GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-19 04:49:47, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_031142               1800 bp    mRNA    linear   ROD 20-MAR-2023
DEFINITION  Rattus norvegicus double C2 domain beta (Doc2b), mRNA.
ACCESSION   NM_031142
VERSION     NM_031142.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1800)
  AUTHORS   Brouwer I, Giniatullina A, Laurens N, van Weering JRT, Bald D,
            Wuite GJL and Groffen AJ.
  TITLE     Direct quantitative detection of Doc2b-induced hemifusion in
            optically trapped membranes
  JOURNAL   Nat Commun 6, 8387 (2015)
   PUBMED   26395669
  REMARK    GeneRIF: acts directly on membranes and stabilizes hemifusion
            intermediate in cell-free system
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1800)
  AUTHORS   Xue R, Gaffaney JD and Chapman ER.
  TITLE     Structural elements that underlie Doc2beta function during
            asynchronous synaptic transmission
  JOURNAL   Proc Natl Acad Sci U S A 112 (31), E4316-E4325 (2015)
   PUBMED   26195798
  REMARK    GeneRIF: these data reveal the key determinants of Doc2beta that
            underlie its function during the slow phase of synaptic
            transmission.
REFERENCE   3  (bases 1 to 1800)
  AUTHORS   Gaffaney JD, Xue R and Chapman ER.
  TITLE     Mutations that disrupt Ca(2)-binding activity endow Doc2beta with
            novel functional properties during synaptic transmission
  JOURNAL   Mol Biol Cell 25 (4), 481-494 (2014)
   PUBMED   24356452
  REMARK    GeneRIF: Mutations that disrupt Ca(2)-binding activity endow
            Doc2beta with novel functional properties during synaptic
            transmission.
REFERENCE   4  (bases 1 to 1800)
  AUTHORS   Yu H, Rathore SS, Davis EM, Ouyang Y and Shen J.
  TITLE     Doc2b promotes GLUT4 exocytosis by activating the SNARE-mediated
            fusion reaction in a calcium- and membrane bending-dependent manner
  JOURNAL   Mol Biol Cell 24 (8), 1176-1184 (2013)
   PUBMED   23427263
  REMARK    GeneRIF: Doc2b exocytotic functions appear to be distinct from how
            synaptotagmin-1 promotes synaptic neurotransmitter release.
REFERENCE   5  (bases 1 to 1800)
  AUTHORS   Yao J, Gaffaney JD, Kwon SE and Chapman ER.
  TITLE     Doc2 is a Ca2+ sensor required for asynchronous neurotransmitter
            release
  JOURNAL   Cell 147 (3), 666-677 (2011)
   PUBMED   22036572
REFERENCE   6  (bases 1 to 1800)
  AUTHORS   Ke B, Oh E and Thurmond DC.
  TITLE     Doc2beta is a novel Munc18c-interacting partner and positive
            effector of syntaxin 4-mediated exocytosis
  JOURNAL   J Biol Chem 282 (30), 21786-21797 (2007)
   PUBMED   17548353
REFERENCE   7  (bases 1 to 1800)
  AUTHORS   Korteweg N, Denekamp FA, Verhage M and Burbach JP.
  TITLE     Different spatiotemporal expression of DOC2 genes in the developing
            rat brain argues for an additional, nonsynaptic role of DOC2B in
            early development
  JOURNAL   Eur J Neurosci 12 (1), 165-171 (2000)
   PUBMED   10651871
REFERENCE   8  (bases 1 to 1800)
  AUTHORS   Nagano F, Orita S, Sasaki T, Naito A, Sakaguchi G, Maeda M,
            Watanabe T, Kominami E, Uchiyama Y and Takai Y.
  TITLE     Interaction of Doc2 with tctex-1, a light chain of cytoplasmic
            dynein. Implication in dynein-dependent vesicle transport
  JOURNAL   J Biol Chem 273 (46), 30065-30068 (1998)
   PUBMED   9804756
REFERENCE   9  (bases 1 to 1800)
  AUTHORS   Verhage M, de Vries KJ, Roshol H, Burbach JP, Gispen WH and Sudhof
            TC.
  TITLE     DOC2 proteins in rat brain: complementary distribution and proposed
            function as vesicular adapter proteins in early stages of secretion
  JOURNAL   Neuron 18 (3), 453-461 (1997)
   PUBMED   9115738
REFERENCE   10 (bases 1 to 1800)
  AUTHORS   Kojima T, Fukuda M, Aruga J and Mikoshiba K.
  TITLE     Calcium-dependent phospholipid binding to the C2A domain of a
            ubiquitous form of double C2 protein (Doc2 beta)
  JOURNAL   J Biochem 120 (3), 671-676 (1996)
   PUBMED   8902635
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from U70778.2.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: U70778.2 [ECO:0000332]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..1800
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /db_xref="taxon:10116"
                     /chromosome="10"
                     /map="10q24"
     gene            1..1800
                     /gene="Doc2b"
                     /note="double C2 domain beta"
                     /db_xref="GeneID:81820"
                     /db_xref="RGD:620519"
     exon            1..528
                     /gene="Doc2b"
                     /inference="alignment:Splign:2.1.0"
     CDS             156..1394
                     /gene="Doc2b"
                     /function="probably functions in vesicular trafficking"
                     /note="doc2-beta; double C2, beta; double C2-like domains,
                     beta"
                     /codon_start=1
                     /product="double C2-like domain-containing protein beta"
                     /protein_id="NP_112404.1"
                     /db_xref="GeneID:81820"
                     /db_xref="RGD:620519"
                     /translation="
MTLRRRGEKATISIQEHMAIDVCPGPIRPIKQISDYFPRFPRGLPPTAAPRASAPPDAPARSPAATAGPRSPSDGARDDDEDVDQLFGAYGASPGPSPGPSPVRPPAKPPEDEPDADGYESDDCTALGTLDFSLLYDQENNALHCTISKAKGLKPMDHNGLADPYVKLHLLPGASKANKLRTKTLRNTLNPSWNETLTYYGITDEDMIRKTLRISVCDEDKFRHNEFIGETRVPLKKLKPNHTKTFSICLEKQLPVDKAEDKSLEERGRILISLKYSSQKQGLLVGIVRCAHLAAMDANGYSDPYVKTYLKPDVDKKSKHKTAVKKKTLNPEFNEEFCYEIKHGDLAKKTLEVTVWDYDIGKSNDFIGGVVLGINAKGERLKHWFDCLKNKDKRIERWHTLTNEIPGAVLSD"
     misc_feature    156..425
                     /gene="Doc2b"
                     /note="propagated from UniProtKB/Swiss-Prot (P70610.2);
                     Region: Mediates interaction with DYNLT1.
                     /evidence=ECO:0000250"
     misc_feature    156..263
                     /gene="Doc2b"
                     /note="propagated from UniProtKB/Swiss-Prot (P70610.2);
                     Region: Negatively regulates targeting to plasma membrane.
                     /evidence=ECO:0000250"
     misc_feature    216..>413
                     /gene="Doc2b"
                     /note="large tegument protein UL36; Provisional; Region:
                     PHA03247"
                     /db_xref="CDD:223021"
     misc_feature    267..524
                     /gene="Doc2b"
                     /note="propagated from UniProtKB/Swiss-Prot (P70610.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    534..905
                     /gene="Doc2b"
                     /note="C2 domain first repeat present in Rabphilin and
                     Double C2 domain; Region: C2A_Rabphilin_Doc2; cd04035"
                     /db_xref="CDD:176000"
     misc_feature    order(624..626,642..644,807..809,813..815,831..833)
                     /gene="Doc2b"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:176000"
     misc_feature    924..1280
                     /gene="Doc2b"
                     /note="propagated from UniProtKB/Swiss-Prot (P70610.2);
                     Region: Mediates interaction with STXBP3.
                     /evidence=ECO:0000250"
     misc_feature    960..1358
                     /gene="Doc2b"
                     /note="C2 domain second repeat present in Rabphilin and
                     Double C2 domain; Region: C2B_Rabphilin_Doc2; cd08384"
                     /db_xref="CDD:176030"
     misc_feature    order(1044..1046,1062..1064,1224..1226,1230..1232,
                     1248..1250)
                     /gene="Doc2b"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:176030"
     misc_feature    1386..1388
                     /gene="Doc2b"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:22673903; propagated from
                     UniProtKB/Swiss-Prot (P70610.2); phosphorylation site"
     exon            529..608
                     /gene="Doc2b"
                     /inference="alignment:Splign:2.1.0"
     exon            609..683
                     /gene="Doc2b"
                     /inference="alignment:Splign:2.1.0"
     exon            684..793
                     /gene="Doc2b"
                     /inference="alignment:Splign:2.1.0"
     exon            794..920
                     /gene="Doc2b"
                     /inference="alignment:Splign:2.1.0"
     exon            921..1078
                     /gene="Doc2b"
                     /inference="alignment:Splign:2.1.0"
     exon            1079..1160
                     /gene="Doc2b"
                     /inference="alignment:Splign:2.1.0"
     exon            1161..1257
                     /gene="Doc2b"
                     /inference="alignment:Splign:2.1.0"
     exon            1258..1800
                     /gene="Doc2b"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
gccgccgccgagcaggcagcagccgcgtcagggccgtccgggggccacaccggcgatgcccgcagcccccgcagcgccccgcgggacccgctgacttacccccgggccggggtcataccgggccgggccgggccgcgagcggcggcgctgcctgcatgaccctccggaggcgcggggagaaggcgaccatcagcatccaagagcatatggccatcgacgtgtgtcccgggcccatccggcctatcaagcagatctccgattacttcccccgcttcccgcggggcctcccccccaccgccgcgccccgcgcctccgcgcccccggacgcccccgcgcgctcgcccgcagccaccgccggcccccgcagcccctccgacggcgcccgcgacgacgacgaagatgtggaccagctcttcggagcctacggtgccagcccaggccccagccccggacccagccccgtgaggccgccggccaagccccccgaggacgaaccggacgccgacggctacgagtcagacgactgcaccgccctgggtacactggacttcagtctgctctatgaccaggagaacaacgcactgcactgcaccatcagcaaagccaagggcctgaagccgatggatcacaatggactggctgatccctacgtcaaactacacttgctgcctggagccagcaaggcaaataagctcagaacaaaaaccctacggaacactctgaacccctcctggaacgagaccctcacctattacgggatcacggatgaggacatgatccgaaagaccctgaggatctccgtgtgtgacgaggacaaattccgccacaacgagttcatcggagagactcgagtgcccctgaagaagctgaaacccaaccacaccaagacattcagcatctgcctggagaagcagctgccggtggacaaggcagaggacaagtccctggaggagcgtggccgcatcctcatctctctcaagtacagctcacagaagcagggcctgctggtgggcatcgttcgctgcgcacacctggcggccatggatgctaacggctactcagacccctacgtgaaaacatatctgaaaccagatgtagacaagaaatccaagcataagaccgcagtcaagaagaaaacactaaaccctgaattcaatgaggagttctgttacgagatcaagcatggagacctagccaaaaagaccctggaggtcactgtctgggactatgatattggaaaatccaatgatttcatcggtggggtggttctgggcatcaatgccaagggtgagcgcctgaagcactggtttgactgtctgaagaacaaggacaagaggattgagcgttggcacacgctcaccaatgagatcccaggggctgtactcagcgactgactgtcccatctgctgccacccacccttgccacccagcccacacaggtccaaccctgggctttctcagctgccaccaagggctgtggccctcacaatgggcaagatccaggttgtctgctcggacatagccactgcagcccctgctaggaggctaggaggccaagagcacccagcctctcgcagagggacaggaaaacacaacatgaaacctgtttcagctcccctggcaccccaaagggccagagctgggagaaatcctcagcctcagctctgtccagtggaagggctatctacagtgaggacctatcagaggtgaggggtggaaccctgctgcaagcacagaaatgggggtactctggctacctggagaccacagagggaggactatgggcaggcagagcccagg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]