacaccagtgtcagtgtgaagaccagtttgcttggtcatgtggcaagtgtgataagtacggcgcatgcagtaatgtcacctcacaaacctgtgattgcataaagggatttcctctgagtggggagttctgtcaaccaatcacagg...
position 1293
XR_002057560.1 - Oreochromis niloticus (Nile tilapia) - NCBI
PREDICTED: Cavia porcellus small nucleolar RNA SNORA31 (LOC111754743), ncRNA. (106 bp)
ncRNA 1..106 /ncRNA_class="snoRNA" /gene="LOC111754743" /product="small nucleolar RNA SNORA31" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00322" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:111754743" /db_xref="RFAM:RF00322" ORIGIN // ctgcatccactgatagaccttgaacaatttgttgttcttatggtttgcactaggatgataaaggaaaaatccctgcacataattctgcataattagtggtatgttt
position 16
XR_002789411.1 - Cavia porcellus (Domestic guinea pig) - NCBI
PREDICTED: Takifugu rubripes supervillin-like (LOC105419549), mRNA. (871 bp)
gttcagacccggctagtggagcccagagcaccctccctgaacagcggtgactgtttcctgctggttacaccacaacactgctttgtctggactggagaatttgcaaatgtcattgagaagaacaaggtctgactgtggtagagttaagaacttgaaaacatgtggcgtctttcatctgtggtgtgacagaagcttagggttgagaagcctgatgctatataggcagactaaccctaacacaggaagccacgcttggtgttttagaggaaacacctgggaaacagcctggcctcctgaccttgaactgaccttgaactgataaacgactctgttggtaccgtacgatggtgctgcaca
position 810
XM_011621184.1 - Takifugu rubripes (Fugu rubripes) - NCBI
PREDICTED: Dasypus novemcinctus small nucleolar RNA SNORA31 (LOC111762065), ncRNA. (122 bp)
ncRNA 1..122 /ncRNA_class="snoRNA" /gene="LOC111762065" /product="small nucleolar RNA SNORA31" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00322" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:111762065" /db_xref="RFAM:RF00322" ORIGIN // ctgcatccactgatagaccttgaacaaattgttattattttggtttgcagtagatgtgaaagaaaaagctccctgtgctttctgtctttgtggcaatccagattgaataggggaatatatgt
position 16
XR_002795276.1 - Dasypus novemcinctus (nine-banded armadillo) - NCBI
PREDICTED: Dasypus novemcinctus small nucleolar RNA SNORA31 (LOC111759323), ncRNA. (123 bp)
ncRNA 1..123 /ncRNA_class="snoRNA" /gene="LOC111759323" /product="small nucleolar RNA SNORA31" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00322" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:111759323" /db_xref="RFAM:RF00322" ORIGIN // ctgcatctactgatagaccttgaacaaattgttgttcttttggtttgcactaggatgcagaagaaaaaactccctgcactttctgcctttgtggcagcccagattgaataggggaatatatat
position 16
XR_002793347.1 - Dasypus novemcinctus (nine-banded armadillo) - NCBI
PREDICTED: Trichechus manatus latirostris small nucleolar RNA SNORA31 (LOC111821595), ncRNA. (125 bp)
ncRNA 1..125 /ncRNA_class="snoRNA" /gene="LOC111821595" /product="small nucleolar RNA SNORA31" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00322" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:111821595" /db_xref="RFAM:RF00322" ORIGIN // cttcatccaccgatagaccttgaacaatttgctgttgttattttggcttgcactaggatgcaaaaaactccctgcactttctgtctgtctttgtggcagcccagattgaatgagcgaatatatct
position 16
XR_002824961.1 - Trichechus manatus latirostris - NCBI
PREDICTED: Pteropus vampyrus small nucleolar RNA SNORA31 (LOC111731412), ncRNA. (126 bp)
ncRNA 1..126 /ncRNA_class="snoRNA" /gene="LOC111731412" /product="small nucleolar RNA SNORA31" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00322" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:111731412" /db_xref="RFAM:RF00322" ORIGIN // ctgcatccactgatagaccttgaacagtgatgttgttcttttggtttgcactaggatgcgacagcaaaatccccgcgctttctgtctgtctgtgtggcggcccagattgaataggggactacatac
position 16
XR_002777122.1 - Pteropus vampyrus (large flying fox) - NCBI
PREDICTED: Pteropus vampyrus small nucleolar RNA SNORA31 (LOC111731411), ncRNA. (126 bp)
ncRNA 1..126 /ncRNA_class="snoRNA" /gene="LOC111731411" /product="small nucleolar RNA SNORA31" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00322" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:111731411" /db_xref="RFAM:RF00322" ORIGIN // ctgcatccactgatagaccttgaacagtgatgttgttcttttggtttgcactaggatgcgacagcaaaatccccgcgctttctgtctgtctgtgtggcggcccagattgaataggggactacatac
position 16
XR_002777121.1 - Pteropus vampyrus (large flying fox) - NCBI
PREDICTED: Cavia porcellus small nucleolar RNA SNORA31 (LOC111753901), ncRNA. (126 bp)
ncRNA 1..126 /ncRNA_class="snoRNA" /gene="LOC111753901" /product="small nucleolar RNA SNORA31" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00322" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:111753901" /db_xref="RFAM:RF00322" ORIGIN // ctgcatccactgatagaccttgaacaatttgttgttcttatggtttgcactaggatgctaaaggaaaaatccctgcactttctgtctgtctttatggcagcccagattgaattggggagtacacct
position 16
XR_002788669.1 - Cavia porcellus (Domestic guinea pig) - NCBI
PREDICTED: Cavia porcellus small nucleolar RNA SNORA31 (LOC111753715), ncRNA. (126 bp)
ncRNA 1..126 /ncRNA_class="snoRNA" /gene="LOC111753715" /product="small nucleolar RNA SNORA31" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00322" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:111753715" /db_xref="RFAM:RF00322" ORIGIN // ctgcatccactgatagaccttgaacaatttgttgttcttacggtttgcacgaggatgctaaaggaaacatccctgcgctttctgtctgtctttatggcagcccagattgaattggggagtacaccc
position 16
XR_002788509.1 - Cavia porcellus (Domestic guinea pig) - NCBI
PREDICTED: Cavia porcellus small nucleolar RNA SNORA31 (LOC111756206), ncRNA. (126 bp)
ncRNA 1..126 /ncRNA_class="snoRNA" /gene="LOC111756206" /product="small nucleolar RNA SNORA31" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00322" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:111756206" /db_xref="RFAM:RF00322" ORIGIN // ctgcatctactgatagaccttgaacaatttgttgttcttatggtttgcactaggatgctaaaggaaaaatccctgcgctttctgtctgtctttatggcagcccagattgaattggggagtacacct
position 16
XR_002790682.1 - Cavia porcellus (Domestic guinea pig) - NCBI
PREDICTED: Cavia porcellus small nucleolar RNA SNORA31 (LOC111755925), ncRNA. (126 bp)
ncRNA 1..126 /ncRNA_class="snoRNA" /gene="LOC111755925" /product="small nucleolar RNA SNORA31" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00322" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:111755925" /db_xref="RFAM:RF00322" ORIGIN // gtgcatctattgatagaccttgaacaatttgttgttcttatggtttgcactaggatgctaaaggaaaaatccctgcgctttctgtctgtctatatggcagcccagattgaattggggagtacacct
position 16
XR_002790445.1 - Cavia porcellus (Domestic guinea pig) - NCBI
PREDICTED: Cavia porcellus small nucleolar RNA SNORA31 (LOC111754742), ncRNA. (126 bp)
ncRNA 1..126 /ncRNA_class="snoRNA" /gene="LOC111754742" /product="small nucleolar RNA SNORA31" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00322" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:111754742" /db_xref="RFAM:RF00322" ORIGIN // ctgcatccactgatagaccttgaacaatttgttgttcttatggtttgcactaggatgataaaggaaaaatccctacgctttctgtttgtctttatggcagcccagattgaattggggagtacacct
position 16
XR_002789410.1 - Cavia porcellus (Domestic guinea pig) - NCBI
PREDICTED: Myotis lucifugus small nucleolar RNA SNORA31 (LOC111824691), ncRNA. (127 bp)
ncRNA 1..127 /ncRNA_class="snoRNA" /gene="LOC111824691" /product="small nucleolar RNA SNORA31" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00322" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:111824691" /db_xref="RFAM:RF00322" ORIGIN // ctgcatccactgatagaccttgaacaacctgttgttcttttggtttgcactgggatgcgaaagaaaaatatccctgcgctttctgtctgtctttgtggcggcccagattgaataagggactacatct
position 16
XR_002827780.1 - Myotis lucifugus (little brown bat) - NCBI
PREDICTED: Myotis lucifugus small nucleolar RNA SNORA31 (LOC111823056), ncRNA. (127 bp)
ncRNA 1..127 /ncRNA_class="snoRNA" /gene="LOC111823056" /product="small nucleolar RNA SNORA31" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00322" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:111823056" /db_xref="RFAM:RF00322" ORIGIN // ctgcatccactgatagaccttgaacaacctgttgttcttttggtttgcactgggatgcgaaagaaaaatatccctgcgctttctgtctgtctttgtggcggcccagattgaataagggactacatct
position 16
XR_002826045.1 - Myotis lucifugus (little brown bat) - NCBI
PREDICTED: Octodon degus small nucleolar RNA SNORA31 (LOC111812390), ncRNA. (127 bp)
ncRNA 1..127 /ncRNA_class="snoRNA" /gene="LOC111812390" /product="small nucleolar RNA SNORA31" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00322" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:111812390" /db_xref="RFAM:RF00322" ORIGIN // ccgcatccactgatagaccttgaacaacttgttgttctttgggtttgcactaggatgctaaaggaaaaaatccctgcgctttctgtctgtctttatggcagcccagattgaattggggagtacatct
position 16
XR_002817898.1 - Octodon degus (degu) - NCBI
PREDICTED: Dasypus novemcinctus small nucleolar RNA SNORA31 (LOC111763998), ncRNA. (127 bp)
ncRNA 1..127 /ncRNA_class="snoRNA" /gene="LOC111763998" /product="small nucleolar RNA SNORA31" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00322" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:111763998" /db_xref="RFAM:RF00322" ORIGIN // ctgcatccactgatagaccttgaacaaattgttgttcttttggtttgcactaggatgcgaaagaaaagactccctgcgctttctgtctgtctttgtggcggcccagattgaataggggaatacatat
position 16
XR_002796709.1 - Dasypus novemcinctus (nine-banded armadillo) - NCBI
Mus musculus microRNA 3070b (Mir3070b), microRNA. (89 bp)
PUBMED 20413612 REFERENCE 3 (bases 1 to 89) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res. 34 (DATABASE ISSUE), D140-D144 (2006) PUBMED 16381832 gtgctgagtgaggctgagcccctgaccttgaacctgggatcctccccatgatcttctggtgctatggtcaggggtagattccttgtcat
position 24
Synonym: mir-3070-2; mmu-mir-3070-2; mmu-mir-3070b
NR_037231.1 - Mus musculus (house mouse) - NCBI - UCSC - RefEx(expression)
Mus musculus microRNA 3070a (Mir3070a), microRNA. (89 bp)
PUBMED 20413612 REFERENCE 3 (bases 1 to 89) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res. 34 (DATABASE ISSUE), D140-D144 (2006) PUBMED 16381832 gtgctgagtgaggctgagcccctgaccttgaacctgggatcctatccatgatctcctggtgctaccgtcaggggtagattccttgtcat
position 24
Synonym: mir-3070-1; mmu-mir-3070-1; mmu-mir-3070a
NR_037230.1 - Mus musculus (house mouse) - NCBI - UCSC - RefEx(expression)
PREDICTED: Physeter catodon small nucleolar RNA SNORA31 (LOC112066446), ncRNA. (128 bp)
ncRNA 1..128 /ncRNA_class="snoRNA" /gene="LOC112066446" /product="small nucleolar RNA SNORA31" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00322" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:112066446" /db_xref="RFAM:RF00322" ORIGIN // ctgcgtccactgatagaccttgaacaatctgctgttgttcttttggtttgcactaagatgcaaaagaaaaatccctgcgctttctgtctgtctttgtggcagcccagattgaataggggaatacattt
position 16
XR_002892663.1 - Physeter catodon (sperm whale) - NCBI
PREDICTED: Physeter catodon small nucleolar RNA SNORA31 (LOC112065444), ncRNA. (128 bp)
ncRNA 1..128 /ncRNA_class="snoRNA" /gene="LOC112065444" /product="small nucleolar RNA SNORA31" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00322" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:112065444" /db_xref="RFAM:RF00322" ORIGIN // ctgcatccactgatagaccttgaacaatctgctgttgttcttttggtttgcactaggatgcaaaagaaaaatccctgcgctttctgtctgtctgtgtggcagcccagattgaataggggaatacattt
position 16
XR_002892044.1 - Physeter catodon (sperm whale) - NCBI
PREDICTED: Pteropus vampyrus small nucleolar RNA SNORA31 (LOC111737098), ncRNA. (128 bp)
ncRNA 1..128 /ncRNA_class="snoRNA" /gene="LOC111737098" /product="small nucleolar RNA SNORA31" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00322" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:111737098" /db_xref="RFAM:RF00322" ORIGIN // catcaaccacggatagaccttgaacaaattgctattgttcgtttggattgtattagaatgagaaaggaaaaaaaatctctgtgctttctgtctttgtggcggcccagattgaatactgaaatacatct
position 16
XR_002779352.1 - Pteropus vampyrus (large flying fox) - NCBI
PREDICTED: Trichechus manatus latirostris small nucleolar RNA SNORA31 (LOC111820605), ncRNA. (129 bp)
ncRNA 1..129 /ncRNA_class="snoRNA" /gene="LOC111820605" /product="small nucleolar RNA SNORA31" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00322" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:111820605" /db_xref="RFAM:RF00322" ORIGIN // ctgcatcctctgatagaccttgaacaatttgctgttgttctttcggtttgcactaggatgcaaaagaaaaaatccctgcgctttctgtctgtctttgtggcagcccagattgaatgagggaatacatct
position 16
XR_002824150.1 - Trichechus manatus latirostris - NCBI
PREDICTED: Loxodonta africana small nucleolar RNA SNORA31 (LOC111751353), ncRNA. (129 bp)
ncRNA 1..129 /ncRNA_class="snoRNA" /gene="LOC111751353" /product="small nucleolar RNA SNORA31" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00322" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:111751353" /db_xref="RFAM:RF00322" ORIGIN // ctgcatccactgatagaccttgaacaatttgctgttgttcttttggtttgcactaggatgcgaaagaaaaaatccctgcgctttctgcctgtctttgtggcggcccagattgaatgagggaatacatct
position 16
XR_002786434.1 - Loxodonta africana (African savanna elephant) - NCBI
PREDICTED: Pongo abelii small nucleolar RNA SNORA31 (LOC112128646), ncRNA. (130 bp)
ncRNA 1..130 /ncRNA_class="snoRNA" /gene="LOC112128646" /product="small nucleolar RNA SNORA31" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00322" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:112128646" /db_xref="RFAM:RF00322" ORIGIN // ctgcatccactgatagaccttgaacaatttactgttgttcttttggtttgcactaggatgcaaaagaaagaaatccctgcgctttctgtctgtctttgtggcggcccagattgaattggggaatacatct
position 16
XR_002911136.1 - Pongo abelii (Sumatran orangutan) - NCBI
PREDICTED: Equus caballus small nucleolar RNA SNORA31 (LOC111768726), ncRNA. (130 bp)
ncRNA 1..130 /ncRNA_class="snoRNA" /gene="LOC111768726" /product="small nucleolar RNA SNORA31" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00322" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:111768726" /db_xref="RFAM:RF00322" ORIGIN // ctgcatccactgatagaccttgaacaatttgctgttgttcctttggtttgcactaggatgcgaaagaaagaaatccctgcgctttctgcctgtctctgtggcggctcagattgaataggggaatacatct
position 16
XR_002801195.1 - Equus caballus (horse) - NCBI
PREDICTED: Myotis lucifugus small nucleolar RNA SNORA42/SNORA80 family (LOC111825747), ncRNA. (132 bp)
product="small nucleolar RNA SNORA42/SNORA80 family" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00406" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:111825747" /db_xref="RFAM:RF00406" ORIGIN // gcattggtttggatttgtggcaggcccgtccccctgggtctcatagtgtcccatgccagagcaagctgtgaccttgaaccatagcctggcctctgcccataggctgcaggcactagagcagggtacacagtg
position 70
XR_002828938.1 - Myotis lucifugus (little brown bat) - NCBI
PREDICTED: Otolemur garnettii small nucleolar RNA SNORA31 (LOC111725571), ncRNA. (132 bp)
ncRNA 1..132 /ncRNA_class="snoRNA" /gene="LOC111725571" /product="small nucleolar RNA SNORA31" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00322" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:111725571" /db_xref="RFAM:RF00322" ORIGIN // ctgcatccactgatagaccttgaacaatttgctgttgttcttttggtttgcactaggatgcaaaagaaaaaatattccctgcgctttctgtctgtctttgtggcggctcagattgaattagggaatacattt
position 16
XR_002773606.1 - Otolemur garnettii (small-eared galago) - NCBI
PREDICTED: Octodon degus small nucleolar RNA SNORA64/SNORA10 family (LOC111814553), ncRNA. (133 bp)
nucleolar RNA SNORA64/SNORA10 family" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00264" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:111814553" /db_xref="RFAM:RF00264" ORIGIN // actctctccactctgcacagttacactagttgtggtgtgactttcgtacaggagagagaaagaaaagagctcttcaaaaggaccttgaactggcctcatggtggccattctttctttgaggggcactacaggt
position 81
XR_002819518.1 - Octodon degus (degu) - NCBI
PREDICTED: Octodon degus small nucleolar RNA SNORA64/SNORA10 family (LOC111815813), ncRNA. (133 bp)
nucleolar RNA SNORA64/SNORA10 family" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00264" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:111815813" /db_xref="RFAM:RF00264" ORIGIN // actctctccactctgcacagttacactagttgtggtgtgactttcgtacaggagagagaaagaaaagagctcttcaaaaggaccttgaactggcctcatggtggccattctttctttgaggggcactacagat
position 81
XR_002820447.1 - Octodon degus (degu) - NCBI
PREDICTED: Piliocolobus tephrosceles small nucleolar RNA SNORA31 (LOC111523122), ncRNA. (128 bp)
ncRNA 1..128 /ncRNA_class="snoRNA" /gene="LOC111523122" /product="small nucleolar RNA SNORA31" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00322" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:111523122" /db_xref="RFAM:RF00322" ORIGIN // ctgcatccactgatagaccttgaacaatttactgttgttcttttggtttgcactaggatgcaaaagaaaaatccctgcgctttctgtctgtctttgtggcggcccagattgaattggggaatacatct
position 16
XR_002725447.1 - Piliocolobus tephrosceles (Ugandan red Colobus) - NCBI
PREDICTED: Sarcophilus harrisii small nucleolar RNA SNORA31 (LOC111720273), ncRNA. (129 bp)
ncRNA 1..129 /ncRNA_class="snoRNA" /gene="LOC111720273" /product="small nucleolar RNA SNORA31" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00322" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:111720273" /db_xref="RFAM:RF00322" ORIGIN // ctgcatccactgatagaccttgaacaagttactgttgttcactggtttgcactagggtgccaaagagaagtcctcgcgctttctgtctgtctctctgtggcagcccagattgaatagaggaatacattt
position 16
XR_002770022.1 - Sarcophilus harrisii (Tasmanian devil) - NCBI
PREDICTED: Octodon degus small nucleolar RNA SNORA64/SNORA10 family (LOC111813644), ncRNA. (138 bp)
RNA SNORA64/SNORA10 family" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00264" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:111813644" /db_xref="RFAM:RF00264" ORIGIN // gctttctttaaaattcccgtatacattatactagttgtagtgtgactttcataccggagagagaaagaaaagagctcttcaaaaggaccttgaactggcctcatggtggccattctttctttgaggggcactacagat
position 86
XR_002818837.1 - Octodon degus (degu) - NCBI
Trichomonas vaginalis G3 hypothetical protein (TVAG_538490) partial mRNA. (1005 bp)
cgaatcgaagaagaaggaacttgaatctattccaaccgttgaagataaatcatcatctgttgaagaggaaatcaataacatcaattcacatatcaacgaaaagaattccaagaacgcagaacaagaaaagaagaacagtgaacttcaacaacaactggaatctaagaagaatgaacttgaatctattccaacagttgaagacaaatcatccgaacttgaaaacgaacttaagaacatcaattcacatatcaacgaaaagaattcaaagaactcagaaaccgatcataagaacaaggaccttgaacaagagttgaatgataagaagtctcaacttgaatccattccaaccgttgaagacaaatcatccgaactcgaaaacgaaatcaagaacatcaattcacatatcaacgaaaagaattcaaagaactcagaaactgacaagaagaacaaagatcttgaacaagagttgaatgataagaaagctcaacttgaatccattccaaccgttgaagacaaatcatccgaactcgaaaacgaaatcaagaacatcaattcacatatcaacgaaaagaattcaaagaactcagaaactgacaagaa...
position 373
XM_001283317.1 - Trichomonas vaginalis G3 - NCBI
PREDICTED: Cavia porcellus uncharacterized LOC106028467 (LOC106028467), transcript variant X4, ncRNA. (152 bp)
ncRNA_class="lncRNA" /gene="LOC106028467" /product="uncharacterized LOC106028467, transcript variant X4" /db_xref="GeneID:106028467" ORIGIN // cgcgtctatctaagcgcccttccgctgggctaccgcctgccccgagctccctgcgtgcaccgcgcgccgctcggtgcggtagcggggattgctttcaggacctcatgcatactagagtcttactatgcagttcaggctgaccttgaactcac
position 139
XR_002792089.1 - Cavia porcellus (Domestic guinea pig) - NCBI

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/GACCTTGAAC
lang : en | div : | spe : | query_string : GACCTTGAAC | format : html | download :

0.000 | 0.000 | search_start;
0.224 | 0.224 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACCTTGAAC)?to=0&format=json
0.404 | 0.181 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACCTTGAAC)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.410 | 0.005 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]