2024-05-19 06:06:47, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_053318 1484 bp mRNA linear ROD 07-MAY-2023 DEFINITION Rattus norvegicus hemopexin (Hpx), mRNA. ACCESSION NM_053318 VERSION NM_053318.1 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 1484) AUTHORS Detsika MG and Lianos EA. TITLE Hemopexin Modulates Expression of Complement Regulatory Proteins in Rat Glomeruli JOURNAL Curr Issues Mol Biol 43 (2), 1081-1089 (2021) PUBMED 34563046 REMARK GeneRIF: Hemopexin Modulates Expression of Complement Regulatory Proteins in Rat Glomeruli. Publication Status: Online-Only REFERENCE 2 (bases 1 to 1484) AUTHORS Liu Y, Tan C, Li W, Liu X, Wang X, Gui Y, Qin L, Deng F, Hu C and Chen L. TITLE Adenoviral transfer of hemopexin gene attenuates oxidative stress and apoptosis in cultured primary cortical neuron cell exposed to blood clot JOURNAL Neuroreport 31 (15), 1065-1071 (2020) PUBMED 32804709 REMARK GeneRIF: Adenoviral transfer of hemopexin gene attenuates oxidative stress and apoptosis in cultured primary cortical neuron cell exposed to blood clot. REFERENCE 3 (bases 1 to 1484) AUTHORS Hahl P, Hunt R, Bjes ES, Skaff A, Keightley A and Smith A. TITLE Identification of oxidative modifications of hemopexin and their predicted physiological relevance JOURNAL J Biol Chem 292 (33), 13658-13671 (2017) PUBMED 28596380 REMARK GeneRIF: Data suggest that apo-hemopexin isolated from plasma exchibits low endogenous levels of tyrosine nitration in the peptide YYCFQGNQFLR in the heme-binding site of human hemopexin, which was similarly nitrated in rabbit and rat hemopexins; heme binding by hemopexin declined as tyrosine nitration proceeded in vitro. REFERENCE 4 (bases 1 to 1484) AUTHORS Bastos-Amador P, Royo F, Gonzalez E, Conde-Vancells J, Palomo-Diez L, Borras FE and Falcon-Perez JM. TITLE Proteomic analysis of microvesicles from plasma of healthy donors reveals high individual variability JOURNAL J Proteomics 75 (12), 3574-3584 (2012) PUBMED 22516433 REFERENCE 5 (bases 1 to 1484) AUTHORS Takagi T, Naito Y, Okada H, Takaoka M, Oya-Ito T, Yamada S, Hirai Y, Mizushima K, Yoshida N, Kamada K, Katada K, Uchiyama K, Ishikawa T, Handa O, Yagi N, Konishi H, Kokura S, Ichikawa H and Yoshikawa T. TITLE Hemopexin is upregulated in rat intestinal mucosa injured by indomethacin JOURNAL J Gastroenterol Hepatol 27 Suppl 3, 70-75 (2012) PUBMED 22486875 REMARK GeneRIF: Hemopexin was identified as upregulated protein in the small intestine exposed to indomethacin. REFERENCE 6 (bases 1 to 1484) AUTHORS Tolosano E, Hirsch E, Patrucco E, Camaschella C, Navone R, Silengo L and Altruda F. TITLE Defective recovery and severe renal damage after acute hemolysis in hemopexin-deficient mice JOURNAL Blood 94 (11), 3906-3914 (1999) PUBMED 10572107 REFERENCE 7 (bases 1 to 1484) AUTHORS Nagae Y and Muller-Eberhard U. TITLE Identification of an interleukin-6 responsive element and characterization of the proximal promoter region of the rat hemopexin gene JOURNAL Biochem Biophys Res Commun 185 (1), 420-429 (1992) PUBMED 1599480 REFERENCE 8 (bases 1 to 1484) AUTHORS Swerts JP, Soula C, Sagot Y, Guinaudy MJ, Guillemot JC, Ferrara P, Duprat AM and Cochard P. TITLE Hemopexin is synthesized in peripheral nerves but not in central nervous system and accumulates after axotomy JOURNAL J Biol Chem 267 (15), 10596-10600 (1992) PUBMED 1587840 REFERENCE 9 (bases 1 to 1484) AUTHORS Nikkila H, Gitlin JD and Muller-Eberhard U. TITLE Rat hemopexin. Molecular cloning, primary structural characterization, and analysis of gene expression JOURNAL Biochemistry 30 (3), 823-829 (1991) PUBMED 1988069 REFERENCE 10 (bases 1 to 1484) AUTHORS Wellner D, Cheng KC and Muller-Eberhard U. TITLE N-terminal amino acid sequences of the hemopexins from chicken, rat and rabbit JOURNAL Biochem Biophys Res Commun 155 (2), 622-625 (1988) PUBMED 3421961 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from M62642.1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: FQ210231.1, FQ211176.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA5756307, SAMEA5760400 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..1484 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="Sprague-Dawley" /db_xref="taxon:10116" /chromosome="1" /map="1q32" gene 1..1484 /gene="Hpx" /gene_synonym="Hpxn" /note="hemopexin" /db_xref="GeneID:58917" /db_xref="RGD:62040" exon 1..105 /gene="Hpx" /gene_synonym="Hpxn" /inference="alignment:Splign:2.1.0" CDS 23..1405 /gene="Hpx" /gene_synonym="Hpxn" /EC_number="3.2.1.35" /codon_start=1 /product="hemopexin precursor" /protein_id="NP_445770.1" /db_xref="GeneID:58917" /db_xref="RGD:62040" /translation="
MARTVVALNILVLLGLCWSLAVANPLPAAHETVAKGENGTKPDSDVIEHCSDAWSFDATTMDHNGTMLFFKGEFVWRGHSGIRELISERWKNPVTSVDAAFRGPDSVFLIKEDKVWVYPPEKKENGYPKLFQEESPGIPYPPDAAVECHRGECQSEGVLFFQGNRKWFWDFATRTQKERSWPAVGNCTAALRWLERYYCFQGNKFLRFNPVTGEVPPRYPLDARDYFISCPGRGHGKLRNGTAHGNSTHPMHSRCNADPGLSALLSDHRGATYAFSGSHYWRLDSSRDGWHSWPIAHHWPQGPSAVDAAFSWDEKVYLIQGTQVYVFLTKGGNNLVSGYPKRLEKELGSPPGISLDTIDAAFSCPGSSKLYVTSGRRLWWLDLKSGAQATWAELSWPHEKVDGALCLEKSLGPYSCSSNGPNLFFIHGPNLYCYSSIDKLNAAKSLPQPQKVNSILGCSQ"
sig_peptide 23..91 /gene="Hpx" /gene_synonym="Hpxn" /inference="COORDINATES: ab initio prediction:SignalP:4.0" mat_peptide 92..1402 /gene="Hpx" /gene_synonym="Hpxn" /product="hemopexin" misc_feature 134..136 /gene="Hpx" /gene_synonym="Hpxn" /note="N-linked (GlcNAc...) asparagine. /evidence=ECO:0000255; propagated from UniProtKB/Swiss-Prot (P20059.3); glycosylation site" misc_feature 176..712 /gene="Hpx" /gene_synonym="Hpxn" /note="Hemopexin-like repeats.; Hemopexin is a heme-binding protein that transports heme to the liver. Hemopexin-like repeats occur in vitronectin and some matrix metalloproteinases family (matrixins). The HX repeats of some matrixins bind tissue inhibitor of...; Region: HX; cd00094" /db_xref="CDD:238046" misc_feature 179..301 /gene="Hpx" /gene_synonym="Hpxn" /note="propagated from UniProtKB/Swiss-Prot (P20059.3); Region: Hemopexin 1" misc_feature order(191..193,197..199,314..316,320..322,449..451, 455..457,584..586,590..592) /gene="Hpx" /gene_synonym="Hpxn" /note="Metal binding sites [ion binding]; metal-binding site" /db_xref="CDD:238046" misc_feature 212..214 /gene="Hpx" /gene_synonym="Hpxn" /note="N-linked (GlcNAc...) asparagine. /evidence=ECO:0000255; propagated from UniProtKB/Swiss-Prot (P20059.3); glycosylation site" misc_feature 302..436 /gene="Hpx" /gene_synonym="Hpxn" /note="propagated from UniProtKB/Swiss-Prot (P20059.3); Region: Hemopexin 2" misc_feature 437..571 /gene="Hpx" /gene_synonym="Hpxn" /note="propagated from UniProtKB/Swiss-Prot (P20059.3); Region: Hemopexin 3" misc_feature 572..712 /gene="Hpx" /gene_synonym="Hpxn" /note="propagated from UniProtKB/Swiss-Prot (P20059.3); Region: Hemopexin 4" misc_feature 578..580 /gene="Hpx" /gene_synonym="Hpxn" /note="N-linked (GlcNAc...) asparagine. /evidence=ECO:0000255; propagated from UniProtKB/Swiss-Prot (P20059.3); glycosylation site" misc_feature 740..742 /gene="Hpx" /gene_synonym="Hpxn" /note="N-linked (GlcNAc...) asparagine. /evidence=ECO:0000255; propagated from UniProtKB/Swiss-Prot (P20059.3); glycosylation site" misc_feature 758..760 /gene="Hpx" /gene_synonym="Hpxn" /note="N-linked (GlcNAc...) asparagine. /evidence=ECO:0000255; propagated from UniProtKB/Swiss-Prot (P20059.3); glycosylation site" misc_feature 791..928 /gene="Hpx" /gene_synonym="Hpxn" /note="propagated from UniProtKB/Swiss-Prot (P20059.3); Region: Hemopexin 5" misc_feature 827..1396 /gene="Hpx" /gene_synonym="Hpxn" /note="Hemopexin-like repeats.; Hemopexin is a heme-binding protein that transports heme to the liver. Hemopexin-like repeats occur in vitronectin and some matrix metalloproteinases family (matrixins). The HX repeats of some matrixins bind tissue inhibitor of...; Region: HX; cd00094" /db_xref="CDD:238046" misc_feature 929..1072 /gene="Hpx" /gene_synonym="Hpxn" /note="propagated from UniProtKB/Swiss-Prot (P20059.3); Region: Hemopexin 6" misc_feature 1085..1204 /gene="Hpx" /gene_synonym="Hpxn" /note="propagated from UniProtKB/Swiss-Prot (P20059.3); Region: Hemopexin 7" misc_feature 1214..1366 /gene="Hpx" /gene_synonym="Hpxn" /note="propagated from UniProtKB/Swiss-Prot (P20059.3); Region: Hemopexin 8" exon 106..164 /gene="Hpx" /gene_synonym="Hpxn" /inference="alignment:Splign:2.1.0" exon 165..236 /gene="Hpx" /gene_synonym="Hpxn" /inference="alignment:Splign:2.1.0" exon 237..355 /gene="Hpx" /gene_synonym="Hpxn" /inference="alignment:Splign:2.1.0" exon 356..509 /gene="Hpx" /gene_synonym="Hpxn" /inference="alignment:Splign:2.1.0" exon 510..722 /gene="Hpx" /gene_synonym="Hpxn" /inference="alignment:Splign:2.1.0" exon 723..851 /gene="Hpx" /gene_synonym="Hpxn" /inference="alignment:Splign:2.1.0" exon 852..982 /gene="Hpx" /gene_synonym="Hpxn" /inference="alignment:Splign:2.1.0" exon 983..1145 /gene="Hpx" /gene_synonym="Hpxn" /inference="alignment:Splign:2.1.0" exon 1146..1484 /gene="Hpx" /gene_synonym="Hpxn" /inference="alignment:Splign:2.1.0" ORIGIN
tgtgtggtctttgcagctcgccatggctaggacagtagtagcactaaatatcctggtattgctgggcctgtgctggtccctggctgttgccaaccctcttcctgctgcccatgagactgttgctaaaggtgaaaatgggaccaagccagactcagatgtaatcgaacactgctcagatgcctggagctttgacgctaccaccatggatcacaatgggaccatgctgttctttaaaggggagtttgtgtggaggggtcactcagggatccgggagttaatctcagagaggtggaagaatcccgtcacctcagtggatgctgcattccgtggtcctgacagtgtcttcctgatcaaggaagacaaagtctgggtgtatcctcctgaaaagaaagagaacgggtatccaaagttgttccaagaagagtctcctggaatcccatacccaccagacgcagctgtggaatgccaccgtggagaatgccagagtgaaggtgtcctcttcttccaaggtaaccgcaagtggttctgggactttgccacaagaacccaaaaggaacgttcctggcctgctgttgggaattgcactgcggccttgaggtggcttgaacgctactactgcttccagggtaacaagttcctgagatttaaccccgtcacaggagaggtgcctcccagataccctctggatgcccgtgactacttcatatcctgccctggcagaggccatggtaaactaagaaatggaactgctcatgggaatagcacccatcctatgcattcgcgttgtaacgcagatcctggcctgtctgcactgctgtctgaccatcgaggtgccacctatgccttcagtggctcccactactggcgtctggactccagccgtgatgggtggcatagctggcccattgctcatcactggccccagggtccttcagcagtagatgctgccttttcctgggatgagaaagtctatctgatccagggcactcaagtatatgtcttcctgacgaaggggggcaataacctagtaagtggttatccaaagcggctggagaaggaacttgggagccctcccgggatcagccttgataccatagatgcagccttttcctgccctggttcttccaagctctacgtcacatcaggacggcggctttggtggctggacctgaagtcaggagcccaggcgacatgggcagagctttcctggccccatgagaaagttgatggtgccctgtgtttggaaaagtcccttggtccctactcatgctcttccaatggtcccaacttgttctttatccatgggcccaatttatactgctatagcagtatagacaaactgaatgcagccaagagtctgcctcagccccagaaagtgaacagcatccttggctgcagtcaataaaaagccctgatgggaattagcccagcccaccccacctctccatttccattctaataaaaccagatggtttcttcacatg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]