GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2017-09-24 13:52:35, GGRNA : RefSeq release 83 (Jul, 2017)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Pan paniscus NLR family, pyrin domain containing 12 (NLRP12), transcript variant X2, mRNA. (3580 bp)
acgacctgggagactggggcctgtggttgctggctgaggggctgcaacatcctgcctgcagactccagaaactgtggctggatagctgtggcctcacagccaaggcttgtaagaatctttacttcaccctggggatcaaccagaccttgaccgacctttacctgacgaacaacgccctaggggacacaggcgtccgactgctttgcaagcggctgagccatcctggctgcaaactccgagtcctctggttatttgggatggacctgaataaaatgacccacagtaggttggcagcgcttcgagtaacaaaaccttatttggacattggctgctgaatggtcctatctgctggctctcccctgagatctggacagaggaagatgggagggtgctcatcacccccacagcataatgatcagcctccttcctagagacagactcatgcagattgagatcaaaagtccctctgcttgggatcaaattaatgtttgacagagctg
position 3351
XM_003830143.2 - Pan paniscus (pygmy chimpanzee) - NCBI
PREDICTED: Pan paniscus NLR family, pyrin domain containing 12 (NLRP12), transcript variant X3, mRNA. (3702 bp)
atgagctgggggacctcggggtgctgctgctgtgtgagggcctcaggcatcccacgtgcaagctccagaccctccggctggatagctgtggcctcacagccaaggcttgtaagaatctttacttcaccctggggatcaaccagaccttgaccgacctttacctgacgaacaacgccctaggggacacaggcgtccgactgctttgcaagcggctgagccatcctggctgcaaactccgagtcctctggttatttgggatggacctgaataaaatgacccacagtaggttggcagcgcttcgagtaacaaaaccttatttggacattggctgctgaatggtcctatctgctggctctcccctgagatctggacagaggaagatgggagggtgctcatcacccccacagcataatgatcagcctccttcctagagacagactcatgcagattgagatcaaaagtccctctgcttgggatcaaattaatgtttgacagagctggccaggcgtggtggctcatgtatgtaatcccagcacttcgagaggccgaggcaggtggatcacgaggtcaggagtttgagatcagcctggccaagatggt...
position 3180
XM_003830145.2 - Pan paniscus (pygmy chimpanzee) - NCBI
PREDICTED: Pan paniscus NLR family, pyrin domain containing 12 (NLRP12), transcript variant X1, mRNA. (3876 bp)
acgacctgggagactggggcctgtggttgctggctgaggggctgcaacatcctgcctgcagactccagaaactgtggctggatagctgtggcctcacagccaaggcttgtaagaatctttacttcaccctggggatcaaccagaccttgaccgacctttacctgacgaacaacgccctaggggacacaggcgtccgactgctttgcaagcggctgagccatcctggctgcaaactccgagtcctctggttatttgggatggacctgaataaaatgacccacagtaggttggcagcgcttcgagtaacaaaaccttatttggacattggctgctgaatggtcctatctgctggctctcccctgagatctggacagaggaagatgggagggtgctcatcacccccacagcataatgatcagcctccttcctagagacagactcatgcagattgagatcaaaagtccctctgcttgggatcaaattaatgtttgacagagctggccaggcgtggtggctcatgtatgtaatcccagcacttcgagaggccgaggcaggtggatcacgaggtcaggagtttgagatcagcctggccaagatggt...
position 3354
XM_008955557.1 - Pan paniscus (pygmy chimpanzee) - NCBI
PREDICTED: Homo sapiens NLR family, pyrin domain containing 12 (NLRP12), transcript variant X8, mRNA. (3295 bp)
acgacctgggagactggggcctgtggttgctggctgaggggctgcaacatcccgcctgcagactccagaaactgtggctggatagctgtggcctcacagccaaggcttgtgagaatctttacttcaccctggggatcaaccagaccttgaccgacctttacctgaccaacaacgccctaggggacacaggtgtccgactgctttgcaagcggctgagccatcctggctgcaaactccgagtcctctggttatttgggatggacctgaataaaatgacccacagtaggttggcagcgcttcgagtaacaaaaccttatttggacattggctgctgaatggtcctatctgctggctctcccctgagatctggacagaggaagatgggagggtgctcatcacccccccagcataatgatcagcctccttcctagagacagactcatgcagattgagatcaaaagtccctctgcttgggatcaaattaatgtttgacagagctggccaggcgtggtggctcatgtatgtaatcctagcacttcgagaggccgaggcaggtggatcacgaggtcaggagtttgagattagcctggccaagatggt...
position 2925
Synonym: CLR19.3; FCAS2; NALP12; PAN6; PYPAF7; RNO; RNO2
XM_017027464.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens NLR family, pyrin domain containing 12 (NLRP12), transcript variant X11, mRNA. (3297 bp)
acgacctgggagactggggcctgtggttgctggctgaggggctgcaacatcccgcctgcagactccagaaactgtggctggatagctgtggcctcacagccaaggcttgtgagaatctttacttcaccctggggatcaaccagaccttgaccgacctttacctgaccaacaacgccctaggggacacaggtgtccgactgctttgcaagcggctgagccatcctggctgcaaactccgagtcctctggttatttgggatggacctgaataaaatgacccacagtaggttggcagcgcttcgagtaacaaaaccttatttggacattggctgctgaatggtcctatctgctggctctcccctgagatctggacagaggaagatgggagggtgctcatcacccccccagcataatgatcagcctccttcctagagacagactcatgcagattgagatcaaaagtccctctgcttgggatcaaattaatgtttgacagagctggccaggcgtggtggctcatgtatgtaatcctagcacttcgagaggccgaggcaggtggatcacgaggtcaggagtttgagattagcctggccaagatggt...
position 2927
Synonym: CLR19.3; FCAS2; NALP12; PAN6; PYPAF7; RNO; RNO2
XM_017027467.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens NLR family, pyrin domain containing 12 (NLRP12), transcript variant X6, mRNA. (3382 bp)
atgcactggaggatttgggcctgaggttactatgccagggactgaggcacccagtctgcagactacggactttgtggctggatagctgtggcctcacagccaaggcttgtgagaatctttacttcaccctggggatcaaccagaccttgaccgacctttacctgaccaacaacgccctaggggacacaggtgtccgactgctttgcaagcggctgagccatcctggctgcaaactccgagtcctctggttatttgggatggacctgaataaaatgacccacagtaggttggcagcgcttcgagtaacaaaaccttatttggacattggctgctgaatggtcctatctgctggctctcccctgagatctggacagaggaagatgggagggtgctcatcacccccccagcataatgatcagcctccttcctagagacagactcatgcagattgagatcaaaagtccctctgcttgggatcaaattaatgtttgacagagctggccaggcgtggtggctcatgtatgtaatcctagcacttcgagaggccgaggcaggtggatcacgaggtcaggagtttgagattagcctggccaagatggt...
position 3012
Synonym: CLR19.3; FCAS2; NALP12; PAN6; PYPAF7; RNO; RNO2
XM_011527482.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens NLR family, pyrin domain containing 12 (NLRP12), transcript variant X4, mRNA. (3412 bp)
atgagctgggggacctcggggtgctgctgctgtgtgagggcctcaggcatcccacgtgcaagctccagaccctgcggttgggcatctgccggctgggctctgccgcctgtgagggtctttctgtggtgctccaggccaaccacaacctccgggagctggacttgagtttcaacgacctgggagactggggcctgtggttgctggctgaggggctgcaacatcccgcctgcagactccagaaactgtggttatttgggatggacctgaataaaatgacccacagtaggttggcagcgcttcgagtaacaaaaccttatttggacattggctgctgaatggtcctatctgctggctctcccctgagatctggacagaggaagatgggagggtgctcatcacccccccagcataatgatcagcctccttcctagagacagactcatgcagattgagatcaaaagtccctctgcttgggatcaaattaatgtttgacagagctg
position 3183
Synonym: CLR19.3; FCAS2; NALP12; PAN6; PYPAF7; RNO; RNO2
XM_017027461.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens NLR family, pyrin domain containing 12 (NLRP12), transcript variant X7, mRNA. (3497 bp)
acgacctgggagactggggcctgtggttgctggctgaggggctgcaacatcccgcctgcagactccagaaactgtggctggatagctgtggcctcacagccaaggcttgtgagaatctttacttcaccctggggatcaaccagaccttgaccgacctttacctgaccaacaacgccctaggggacacaggtgtccgactgctttgcaagcggctgagccatcctggctgcaaactccgagtcctctggttatttgggatggacctgaataaaatgacccacagtaggttggcagcgcttcgagtaacaaaaccttatttggacattggctgctgaatggtcctatctgctggctctcccctgagatctggacagaggaagatgggagggtgctcatcacccccccagcataatgatcagcctccttcctagagacagactcatgcagattgagatcaaaagtccctctgcttgggatcaaattaatgtttgacagagctggccaggcgtggtggctcatgtatgtaatcctagcacttcgagaggccgaggcaggtggatcacgaggtcaggagtttgagattagcctggccaagatggt...
position 3127
Synonym: CLR19.3; FCAS2; NALP12; PAN6; PYPAF7; RNO; RNO2
XM_017027463.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens NLR family, pyrin domain containing 12 (NLRP12), transcript variant X10, mRNA. (3502 bp)
acgacctgggagactggggcctgtggttgctggctgaggggctgcaacatcccgcctgcagactccagaaactgtggctggatagctgtggcctcacagccaaggcttgtgagaatctttacttcaccctggggatcaaccagaccttgaccgacctttacctgaccaacaacgccctaggggacacaggtgtccgactgctttgcaagcggctgagccatcctggctgcaaactccgagtcctctggttatttgggatggacctgaataaaatgacccacagtaggttggcagcgcttcgagtaacaaaaccttatttggacattggctgctgaatggtcctatctgctggctctcccctgagatctggacagaggaagatgggagggtgctcatcacccccccagcataatgatcagcctccttcctagagacagactcatgcagattgagatcaaaagtccctctgcttgggatcaaattaatgtttgacagagctggccaggcgtggtggctcatgtatgtaatcctagcacttcgagaggccgaggcaggtggatcacgaggtcaggagtttgagattagcctggccaagatggt...
position 3132
Synonym: CLR19.3; FCAS2; NALP12; PAN6; PYPAF7; RNO; RNO2
XM_017027466.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens NLR family, pyrin domain containing 12 (NLRP12), transcript variant X9, mRNA. (3505 bp)
acgacctgggagactggggcctgtggttgctggctgaggggctgcaacatcccgcctgcagactccagaaactgtggctggatagctgtggcctcacagccaaggcttgtgagaatctttacttcaccctggggatcaaccagaccttgaccgacctttacctgaccaacaacgccctaggggacacaggtgtccgactgctttgcaagcggctgagccatcctggctgcaaactccgagtcctctggttatttgggatggacctgaataaaatgacccacagtaggttggcagcgcttcgagtaacaaaaccttatttggacattggctgctgaatggtcctatctgctggctctcccctgagatctggacagaggaagatgggagggtgctcatcacccccccagcataatgatcagcctccttcctagagacagactcatgcagattgagatcaaaagtccctctgcttgggatcaaattaatgtttgacagagctggccaggcgtggtggctcatgtatgtaatcctagcacttcgagaggccgaggcaggtggatcacgaggtcaggagtttgagattagcctggccaagatggt...
position 3135
Synonym: CLR19.3; FCAS2; NALP12; PAN6; PYPAF7; RNO; RNO2
XM_017027465.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens NLR family, pyrin domain containing 12 (NLRP12), transcript variant X5, mRNA. (3550 bp)
acgacctgggagactggggcctgtggttgctggctgaggggctgcaacatcccgcctgcagactccagaaactgtggctggatagctgtggcctcacagccaaggcttgtgagaatctttacttcaccctggggatcaaccagaccttgaccgacctttacctgaccaacaacgccctaggggacacaggtgtccgactgctttgcaagcggctgagccatcctggctgcaaactccgagtcctctggttatttgggatggacctgaataaaatgacccacagtaggttggcagcgcttcgagtaacaaaaccttatttggacattggctgctgaatggtcctatctgctggctctcccctgagatctggacagaggaagatgggagggtgctcatcacccccccagcataatgatcagcctccttcctagagacagactcatgcagattgagatcaaaagtccctctgcttgggatcaaattaatgtttgacagagctggccaggcgtggtggctcatgtatgtaatcctagcacttcgagaggccgaggcaggtggatcacgaggtcaggagtttgagattagcctggccaagatggt...
position 3180
Synonym: CLR19.3; FCAS2; NALP12; PAN6; PYPAF7; RNO; RNO2
XM_017027462.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens NLR family, pyrin domain containing 12 (NLRP12), transcript variant X3, mRNA. (3553 bp)
atgagctgggggacctcggggtgctgctgctgtgtgagggcctcaggcatcccacgtgcaagctccagaccctgcggctggatagctgtggcctcacagccaaggcttgtgagaatctttacttcaccctggggatcaaccagaccttgaccgacctttacctgaccaacaacgccctaggggacacaggtgtccgactgctttgcaagcggctgagccatcctggctgcaaactccgagtcctctggttatttgggatggacctgaataaaatgacccacagtaggttggcagcgcttcgagtaacaaaaccttatttggacattggctgctgaatggtcctatctgctggctctcccctgagatctggacagaggaagatgggagggtgctcatcacccccccagcataatgatcagcctccttcctagagacagactcatgcagattgagatcaaaagtccctctgcttgggatcaaattaatgtttgacagagctggccaggcgtggtggctcatgtatgtaatcctagcacttcgagaggccgaggcaggtggatcacgaggtcaggagtttgagattagcctggccaagatggt...
position 3183
Synonym: CLR19.3; FCAS2; NALP12; PAN6; PYPAF7; RNO; RNO2
XM_011527480.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Homo sapiens NLR family, pyrin domain containing 12 (NLRP12), transcript variant X2, mRNA. (3553 bp)
acgacctgggagactggggcctgtggttgctggctgaggggctgcaacatcccgcctgcagactccagaaactgtggctggatagctgtggcctcacagccaaggcttgtgagaatctttacttcaccctggggatcaaccagaccttgaccgacctttacctgaccaacaacgccctaggggacacaggtgtccgactgctttgcaagcggctgagccatcctggctgcaaactccgagtcctctggttatttgggatggacctgaataaaatgacccacagtaggttggcagcgcttcgagtaacaaaaccttatttggacattggctgctgaatggtcctatctgctggctctcccctgagatctggacagaggaagatgggagggtgctcatcacccccccagcataatgatcagcctccttcctagagacagactcatgcagattgagatcaaaagtccctctgcttgggatcaaattaatgtttgacagagctggccaggcgtggtggctcatgtatgtaatcctagcacttcgagaggccgaggcaggtggatcacgaggtcaggagtttgagattagcctggccaagatggt...
position 3183
Synonym: CLR19.3; FCAS2; NALP12; PAN6; PYPAF7; RNO; RNO2
XM_011527479.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Pan troglodytes NLR family, pyrin domain containing 12 (NLRP12), transcript variant X3, mRNA. (3675 bp)
atgagctgggggacctcggggtgctgctgctgtgtgagggcctcaggcatcccacgtgcaagctccagaccctccggctggatagctgtggcctcacagccaaggcttgtaagaatctttacttcaccctggggatcaaccagaccttgaccgacctttacctgacgaacaacgccctaggggacacaggcgtccgactgctttgcaagcggctgagccatcctggctgcaaactccgagtcctctggttatttgggatggacctgaataaaatgacccacagtaggttggcagcgcttcgagtaacaaaaccttatttggacattggctgctgaatggtcctatctgctggctctcccctgagatctggacagaggaagatgggagggtgctcatcacccccacagcataatgatcagcctccttcctagagacagactcatgcagattgagatcaaaagtccctctgcttgggatcaaattaatgtttgacagagctggccaggcgtggtggctcatgtatgtaatcccagcacttcgagaggccgaggcaggtggatcacgag
position 3380
XM_016936755.1 - Pan troglodytes (chimpanzee) - NCBI
PREDICTED: Homo sapiens NLR family, pyrin domain containing 12 (NLRP12), transcript variant X1, mRNA. (3721 bp)
tcaacgacctgggagactggggcctgtggttgctggctgaggggctgcaacatcccgcctgcagactccagaaactgctggatagctgtggcctcacagccaaggcttgtgagaatctttacttcaccctggggatcaaccagaccttgaccgacctttacctgaccaacaacgccctaggggacacaggtgtccgactgctttgcaagcggctgagccatcctggctgcaaactccgagtcctctggttatttgggatggacctgaataaaatgacccacagtaggttggcagcgcttcgagtaacaaaaccttatttggacattggctgctgaatggtcctatctgctggctctcccctgagatctggacagaggaagatgggagggtgctcatcacccccccagcataatgatcagcctccttcctagagacagactcatgcagattgagatcaaaagtccctctgcttgggatcaaattaatgtttgacagagctggccaggcgtggtggctcatgtatgtaatcctagcacttcgagaggccgaggcaggtggatcacgaggtcaggagtttgagattagcctggccaagatggt...
position 3351
Synonym: CLR19.3; FCAS2; NALP12; PAN6; PYPAF7; RNO; RNO2
XM_017027460.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
PREDICTED: Pan troglodytes NLR family, pyrin domain containing 12 (NLRP12), transcript variant X2, mRNA. (3777 bp)
acgacctgggagactggggcctgtggttgctggctgaggggctgcaacatcctgcctgcagactccagaaactgtggctggatagctgtggcctcacagccaaggcttgtaagaatctttacttcaccctggggatcaaccagaccttgaccgacctttacctgacgaacaacgccctaggggacacaggcgtccgactgctttgcaagcggctgagccatcctggctgcaaactccgagtcctctggttatttgggatggacctgaataaaatgacccacagtaggttggcagcgcttcgagtaacaaaaccttatttggacattggctgctgaatggtcctatctgctggctctcccctgagatctggacagaggaagatgggagggtgctcatcacccccacagcataatgatcagcctccttcctagagacagactcatgcagattgagatcaaaagtccctctgcttgggatcaaattaatgtttgacagagctg
position 3548
XM_524387.4 - Pan troglodytes (chimpanzee) - NCBI
PREDICTED: Pan troglodytes NLR family, pyrin domain containing 12 (NLRP12), transcript variant X1, mRNA. (3809 bp)
acgacctgggagactggggcctgtggttgctggctgaggggctgcaacatcctgcctgcagactccagaaactgtggctggatagctgtggcctcacagccaaggcttgtaagaatctttacttcaccctggggatcaaccagaccttgaccgacctttacctgacgaacaacgccctaggggacacaggcgtccgactgctttgcaagcggctgagccatcctggctgcaaactccgagtcctctggttatttgggatggacctgaataaaatgacccacagtaggttggcagcgcttcgagtaacaaaaccttatttggacattggctgctgaatggaagatgggagggtgctcatcacccccacagcataatgatcagcctccttcctagagacagactcatgcagattgagatcaaaagtccctctgcttgggatcaaattaatgtttgacagagctggccaggcgtggtggctcatgtatgtaatcccagcacttcgagaggccgaggcaggtggatcacgag
position 3552
XM_009436255.2 - Pan troglodytes (chimpanzee) - NCBI
PREDICTED: Pan troglodytes NLR family, pyrin domain containing 12 (NLRP12), transcript variant X4, mRNA. (3901 bp)
atgagctgggggacctcggggtgctgctgctgtgtgagggcctcaggcatcccacgtgcaagctccagaccctccggctggatagctgtggcctcacagccaaggcttgtaagaatctttacttcaccctggggatcaaccagaccttgaccgacctttacctgacgaacaacgccctaggggacacaggcgtccgactgctttgcaagcggctgagccatcctggctgcaaactccgagtcctctggttatttgggatggacctgaataaaatgacccacagtaggttggcagcgcttcgagtaacaaaaccttatttggacattggctgctgaatggtcctatctgctggctctcccctgagatctggacagaggaagatgggagggtgctcatcacccccacagcataatgatcagcctccttcctagagacagactcatgcagattgagatcaaaagtccctctgcttgggatcaaattaatgtttgacagagctggccaggcgtggtggctcatgtatgtaatcccagcacttcgagaggccgaggcaggtggatcacgaggtcaggagtttgagatcagcctggccaagatggt...
position 3376
XM_009436257.2 - Pan troglodytes (chimpanzee) - NCBI
Homo sapiens NLR family pyrin domain containing 12 (NLRP12), transcript variant 4, mRNA. (3709 bp)
atgagctgggggacctcggggtgctgctgctgtgtgagggcctcaggcatcccacgtgcaagctccagaccctgcggctggatagctgtggcctcacagccaaggcttgtgagaatctttacttcaccctggggatcaaccagaccttgaccgacctttacctgaccaacaacgccctaggggacacaggtgtccgactgctttgcaagcggctgagccatcctggctgcaaactccgagtcctctggttatttgggatggacctgaataaaatgacccacagtaggttggcagcgcttcgagtaacaaaaccttatttggacattggctgctgaatggtcctatctgctggctctcccctgagatctggacagaggaagatgggagggtgctcatcacccccccagcataatgatcagcctccttcctagagacagactcatgcagattgagatcaaaagtccctctgcttgggatcaaattaatgtttgacagagctggccaggcgtggtggctcatgtatgtaatcctagcacttcgagaggccgaggcaggtggatcacgaggtcaggagtttgagattagcctggccaagatggt...
position 3180
Synonym: CLR19.3; FCAS2; NALP12; PAN6; PYPAF7; RNO; RNO2
NM_001277129.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens NLR family pyrin domain containing 12 (NLRP12), transcript variant 2, mRNA. (3880 bp)
acgacctgggagactggggcctgtggttgctggctgaggggctgcaacatcccgcctgcagactccagaaactgtggctggatagctgtggcctcacagccaaggcttgtgagaatctttacttcaccctggggatcaaccagaccttgaccgacctttacctgaccaacaacgccctaggggacacaggtgtccgactgctttgcaagcggctgagccatcctggctgcaaactccgagtcctctggttatttgggatggacctgaataaaatgacccacagtaggttggcagcgcttcgagtaacaaaaccttatttggacattggctgctgaatggtcctatctgctggctctcccctgagatctggacagaggaagatgggagggtgctcatcacccccccagcataatgatcagcctccttcctagagacagactcatgcagattgagatcaaaagtccctctgcttgggatcaaattaatgtttgacagagctggccaggcgtggtggctcatgtatgtaatcctagcacttcgagaggccgaggcaggtggatcacgaggtcaggagtttgagattagcctggccaagatggt...
position 3351
Synonym: CLR19.3; FCAS2; NALP12; PAN6; PYPAF7; RNO; RNO2
NM_144687.3 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)
Homo sapiens NLR family pyrin domain containing 12 (NLRP12), transcript variant 3, mRNA. (3883 bp)
acgacctgggagactggggcctgtggttgctggctgaggggctgcaacatcccgcctgcagactccagaaactgtggctggatagctgtggcctcacagccaaggcttgtgagaatctttacttcaccctggggatcaaccagaccttgaccgacctttacctgaccaacaacgccctaggggacacaggtgtccgactgctttgcaagcggctgagccatcctggctgcaaactccgagtcctctggttatttgggatggacctgaataaaatgacccacagtaggttggcagcgcttcgagtaacaaaaccttatttggacattggctgctgaatggtcctatctgctggctctcccctgagatctggacagaggaagatgggagggtgctcatcacccccccagcataatgatcagcctccttcctagagacagactcatgcagattgagatcaaaagtccctctgcttgggatcaaattaatgtttgacagagctggccaggcgtggtggctcatgtatgtaatcctagcacttcgagaggccgaggcaggtggatcacgaggtcaggagtttgagattagcctggccaagatggt...
position 3354
Synonym: CLR19.3; FCAS2; NALP12; PAN6; PYPAF7; RNO; RNO2
NM_001277126.1 - Homo sapiens (human) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/A_23_P101434
lang : en | div : | spe : | query_string : A_23_P101434 | format : html | download :

0.000 | 0.000 | search_start;
0.075 | 0.075 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAATGACCCACAGTAGGTTGGCAGCGCTTCGAGTAACAAAACCTTATTTGGACATTGGCT)?to=0&format=json
0.283 | 0.208 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAATGACCCACAGTAGGTTGGCAGCGCTTCGAGTAACAAAACCTTATTTGGACATTGGCT)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.285 | 0.002 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]